diff --git a/.buildinfo b/.buildinfo index bddae694..2232eaec 100644 --- a/.buildinfo +++ b/.buildinfo @@ -1,4 +1,4 @@ # Sphinx build info version 1 # This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done. -config: b11a49c99066da48d26675bff2f5edc9 +config: ac8ae6f5178219d3fadeb9e68b57bc56 tags: 645f666f9bcd5a90fca523b33c5a78b7 diff --git a/_modules/index.html b/_modules/index.html index fbddde47..fbbff19a 100644 --- a/_modules/index.html +++ b/_modules/index.html @@ -5,14 +5,14 @@ - Overview: module code — pydna 0.0.0.post1+91b3dd0 documentation + Overview: module code — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna.html b/_modules/pydna.html index 86313c5e..e6114627 100644 --- a/_modules/pydna.html +++ b/_modules/pydna.html @@ -5,14 +5,14 @@ - pydna — pydna 0.0.0.post1+91b3dd0 documentation + pydna — pydna 0.0.0.post1+30792a3 documentation - + @@ -218,7 +218,7 @@

Source code for pydna

 __maintainer__ = "Björn Johansson"
 __email__ = "bjorn_johansson@bio.uminho.pt"
 __status__ = "Development"  # "Production" #"Prototype"
-__version__ = "0.0.0-post.1+91b3dd0"
+__version__ = "0.0.0-post.1+30792a3"
 
 
 # create config directory
diff --git a/_modules/pydna/amplicon.html b/_modules/pydna/amplicon.html
index 178f5c0b..13ee8591 100644
--- a/_modules/pydna/amplicon.html
+++ b/_modules/pydna/amplicon.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.amplicon — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.amplicon — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
diff --git a/_modules/pydna/amplify.html b/_modules/pydna/amplify.html
index 4903710b..a10ca17f 100644
--- a/_modules/pydna/amplify.html
+++ b/_modules/pydna/amplify.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.amplify — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.amplify — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
diff --git a/_modules/pydna/assembly.html b/_modules/pydna/assembly.html
index 74090f82..4cc3881e 100644
--- a/_modules/pydna/assembly.html
+++ b/_modules/pydna/assembly.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.assembly — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.assembly — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
diff --git a/_modules/pydna/common_sub_strings.html b/_modules/pydna/common_sub_strings.html
index 0b158557..d941d427 100644
--- a/_modules/pydna/common_sub_strings.html
+++ b/_modules/pydna/common_sub_strings.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.common_sub_strings — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.common_sub_strings — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
diff --git a/_modules/pydna/contig.html b/_modules/pydna/contig.html
index 21c29d64..e6fb3dec 100644
--- a/_modules/pydna/contig.html
+++ b/_modules/pydna/contig.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.contig — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.contig — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
diff --git a/_modules/pydna/design.html b/_modules/pydna/design.html
index 43b81374..6e3c0c96 100644
--- a/_modules/pydna/design.html
+++ b/_modules/pydna/design.html
@@ -5,14 +5,14 @@
 
   
   
-  pydna.design — pydna 0.0.0.post1+91b3dd0 documentation
+  pydna.design — pydna 0.0.0.post1+30792a3 documentation
       
       
 
   
       
       
-      
+      
       
       
     
@@ -310,7 +310,7 @@ 

Source code for pydna.design

 
 
[docs] -def assembly_fragments(f, overlap=35, maxlink=40): +def assembly_fragments(f, overlap=35, maxlink=40, circular=False): """This function return a list of :mod:`pydna.amplicon.Amplicon` objects where primers have been modified with tails so that the fragments can be fused in the order they appear in the list by for example Gibson assembly or homologous @@ -637,6 +637,9 @@

Source code for pydna.design

     maxlink : int, optional
         Maximum length of spacer sequences that may be present in f. These will be included in tails for designed primers.
 
+    circular : bool, optional
+        If True, the assembly is circular. If False, the assembly is linear.
+
     Returns
     -------
     seqs : list of :mod:`pydna.amplicon.Amplicon` and other Dseqrecord like objects :mod:`pydna.amplicon.Amplicon` objects
@@ -694,6 +697,15 @@ 

Source code for pydna.design

     >>>
 
     """
+
+    # Recursive call for circular assemblies
+    if circular:
+        fragments = assembly_fragments(f + f[0:1], overlap=overlap, maxlink=maxlink, circular=False)
+
+        if hasattr(fragments[0], "template"):
+            fragments[0] = _pcr((fragments[-1].forward_primer, fragments[0].reverse_primer), fragments[0].template)
+        return fragments[:-1]
+
     # sanity check for arguments
     nf = [item for item in f if len(item) > maxlink]
     if not all(hasattr(i[0], "template") or hasattr(i[1], "template") for i in zip(nf, nf[1:])):
@@ -819,11 +831,19 @@ 

Source code for pydna.design

 
[docs] def circular_assembly_fragments(f, overlap=35, maxlink=40): - fragments = assembly_fragments(f + f[0:1], overlap=overlap, maxlink=maxlink) + """ + Equivalent to `assembly_fragments` with `circular=True`. - if hasattr(fragments[0], "template"): - fragments[0] = _pcr((fragments[-1].forward_primer, fragments[0].reverse_primer), fragments[0].template) - return fragments[:-1]
+ Deprecated, kept for backward compatibility. Use `assembly_fragments` with `circular=True` instead. + """ + import warnings + + warnings.warn( + "The circular_assembly_fragments function is deprecated. Use assembly_fragments with circular=True instead.", + DeprecationWarning, + stacklevel=2, + ) + return assembly_fragments(f, overlap=overlap, maxlink=maxlink, circular=True)
diff --git a/_modules/pydna/dseq.html b/_modules/pydna/dseq.html index cb7b3383..5e45ebd1 100644 --- a/_modules/pydna/dseq.html +++ b/_modules/pydna/dseq.html @@ -5,14 +5,14 @@ - pydna.dseq — pydna 0.0.0.post1+91b3dd0 documentation + pydna.dseq — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/dseqrecord.html b/_modules/pydna/dseqrecord.html index e8320cf3..7c167e46 100644 --- a/_modules/pydna/dseqrecord.html +++ b/_modules/pydna/dseqrecord.html @@ -5,14 +5,14 @@ - pydna.dseqrecord — pydna 0.0.0.post1+91b3dd0 documentation + pydna.dseqrecord — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/editor.html b/_modules/pydna/editor.html index ad9fab63..6365a486 100644 --- a/_modules/pydna/editor.html +++ b/_modules/pydna/editor.html @@ -5,14 +5,14 @@ - pydna.editor — pydna 0.0.0.post1+91b3dd0 documentation + pydna.editor — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/gel.html b/_modules/pydna/gel.html index f26f9663..4e28ae53 100644 --- a/_modules/pydna/gel.html +++ b/_modules/pydna/gel.html @@ -5,14 +5,14 @@ - pydna.gel — pydna 0.0.0.post1+91b3dd0 documentation + pydna.gel — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/genbank.html b/_modules/pydna/genbank.html index e8e1c3c6..6361d1ef 100644 --- a/_modules/pydna/genbank.html +++ b/_modules/pydna/genbank.html @@ -5,14 +5,14 @@ - pydna.genbank — pydna 0.0.0.post1+91b3dd0 documentation + pydna.genbank — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/genbankfile.html b/_modules/pydna/genbankfile.html index bc300576..f95eb6e0 100644 --- a/_modules/pydna/genbankfile.html +++ b/_modules/pydna/genbankfile.html @@ -5,14 +5,14 @@ - pydna.genbankfile — pydna 0.0.0.post1+91b3dd0 documentation + pydna.genbankfile — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/genbankfixer.html b/_modules/pydna/genbankfixer.html index 96576c60..6680cd47 100644 --- a/_modules/pydna/genbankfixer.html +++ b/_modules/pydna/genbankfixer.html @@ -5,14 +5,14 @@ - pydna.genbankfixer — pydna 0.0.0.post1+91b3dd0 documentation + pydna.genbankfixer — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/genbankrecord.html b/_modules/pydna/genbankrecord.html index 435e8496..8da8a7ba 100644 --- a/_modules/pydna/genbankrecord.html +++ b/_modules/pydna/genbankrecord.html @@ -5,14 +5,14 @@ - pydna.genbankrecord — pydna 0.0.0.post1+91b3dd0 documentation + pydna.genbankrecord — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/myprimers.html b/_modules/pydna/myprimers.html index 6bd6af16..b337e1a6 100644 --- a/_modules/pydna/myprimers.html +++ b/_modules/pydna/myprimers.html @@ -5,14 +5,14 @@ - pydna.myprimers — pydna 0.0.0.post1+91b3dd0 documentation + pydna.myprimers — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/parsers.html b/_modules/pydna/parsers.html index 95a07d1b..2e9f2bbe 100644 --- a/_modules/pydna/parsers.html +++ b/_modules/pydna/parsers.html @@ -5,14 +5,14 @@ - pydna.parsers — pydna 0.0.0.post1+91b3dd0 documentation + pydna.parsers — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/primer.html b/_modules/pydna/primer.html index 90473025..6602a1ca 100644 --- a/_modules/pydna/primer.html +++ b/_modules/pydna/primer.html @@ -5,14 +5,14 @@ - pydna.primer — pydna 0.0.0.post1+91b3dd0 documentation + pydna.primer — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/readers.html b/_modules/pydna/readers.html index b912f6a3..93649c3a 100644 --- a/_modules/pydna/readers.html +++ b/_modules/pydna/readers.html @@ -5,14 +5,14 @@ - pydna.readers — pydna 0.0.0.post1+91b3dd0 documentation + pydna.readers — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/seqrecord.html b/_modules/pydna/seqrecord.html index 7d1b5491..70571ea9 100644 --- a/_modules/pydna/seqrecord.html +++ b/_modules/pydna/seqrecord.html @@ -5,14 +5,14 @@ - pydna.seqrecord — pydna 0.0.0.post1+91b3dd0 documentation + pydna.seqrecord — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/threading_timer_decorator_exit.html b/_modules/pydna/threading_timer_decorator_exit.html index b2ebcd7d..004e8fda 100644 --- a/_modules/pydna/threading_timer_decorator_exit.html +++ b/_modules/pydna/threading_timer_decorator_exit.html @@ -5,14 +5,14 @@ - pydna.threading_timer_decorator_exit — pydna 0.0.0.post1+91b3dd0 documentation + pydna.threading_timer_decorator_exit — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/tm.html b/_modules/pydna/tm.html index 913cb5f8..d7d0b96a 100644 --- a/_modules/pydna/tm.html +++ b/_modules/pydna/tm.html @@ -5,14 +5,14 @@ - pydna.tm — pydna 0.0.0.post1+91b3dd0 documentation + pydna.tm — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_modules/pydna/utils.html b/_modules/pydna/utils.html index 9c8ac3e8..3fb81834 100644 --- a/_modules/pydna/utils.html +++ b/_modules/pydna/utils.html @@ -5,14 +5,14 @@ - pydna.utils — pydna 0.0.0.post1+91b3dd0 documentation + pydna.utils — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/_static/documentation_options.js b/_static/documentation_options.js index 35d8741f..47167bba 100644 --- a/_static/documentation_options.js +++ b/_static/documentation_options.js @@ -1,5 +1,5 @@ const DOCUMENTATION_OPTIONS = { - VERSION: '0.0.0.post1+91b3dd0', + VERSION: '0.0.0.post1+30792a3', LANGUAGE: 'en', COLLAPSE_INDEX: false, BUILDER: 'html', diff --git a/genindex.html b/genindex.html index 07eed4a6..8df246ae 100644 --- a/genindex.html +++ b/genindex.html @@ -5,14 +5,14 @@ - Index — pydna 0.0.0.post1+91b3dd0 documentation + Index — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/index.html b/index.html index a667e8f2..b856ca4f 100644 --- a/index.html +++ b/index.html @@ -6,14 +6,14 @@ - Welcome to pydna’s documentation! — pydna 0.0.0.post1+91b3dd0 documentation + Welcome to pydna’s documentation! — pydna 0.0.0.post1+30792a3 documentation - + @@ -3150,7 +3150,7 @@

Examples of pydna in use
-pydna.design.assembly_fragments(f, overlap=35, maxlink=40)[source]
+pydna.design.assembly_fragments(f, overlap=35, maxlink=40, circular=False)[source]

This function return a list of pydna.amplicon.Amplicon objects where primers have been modified with tails so that the fragments can be fused in the order they appear in the list by for example Gibson assembly or homologous @@ -3419,6 +3419,7 @@

Examples of pydna in usepydna.amplicon.Amplicon and other Dseqrecord like objects) – list Amplicon and Dseqrecord object for which fusion primers should be constructed.

  • overlap (int, optional) – Length of required overlap between fragments.

  • maxlink (int, optional) – Maximum length of spacer sequences that may be present in f. These will be included in tails for designed primers.

  • +
  • circular (bool, optional) – If True, the assembly is circular. If False, the assembly is linear.

  • Returns:
    @@ -3483,7 +3484,9 @@

    Examples of pydna in use
    pydna.design.circular_assembly_fragments(f, overlap=35, maxlink=40)[source]
    -
    +

    Equivalent to assembly_fragments with circular=True.

    +

    Deprecated, kept for backward compatibility. Use assembly_fragments with circular=True instead.

    +
    diff --git a/py-modindex.html b/py-modindex.html index 97c1137b..8f295626 100644 --- a/py-modindex.html +++ b/py-modindex.html @@ -5,14 +5,14 @@ - Python Module Index — pydna 0.0.0.post1+91b3dd0 documentation + Python Module Index — pydna 0.0.0.post1+30792a3 documentation - + diff --git a/search.html b/search.html index fb848631..ffde90e6 100644 --- a/search.html +++ b/search.html @@ -5,7 +5,7 @@ - Search — pydna 0.0.0.post1+91b3dd0 documentation + Search — pydna 0.0.0.post1+30792a3 documentation @@ -13,7 +13,7 @@ - + diff --git a/searchindex.js b/searchindex.js index 979729e4..5b463542 100644 --- a/searchindex.js +++ b/searchindex.js @@ -1 +1 @@ -Search.setIndex({"alltitles": {"Examples of pydna in use": [[0, "examples-of-pydna-in-use"]], "How to get more help": [[0, "how-to-get-more-help"]], "How to use the documentation": [[0, "how-to-use-the-documentation"]], "Indices and tables": [[0, "indices-and-tables"]], "Module contents": [[0, "module-pydna"]], "Welcome to pydna\u2019s documentation!": [[0, null]], "pydna": [[0, "pydna"]], "pydna package layout": [[0, "pydna-package-layout"]], "pydna source code": [[0, "pydna-source-code"]], "pydna.amplicon module": [[0, "module-pydna.amplicon"]], "pydna.amplify module": [[0, "module-pydna.amplify"]], "pydna.assembly module": [[0, "module-pydna.assembly"]], "pydna.common_sub_strings module": [[0, "module-pydna.common_sub_strings"]], "pydna.contig module": [[0, "module-pydna.contig"]], "pydna.design module": [[0, "module-pydna.design"]], "pydna.download module": [[0, "module-pydna.download"]], "pydna.dseq module": [[0, "module-pydna.dseq"]], "pydna.dseqrecord module": [[0, "module-pydna.dseqrecord"]], "pydna.editor module": [[0, "module-pydna.editor"]], "pydna.gel module": [[0, "module-pydna.gel"]], "pydna.genbank module": [[0, "module-pydna.genbank"]], "pydna.genbankfile module": [[0, "module-pydna.genbankfile"]], "pydna.genbankfixer module": [[0, "module-pydna.genbankfixer"]], "pydna.genbankrecord module": [[0, "module-pydna.genbankrecord"]], "pydna.myprimers module": [[0, "module-pydna.myprimers"]], "pydna.parsers module": [[0, "module-pydna.parsers"]], "pydna.primer module": [[0, "module-pydna.primer"]], "pydna.readers module": [[0, "module-pydna.readers"]], "pydna.seqrecord module": [[0, "module-pydna.seqrecord"]], "pydna.tm module": [[0, "module-pydna.tm"]], "pydna.utils module": [[0, "module-pydna.utils"]]}, "docnames": ["index"], "envversion": {"sphinx": 63, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1}, "filenames": ["index.rst"], "indexentries": {"accessed (pydna.myprimers.primerlist property)": [[0, "pydna.myprimers.PrimerList.accessed", false]], "accession (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.accession", false]], "add_colors_to_features_for_ape() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_colors_to_features_for_ape", false]], "add_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.add_feature", false]], "add_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_feature", false]], "amplicon (class in pydna.amplicon)": [[0, "pydna.amplicon.Amplicon", false]], "anneal (class in pydna.amplify)": [[0, "pydna.amplify.Anneal", false]], "ape() (in module pydna.editor)": [[0, "pydna.editor.ape", false]], "apply_cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.apply_cut", false]], "apply_cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.apply_cut", false]], "assemble_circular() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_circular", false]], "assemble_linear() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_linear", false]], "assembly (class in pydna.assembly)": [[0, "pydna.assembly.Assembly", false]], "assembly_fragments() (in module pydna.design)": [[0, "pydna.design.assembly_fragments", false]], "assign_numbers() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.assign_numbers", false]], "biopython_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.biopython_code", false]], "cai() (in module pydna.utils)": [[0, "pydna.utils.cai", false]], "cai() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.cai", false]], "cai() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.cai", false]], "cas9() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cas9", false]], "cas9() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cas9", false]], "check_primer_numbers() (in module pydna.myprimers)": [[0, "pydna.myprimers.check_primer_numbers", false]], "circular (pydna.dseqrecord.dseqrecord property)": [[0, "pydna.dseqrecord.Dseqrecord.circular", false]], "circular_assembly_fragments() (in module pydna.design)": [[0, "pydna.design.circular_assembly_fragments", false]], "code() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.code", false]], "comment() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.comment", false]], "common_sub_strings() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.common_sub_strings", false]], "complement() (in module pydna.utils)": [[0, "pydna.utils.complement", false]], "concat_dict() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.concat_dict", false]], "contig (class in pydna.contig)": [[0, "pydna.contig.Contig", false]], "copy() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.copy", false]], "copy_fasta_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_fasta_to_clipboard", false]], "copy_gb_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_gb_to_clipboard", false]], "cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cut", false]], "cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cut", false]], "cuts_overlap() (in module pydna.utils)": [[0, "pydna.utils.cuts_overlap", false]], "cutsite_is_valid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutsite_is_valid", false]], "cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutters", false]], "cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cutters", false]], "datefunction() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.datefunction", false]], "dbd_program() (in module pydna.tm)": [[0, "pydna.tm.dbd_program", false]], "dbd_program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.dbd_program", false]], "definition (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.definition", false]], "detailed_figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.detailed_figure", false]], "dseq (class in pydna.dseq)": [[0, "pydna.dseq.Dseq", false]], "dseqrecord (class in pydna.dseqrecord)": [[0, "pydna.dseqrecord.Dseqrecord", false]], "dump() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.dump", false]], "editor (class in pydna.editor)": [[0, "pydna.editor.Editor", false]], "embl_gb_fasta() (in module pydna.parsers)": [[0, "pydna.parsers.embl_gb_fasta", false]], "eq() (in module pydna.utils)": [[0, "pydna.utils.eq", false]], "exo1_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_end", false]], "exo1_front() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_front", false]], "express() (in module pydna.utils)": [[0, "pydna.utils.express", false]], "express() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.express", false]], "express() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.express", false]], "extract_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.extract_feature", false]], "extract_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.extract_feature", false]], "extract_from_text() (in module pydna.parsers)": [[0, "pydna.parsers.extract_from_text", false]], "figure() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.figure", false]], "figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.figure", false]], "figure() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.figure", false]], "fill_in() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.fill_in", false]], "find() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.find", false]], "find() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find", false]], "find_aa() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aa", false]], "find_aminoacids() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aminoacids", false]], "find_duplicate_primers() (in module pydna.myprimers)": [[0, "pydna.myprimers.find_duplicate_primers", false]], "five_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.five_prime_end", false]], "flatten() (in module pydna.utils)": [[0, "pydna.utils.flatten", false]], "footprint (pydna.primer.primer property)": [[0, "pydna.primer.Primer.footprint", false]], "format() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.format", false]], "forward_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.forward_primers", false]], "from_bio_seqrecord() (pydna.seqrecord.seqrecord class method)": [[0, "pydna.seqrecord.SeqRecord.from_Bio_SeqRecord", false]], "from_full_sequence_and_overhangs() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_full_sequence_and_overhangs", false]], "from_representation() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_representation", false]], "from_seqrecord() (pydna.amplicon.amplicon class method)": [[0, "pydna.amplicon.Amplicon.from_SeqRecord", false]], "from_seqrecord() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_SeqRecord", false]], "from_seqrecord() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankfile.genbankfile class method)": [[0, "pydna.genbankfile.GenbankFile.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_SeqRecord", false]], "from_string() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_string", false]], "from_string() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_string", false]], "from_string() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_string", false]], "from_string() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_string", false]], "gbtext_clean() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.gbtext_clean", false]], "gc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.gc", false]], "gc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.gc", false]], "gel() (in module pydna.gel)": [[0, "pydna.gel.gel", false]], "genbank (class in pydna.genbank)": [[0, "pydna.genbank.Genbank", false]], "genbank() (in module pydna.genbank)": [[0, "pydna.genbank.genbank", false]], "genbankfile (class in pydna.genbankfile)": [[0, "pydna.genbankfile.GenbankFile", false]], "genbankrecord (class in pydna.genbankrecord)": [[0, "pydna.genbankrecord.GenbankRecord", false]], "get_cut_parameters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cut_parameters", false]], "get_cutsite_pairs() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsite_pairs", false]], "get_cutsites() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsites", false]], "get_env() (in module pydna)": [[0, "pydna.get_env", false]], "identifier_from_string() (in module pydna.utils)": [[0, "pydna.utils.identifier_from_string", false]], "interpolator() (in module pydna.gel)": [[0, "pydna.gel.interpolator", false]], "isblunt() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.isblunt", false]], "isorf() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.isorf", false]], "isorf() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.isorf", false]], "lcs() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.lcs", false]], "left_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.left_end_position", false]], "limit (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.limit", false]], "linearize() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.linearize", false]], "list_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.list_features", false]], "location_boundaries() (in module pydna.utils)": [[0, "pydna.utils.location_boundaries", false]], "locations_overlap() (in module pydna.utils)": [[0, "pydna.utils.locations_overlap", false]], "locstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.locstr", false]], "locus (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.locus", false]], "logo() (in module pydna)": [[0, "pydna.logo", false]], "looped() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.looped", false]], "looped() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.looped", false]], "lower() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.lower", false]], "lower() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.lower", false]], "m() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.m", false]], "map_trace_files() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.map_trace_files", false]], "memorize() (in module pydna.utils)": [[0, "pydna.utils.memorize", false]], "module": [[0, "module-pydna", false], [0, "module-pydna.amplicon", false], [0, "module-pydna.amplify", false], [0, "module-pydna.assembly", false], [0, "module-pydna.common_sub_strings", false], [0, "module-pydna.contig", false], [0, "module-pydna.design", false], [0, "module-pydna.download", false], [0, "module-pydna.dseq", false], [0, "module-pydna.dseqrecord", false], [0, "module-pydna.editor", false], [0, "module-pydna.gel", false], [0, "module-pydna.genbank", false], [0, "module-pydna.genbankfile", false], [0, "module-pydna.genbankfixer", false], [0, "module-pydna.genbankrecord", false], [0, "module-pydna.myprimers", false], [0, "module-pydna.parsers", false], [0, "module-pydna.primer", false], [0, "module-pydna.readers", false], [0, "module-pydna.seqrecord", false], [0, "module-pydna.tm", false], [0, "module-pydna.utils", false]], "mung() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mung", false]], "mw() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mw", false]], "n_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.n_cutters", false]], "n_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.n_cutters", false]], "no_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.no_cutters", false]], "no_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.no_cutters", false]], "nucleotide() (pydna.genbank.genbank method)": [[0, "pydna.genbank.Genbank.nucleotide", false]], "number_of_cuts() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.number_of_cuts", false]], "once_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.once_cutters", false]], "once_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.once_cutters", false]], "open() (pydna.editor.editor method)": [[0, "pydna.editor.Editor.open", false]], "open_cache_folder() (in module pydna)": [[0, "pydna.open_cache_folder", false]], "open_config_folder() (in module pydna)": [[0, "pydna.open_config_folder", false]], "open_current_folder() (in module pydna)": [[0, "pydna.open_current_folder", false]], "open_folder() (in module pydna.utils)": [[0, "pydna.utils.open_folder", false]], "open_folder() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.open_folder", false]], "open_log_folder() (in module pydna)": [[0, "pydna.open_log_folder", false]], "orfs() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs", false]], "orfs_to_features() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs_to_features", false]], "originstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.originstr", false]], "parse() (in module pydna.parsers)": [[0, "pydna.parsers.parse", false]], "parse_primers() (in module pydna.parsers)": [[0, "pydna.parsers.parse_primers", false]], "parsegbloc() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.parseGBLoc", false]], "pcr() (in module pydna.amplify)": [[0, "pydna.amplify.pcr", false]], "pfu_sso7d_program() (in module pydna.tm)": [[0, "pydna.tm.pfu_sso7d_program", false]], "primer (class in pydna.primer)": [[0, "pydna.primer.Primer", false]], "primer_design() (in module pydna.design)": [[0, "pydna.design.primer_design", false]], "primerlist (class in pydna.myprimers)": [[0, "pydna.myprimers.PrimerList", false]], "primers() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.primers", false]], "products (pydna.amplify.anneal property)": [[0, "pydna.amplify.Anneal.products", false]], "program() (in module pydna.tm)": [[0, "pydna.tm.program", false]], "program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.program", false]], "proteinseqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.ProteinSeqRecord", false]], "pydna": [[0, "module-pydna", false]], "pydna.amplicon": [[0, "module-pydna.amplicon", false]], "pydna.amplify": [[0, "module-pydna.amplify", false]], "pydna.assembly": [[0, "module-pydna.assembly", false]], "pydna.common_sub_strings": [[0, "module-pydna.common_sub_strings", false]], "pydna.contig": [[0, "module-pydna.contig", false]], "pydna.design": [[0, "module-pydna.design", false]], "pydna.download": [[0, "module-pydna.download", false]], "pydna.dseq": [[0, "module-pydna.dseq", false]], "pydna.dseqrecord": [[0, "module-pydna.dseqrecord", false]], "pydna.editor": [[0, "module-pydna.editor", false]], "pydna.gel": [[0, "module-pydna.gel", false]], "pydna.genbank": [[0, "module-pydna.genbank", false]], "pydna.genbankfile": [[0, "module-pydna.genbankfile", false]], "pydna.genbankfixer": [[0, "module-pydna.genbankfixer", false]], "pydna.genbankrecord": [[0, "module-pydna.genbankrecord", false]], "pydna.myprimers": [[0, "module-pydna.myprimers", false]], "pydna.parsers": [[0, "module-pydna.parsers", false]], "pydna.primer": [[0, "module-pydna.primer", false]], "pydna.readers": [[0, "module-pydna.readers", false]], "pydna.seqrecord": [[0, "module-pydna.seqrecord", false]], "pydna.tm": [[0, "module-pydna.tm", false]], "pydna.utils": [[0, "module-pydna.utils", false]], "pydna_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.pydna_code", false]], "pydna_code_from_list() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.pydna_code_from_list", false]], "q5() (in module pydna.tm)": [[0, "pydna.tm.Q5", false]], "quick() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.quick", false]], "randomdna() (in module pydna.utils)": [[0, "pydna.utils.randomDNA", false]], "randomorf() (in module pydna.utils)": [[0, "pydna.utils.randomORF", false]], "randomprot() (in module pydna.utils)": [[0, "pydna.utils.randomprot", false]], "randomrna() (in module pydna.utils)": [[0, "pydna.utils.randomRNA", false]], "rarecodons() (in module pydna.utils)": [[0, "pydna.utils.rarecodons", false]], "rarecodons() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rarecodons", false]], "rarecodons() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rarecodons", false]], "rc() (in module pydna.utils)": [[0, "pydna.utils.rc", false]], "rc() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.rc", false]], "rc() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.rc", false]], "rc() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.rc", false]], "rc() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.rc", false]], "rc() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.rc", false]], "rc() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.rc", false]], "rc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rc", false]], "rc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rc", false]], "read() (in module pydna.readers)": [[0, "pydna.readers.read", false]], "read_primer() (in module pydna.readers)": [[0, "pydna.readers.read_primer", false]], "report() (pydna.amplify.anneal method)": [[0, "pydna.amplify.Anneal.report", false]], "reverse_complement() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.reverse_complement", false]], "reverse_complement() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.reverse_complement", false]], "reverse_complement() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.reverse_complement", false]], "reverse_complement() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.reverse_complement", false]], "reverse_complement() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.reverse_complement", false]], "reverse_complement() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.reverse_complement", false]], "reverse_complement() (pydna.primer.primer method)": [[0, "pydna.primer.Primer.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.reverse_complement", false]], "reverse_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.reverse_primers", false]], "right_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.right_end_position", false]], "seguid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.seguid", false]], "seguid() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.seguid", false]], "seguid() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.seguid", false]], "seq31() (in module pydna.utils)": [[0, "pydna.utils.seq31", false]], "seqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.SeqRecord", false]], "set_forward_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_forward_primer_footprint", false]], "set_reverse_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_reverse_primer_footprint", false]], "shift_feature() (in module pydna.utils)": [[0, "pydna.utils.shift_feature", false]], "shift_location() (in module pydna.utils)": [[0, "pydna.utils.shift_location", false]], "shifted() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.shifted", false]], "shifted() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.shifted", false]], "smallest_rotation() (in module pydna.utils)": [[0, "pydna.utils.smallest_rotation", false]], "sorted_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.sorted_features", false]], "stamp() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stamp", false]], "startcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.startcodon", false]], "startcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.startcodon", false]], "stopcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.stopcodon", false]], "stopcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stopcodon", false]], "strip_indent() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_indent", false]], "strip_multiline() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_multiline", false]], "synced() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.synced", false]], "t4() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.T4", false], [0, "pydna.dseq.Dseq.t4", false]], "ta_dbd() (in module pydna.tm)": [[0, "pydna.tm.ta_dbd", false]], "ta_default() (in module pydna.tm)": [[0, "pydna.tm.ta_default", false]], "tail (pydna.primer.primer property)": [[0, "pydna.primer.Primer.tail", false]], "taq_program() (in module pydna.tm)": [[0, "pydna.tm.taq_program", false]], "template (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.template", false]], "terminal_overlap() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.terminal_overlap", false]], "terminal_transferase() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.terminal_transferase", false]], "terminal_transferase() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.terminal_transferase", false]], "three_frame_orfs() (in module pydna.utils)": [[0, "pydna.utils.three_frame_orfs", false]], "three_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.three_prime_end", false]], "tm_dbd() (in module pydna.tm)": [[0, "pydna.tm.tm_dbd", false]], "tm_default() (in module pydna.tm)": [[0, "pydna.tm.tm_default", false]], "tm_neb() (in module pydna.tm)": [[0, "pydna.tm.tm_neb", false]], "tm_product() (in module pydna.tm)": [[0, "pydna.tm.tm_product", false]], "tmbresluc() (in module pydna.tm)": [[0, "pydna.tm.tmbresluc", false]], "togb() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toGB", false]], "toint() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toInt", false]], "tojson() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toJSON", false]], "tolinear() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.tolinear", false]], "tolinear() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.tolinear", false]], "transcribe() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.transcribe", false]], "translate() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.translate", false]], "translate() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.translate", false]], "trunc (pydna.dseq.dseq attribute)": [[0, "pydna.dseq.Dseq.trunc", false]], "twice_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.twice_cutters", false]], "twice_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.twice_cutters", false]], "undefined_sequence() (in module pydna.myprimers)": [[0, "pydna.myprimers.undefined_sequence", false]], "unique_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.unique_cutters", false]], "unique_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.unique_cutters", false]], "upper() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.upper", false]], "upper() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.upper", false]], "watson_ovhg() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.watson_ovhg", false]], "wrapstring() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.wrapstring", false]], "write() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.write", false]]}, "objects": {"": [[0, 0, 0, "-", "pydna"]], "pydna": [[0, 0, 0, "-", "amplicon"], [0, 0, 0, "-", "amplify"], [0, 0, 0, "-", "assembly"], [0, 0, 0, "-", "common_sub_strings"], [0, 0, 0, "-", "contig"], [0, 0, 0, "-", "design"], [0, 0, 0, "-", "download"], [0, 0, 0, "-", "dseq"], [0, 0, 0, "-", "dseqrecord"], [0, 0, 0, "-", "editor"], [0, 0, 0, "-", "gel"], [0, 0, 0, "-", "genbank"], [0, 0, 0, "-", "genbankfile"], [0, 0, 0, "-", "genbankfixer"], [0, 0, 0, "-", "genbankrecord"], [0, 5, 1, "", "get_env"], [0, 5, 1, "", "logo"], [0, 0, 0, "-", "myprimers"], [0, 5, 1, "", "open_cache_folder"], [0, 5, 1, "", "open_config_folder"], [0, 5, 1, "", "open_current_folder"], [0, 5, 1, "", "open_log_folder"], [0, 0, 0, "-", "parsers"], [0, 0, 0, "-", "primer"], [0, 0, 0, "-", "readers"], [0, 0, 0, "-", "seqrecord"], [0, 0, 0, "-", "tm"], [0, 0, 0, "-", "utils"]], "pydna.amplicon": [[0, 1, 1, "", "Amplicon"]], "pydna.amplicon.Amplicon": [[0, 2, 1, "", "dbd_program"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "primers"], [0, 2, 1, "", "program"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "set_forward_primer_footprint"], [0, 2, 1, "", "set_reverse_primer_footprint"]], "pydna.amplify": [[0, 1, 1, "", "Anneal"], [0, 5, 1, "", "pcr"]], "pydna.amplify.Anneal": [[0, 3, 1, "", "forward_primers"], [0, 3, 1, "", "limit"], [0, 4, 1, "", "products"], [0, 2, 1, "", "report"], [0, 3, 1, "", "reverse_primers"], [0, 3, 1, "", "template"]], "pydna.assembly": [[0, 1, 1, "", "Assembly"]], "pydna.assembly.Assembly": [[0, 2, 1, "", "assemble_circular"], [0, 2, 1, "", "assemble_linear"]], "pydna.common_sub_strings": [[0, 5, 1, "", "common_sub_strings"], [0, 5, 1, "", "terminal_overlap"]], "pydna.contig": [[0, 1, 1, "", "Contig"]], "pydna.contig.Contig": [[0, 2, 1, "", "detailed_figure"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.design": [[0, 5, 1, "", "assembly_fragments"], [0, 5, 1, "", "circular_assembly_fragments"], [0, 5, 1, "", "primer_design"]], "pydna.dseq": [[0, 1, 1, "", "Dseq"]], "pydna.dseq.Dseq": [[0, 2, 1, "", "T4"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutsite_is_valid"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "exo1_end"], [0, 2, 1, "", "exo1_front"], [0, 2, 1, "", "fill_in"], [0, 2, 1, "", "find"], [0, 2, 1, "", "five_prime_end"], [0, 2, 1, "", "from_full_sequence_and_overhangs"], [0, 2, 1, "", "from_representation"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "get_cut_parameters"], [0, 2, 1, "", "get_cutsite_pairs"], [0, 2, 1, "", "get_cutsites"], [0, 2, 1, "", "isblunt"], [0, 2, 1, "", "left_end_position"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "mung"], [0, 2, 1, "", "mw"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "quick"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "right_end_position"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "t4"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "three_prime_end"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "transcribe"], [0, 2, 1, "", "translate"], [0, 3, 1, "", "trunc"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "watson_ovhg"]], "pydna.dseqrecord": [[0, 1, 1, "", "Dseqrecord"]], "pydna.dseqrecord.Dseqrecord": [[0, 2, 1, "", "add_feature"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 4, 1, "", "circular"], [0, 2, 1, "", "copy_fasta_to_clipboard"], [0, 2, 1, "", "copy_gb_to_clipboard"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "find"], [0, 2, 1, "", "find_aa"], [0, 2, 1, "", "find_aminoacids"], [0, 2, 1, "", "format"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "linearize"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "m"], [0, 2, 1, "", "map_trace_files"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "number_of_cuts"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "orfs"], [0, 2, 1, "", "orfs_to_features"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "synced"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "write"]], "pydna.editor": [[0, 1, 1, "", "Editor"], [0, 5, 1, "", "ape"]], "pydna.editor.Editor": [[0, 2, 1, "", "open"]], "pydna.gel": [[0, 5, 1, "", "gel"], [0, 5, 1, "", "interpolator"]], "pydna.genbank": [[0, 1, 1, "", "Genbank"], [0, 5, 1, "", "genbank"]], "pydna.genbank.Genbank": [[0, 2, 1, "", "nucleotide"]], "pydna.genbankfile": [[0, 1, 1, "", "GenbankFile"]], "pydna.genbankfile.GenbankFile": [[0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.genbankfixer": [[0, 5, 1, "", "concat_dict"], [0, 5, 1, "", "gbtext_clean"], [0, 5, 1, "", "locstr"], [0, 5, 1, "", "originstr"], [0, 5, 1, "", "parseGBLoc"], [0, 5, 1, "", "strip_indent"], [0, 5, 1, "", "strip_multiline"], [0, 5, 1, "", "toGB"], [0, 5, 1, "", "toInt"], [0, 5, 1, "", "toJSON"], [0, 5, 1, "", "wrapstring"]], "pydna.genbankrecord": [[0, 1, 1, "", "GenbankRecord"]], "pydna.genbankrecord.GenbankRecord": [[0, 2, 1, "", "biopython_code"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "pydna_code"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.myprimers": [[0, 1, 1, "", "PrimerList"], [0, 5, 1, "", "check_primer_numbers"], [0, 5, 1, "", "find_duplicate_primers"], [0, 5, 1, "", "undefined_sequence"]], "pydna.myprimers.PrimerList": [[0, 4, 1, "", "accessed"], [0, 2, 1, "", "assign_numbers"], [0, 2, 1, "", "code"], [0, 2, 1, "", "open_folder"], [0, 2, 1, "", "pydna_code_from_list"]], "pydna.parsers": [[0, 5, 1, "", "embl_gb_fasta"], [0, 5, 1, "", "extract_from_text"], [0, 5, 1, "", "parse"], [0, 5, 1, "", "parse_primers"]], "pydna.primer": [[0, 1, 1, "", "Primer"]], "pydna.primer.Primer": [[0, 4, 1, "", "footprint"], [0, 2, 1, "", "reverse_complement"], [0, 4, 1, "", "tail"]], "pydna.readers": [[0, 5, 1, "", "read"], [0, 5, 1, "", "read_primer"]], "pydna.seqrecord": [[0, 1, 1, "", "ProteinSeqRecord"], [0, 1, 1, "", "SeqRecord"]], "pydna.seqrecord.ProteinSeqRecord": [[0, 2, 1, "", "cai"], [0, 2, 1, "", "express"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"]], "pydna.seqrecord.SeqRecord": [[0, 4, 1, "", "accession"], [0, 2, 1, "", "add_colors_to_features_for_ape"], [0, 2, 1, "", "add_feature"], [0, 2, 1, "", "cai"], [0, 2, 1, "", "comment"], [0, 2, 1, "", "copy"], [0, 2, 1, "", "datefunction"], [0, 4, 1, "", "definition"], [0, 2, 1, "", "dump"], [0, 2, 1, "", "express"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "from_Bio_SeqRecord"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "lcs"], [0, 2, 1, "", "list_features"], [0, 4, 1, "", "locus"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "sorted_features"], [0, 2, 1, "", "stamp"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"], [0, 2, 1, "", "translate"]], "pydna.tm": [[0, 5, 1, "", "Q5"], [0, 5, 1, "", "dbd_program"], [0, 5, 1, "", "pfu_sso7d_program"], [0, 5, 1, "", "program"], [0, 5, 1, "", "ta_dbd"], [0, 5, 1, "", "ta_default"], [0, 5, 1, "", "taq_program"], [0, 5, 1, "", "tm_dbd"], [0, 5, 1, "", "tm_default"], [0, 5, 1, "", "tm_neb"], [0, 5, 1, "", "tm_product"], [0, 5, 1, "", "tmbresluc"]], "pydna.utils": [[0, 5, 1, "", "cai"], [0, 5, 1, "", "complement"], [0, 5, 1, "", "cuts_overlap"], [0, 5, 1, "", "eq"], [0, 5, 1, "", "express"], [0, 5, 1, "", "flatten"], [0, 5, 1, "", "identifier_from_string"], [0, 5, 1, "", "location_boundaries"], [0, 5, 1, "", "locations_overlap"], [0, 5, 1, "", "memorize"], [0, 5, 1, "", "open_folder"], [0, 5, 1, "", "randomDNA"], [0, 5, 1, "", "randomORF"], [0, 5, 1, "", "randomRNA"], [0, 5, 1, "", "randomprot"], [0, 5, 1, "", "rarecodons"], [0, 5, 1, "", "rc"], [0, 5, 1, "", "seq31"], [0, 5, 1, "", "shift_feature"], [0, 5, 1, "", "shift_location"], [0, 5, 1, "", "smallest_rotation"], [0, 5, 1, "", "three_frame_orfs"]]}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "attribute", "Python attribute"], "4": ["py", "property", "Python property"], "5": ["py", "function", "Python function"]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:attribute", "4": "py:property", "5": "py:function"}, "terms": {"0": 0, "01": 0, "02": 0, "050": 0, "0_first_prim": 0, "0m": 0, "1": 0, "10": 0, "100": 0, "100bp": 0, "101": 0, "101bp": 0, "102": 0, "102bp": 0, "1051bp": 0, "11": 0, "11m": 0, "12": 0, "13": 0, "1388": 0, "14": 0, "14bp": 0, "15": 0, "15058bp": 0, "166": 0, "169": 0, "17": 0, "18": 0, "19": 0, "1950267": 0, "1983": 0, "1990": 0, "1_second_prim": 0, "1c": 0, "1st": 0, "2": 0, "2007": 0, "2007025016": 0, "2011": 0, "2013": 0, "2023": 0, "2243783": 0, "23": 0, "231": 0, "2389": 0, "24": 0, "25": 0, "250": 0, "2577": 0, "27": 0, "289": 0, "2_third_prim": 0, "3": 0, "30": 0, "300": 0, "304": 0, "308": 0, "313": 0, "32": 0, "32630": 0, "329": 0, "33bp": 0, "34bp": 0, "35": 0, "357": 0, "35bp": 0, "36": 0, "363": 0, "381": 0, "3atgtgagtggcagatagtaatag": 0, "3c": 0, "3gcaagctttgaatgctac5": 0, "3gcaagctttgaatgctaccctagg5": 0, "3gctgacatagtagactatcgtg5": 0, "3min": 0, "3tactgacgattgggaag": 0, "4": 0, "40": 0, "41": 0, "42": 0, "45": 0, "48": 0, "5": 0, "50": 0, "500": 0, "51": 0, "52": 0, "53": 0, "54": 0, "55": 0, "557": 0, "5681": 0, "57": 0, "59": 0, "5atgactgctaacccttc": 0, "5atgactgctaacccttc3": 0, "5e": 0, "5ggatccatgactgctaacccttc3": 0, "5min": 0, "5tacactcaccgtctatcattatc": 0, "5tacactcaccgtctatcattatc3": 0, "6": 0, "60": 0, "600": 0, "61": 0, "64": 0, "7": 0, "72": 0, "72c": 0, "75": 0, "79": 0, "8": 0, "82": 0, "84": 0, "85t6tfcvwav0wnxeib": 0, "9": 0, "95": 0, "98": 0, "A": 0, "AND": 0, "As": 0, "At": 0, "By": 0, "For": 0, "If": 0, "In": 0, "It": 0, "NOT": 0, "No": 0, "One": 0, "The": 0, "Then": 0, "There": 0, "These": 0, "To": 0, "_": 0, "____": 0, "_____": 0, "______": 0, "________": 0, "_________": 0, "__________": 0, "____________": 0, "___________________": 0, "______________________": 0, "__init__": 0, "_abstractcut": 0, "_klenow_frag": 0, "_mt": 0, "_mwstd": 0, "_new": 0, "_pretty_str": 0, "_restrictionbatch": 0, "_seqabstractbaseclass": 0, "_sy": 0, "_tm_default": 0, "_weight": 0, "a1": 0, "aa": 0, "aaa": 0, "aaaa": 0, "aaaaaa": 0, "aaac": 0, "aaacccc": 0, "aaagcccta": 0, "aaagcctag": 0, "aaagttct": 0, "aaat": 0, "aaatatagcgtactgagaagaaa": 0, "aaatg": 0, "aag": 0, "aagaattcaa": 0, "aagaattcaagaattc": 0, "aagaattcaagaattcaa": 0, "aat": 0, "aata": 0, "aattcaa": 0, "aattcaag": 0, "aattcc": 0, "about": 0, "abov": 0, "absolut": 0, "accept": 0, "access": 0, "accompani": 0, "accord": 0, "acg": 0, "acgatgctatactg": 0, "acgatgctatactgccccctgtgctgtgctcta": 0, "acgatgctatactgccccctgtgctgtgctctattttttattctggctgtatcgggggt": 0, "acid": 0, "acitivti": 0, "actgt": 0, "activ": 0, "actta": 0, "ad": 0, "adapt": 0, "add": 0, "add_colors_to_features_for_ap": 0, "add_featur": 0, "addition": 0, "address": 0, "adjac": 0, "advanc": 0, "after": 0, "agaaa": 0, "agaattcaa": 0, "agaros": 0, "agcct": 0, "agcctatcatcttggtctctgca": 0, "agcctatcatcttggtctctgcatttatat": 0, "agcctatcatcttggtctctgcatttatatcgcatgactcttcttt": 0, "agctag": 0, "agctatgtatcttgcatcgta": 0, "aggcct": 0, "agt": 0, "ala": 0, "algorithm": 0, "alia": 0, "all": 0, "allow": 0, "almost": 0, "alon": 0, "alphabet": 0, "alreadi": 0, "also": 0, "altern": 0, "alwai": 0, "ambigu": 0, "amino": 0, "amount": 0, "ampl": 0, "amplicon1": 0, "amplicon1amplicon2amplicon3": 0, "amplicon1amplicon2amplicon3amplicon4": 0, "amplicon1dseqrecd1amplicon2dseqrecd2": 0, "amplicon2": 0, "amplicon3": 0, "amplicon4": 0, "amplif": 0, "amplify_ann": 0, "an": 0, "anaconda3": 0, "analysi": 0, "analyz": 0, "ani": 0, "anneal": 0, "annot": 0, "anoth": 0, "anselm": 0, "antisens": 0, "ap": 0, "apeextractor": 0, "apeinfo": 0, "api": 0, "app": 0, "appear": 0, "apply_cut": 0, "appmain": 0, "aptam": 0, "ar": 0, "arg": 0, "argument": 0, "around": 0, "art": 0, "artifici": 0, "ascii": 0, "assembl": 0, "assemble_circular": 0, "assemble_linear": 0, "assembly_assembli": 0, "assembly_frag": 0, "assemblyobj": 0, "assign": 0, "assign_numb": 0, "assign_numbers_to_new_prim": 0, "associ": 0, "assum": 0, "asterisk": 0, "asx": 0, "ataa": 0, "atc": 0, "atcg": 0, "atcgactgacgtgtt": 0, "atcgtgt": 0, "atcgtgtactgtcatattc": 0, "atg": 0, "atga": 0, "atgaaa": 0, "atgaccc": 0, "atgactgctaaccct": 0, "atgactgctaacccttc": 0, "atgactgctaacccttccttggtgttg": 0, "atgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatg": 0, "atggccattgtaatgggccgctgaaagggtgcccgatag": 0, "atgtaa": 0, "atgtacgatcgtatgctggttatattttag": 0, "atgttcctac": 0, "attca": 0, "attempt": 0, "attribut": 0, "atttaa": 0, "auggccauuguaaugggccgcugaaagggugcccgauag": 0, "author": 0, "automat": 0, "automaticli": 0, "avail": 0, "b": 0, "back": 0, "bamhi": 0, "base": 0, "base64": 0, "basic": 0, "batch": 0, "bean": 0, "becaus": 0, "becom": 0, "been": 0, "befor": 0, "begin": 0, "behav": 0, "below": 0, "best": 0, "beta": 0, "between": 0, "bind": 0, "bio": 0, "biojson": 0, "biolog": 0, "biologi": 0, "biologylab": 0, "biopython": 0, "biopython_cod": 0, "biopythonparserwarn": 0, "bjorn": 0, "bjorn36": 0, "bjornjobb": 0, "bj\u00f6rn": 0, "bkgnebmkia5kng": 0, "blunt": 0, "bool": 0, "both": 0, "bp": 0, "bring": 0, "brixtel": 0, "broken": 0, "bug": 0, "built": 0, "byte": 0, "bytearrai": 0, "c": 0, "c_seq": 0, "ca": 0, "caaa": 0, "caaag": 0, "cach": 0, "cached_func": 0, "cai": 0, "calcul": 0, "call": 0, "callabl": 0, "can": 0, "cannot": 0, "capabl": 0, "capac": 0, "capit": 0, "care": 0, "carefulli": 0, "cas9": 0, "case": 0, "catattc": 0, "catattcaaagttct": 0, "catcga": 0, "catcgat": 0, "catcgatc": 0, "catcgtaagtttcga": 0, "catcgtaagtttcgaacg": 0, "catgatctacgt": 0, "catgatctacgtatcgtgt": 0, "cation": 0, "ccaaacccaccaggtaccttatgtaagtacttcaagtcgccagaagacttcttggtcaagttgcc": 0, "ccc": 0, "ccccaaa": 0, "ccccc": 0, "ccccttt": 0, "ccgga": 0, "cctag": 0, "cctagg": 0, "cctaggnnncttaag": 0, "ccttaa": 0, "cd": 0, "cdseguid": 0, "cgactgtatcatctgatagcac": 0, "cgactgtatcatctgatagcac3": 0, "cgi": 0, "cgtatgctg": 0, "cgttcgaaacttacgatg3": 0, "chang": 0, "charact": 0, "check": 0, "check_primer_numb": 0, "checksum": 0, "chew": 0, "christophchamp": 0, "circular": 0, "circular_assembly_frag": 0, "class": 0, "classmethod": 0, "clean": 0, "clone": 0, "closest": 0, "coding_dna": 0, "coerc": 0, "collect": 0, "color": 0, "com": 0, "combin": 0, "combo": 0, "comma": 0, "command": 0, "comment": 0, "common": 0, "compact": 0, "compar": 0, "comparison": 0, "compat": 0, "complement": 0, "complet": 0, "compoundloc": 0, "comput": 0, "conc": 0, "concat_dict": 0, "concaten": 0, "concentr": 0, "concept": 0, "configpars": 0, "configur": 0, "connect": 0, "consid": 0, "considi": 0, "construct": 0, "contact": 0, "contain": 0, "control": 0, "conveni": 0, "convens": 0, "convent": 0, "copi": 0, "copy_fasta_to_clipboard": 0, "copy_gb_to_clipboard": 0, "copyright": 0, "correct": 0, "correctli": 0, "cottenoir": 0, "could": 0, "cover": 0, "creat": 0, "creation": 0, "crick": 0, "crick_ovhg": 0, "cs570233": 0, "cseguid": 0, "cta": 0, "ctag": 0, "ctagctac": 0, "ctagctag": 0, "ctagg": 0, "ctaggatcgtagatctagctg": 0, "ctaggg": 0, "ctctgcatttatat": 0, "ctctgcatttatatcgcatgactcttcttt": 0, "ctg": 0, "ctgggta": 0, "ctrl": 0, "ctta": 0, "cttt": 0, "cttta": 0, "current": 0, "cursor": 0, "custom": 0, "cut": 0, "cut_crick": 0, "cut_watson": 0, "cuts_overlap": 0, "cutsit": 0, "cutsite_is_valid": 0, "cutter": 0, "d": 0, "data": 0, "data_dir": 0, "date": 0, "datefunct": 0, "david": 0, "db_xref": 0, "dbd_program": 0, "dbxref": 0, "de_tabl": 0, "deal": 0, "debug": 0, "decemb": 0, "deduc": 0, "default": 0, "defin": 0, "definit": 0, "depict": 0, "deprec": 0, "describ": 0, "descript": 0, "detail": 0, "detailed_figur": 0, "detect": 0, "determin": 0, "develop": 0, "dict": 0, "differ": 0, "difficult": 0, "digest": 0, "dir": 0, "direct": 0, "directli": 0, "directori": 0, "dist": 0, "dlist": 0, "dna": 0, "dna_nn3": 0, "dna_nn4": 0, "dnac1": 0, "dnac2": 0, "dntp": 0, "do": 0, "doc": 0, "docstr": 0, "doctr": 0, "doe": 0, "domain": 0, "done": 0, "doubl": 0, "down": 0, "download_text": 0, "dropbox": 0, "dsdna": 0, "dseqr": 0, "dseqrecd1": 0, "dseqrecd1amplicon1amplicon2": 0, "dseqrecd1amplicon1dseqrecd2amplicon2": 0, "dseqrecd2": 0, "dseqrecord_frag": 0, "dseqrecord_sync": 0, "dseqtyp": 0, "dump": 0, "duplic": 0, "dure": 0, "duval": 0, "dvberkel": 0, "e": 0, "each": 0, "earlier": 0, "easier": 0, "easiest": 0, "ecori": 0, "edg": 0, "edit": 0, "edu": 0, "effect": 0, "either": 0, "element": 0, "els": 0, "email": 0, "embl": 0, "embl_gb_fasta": 0, "empti": 0, "en": 0, "encod": 0, "end": 0, "engin": 0, "enough": 0, "ensur": 0, "enter": 0, "entir": 0, "entri": 0, "env": 0, "environ": 0, "environment": 0, "enz": 0, "enzym": 0, "enzymestyp": 0, "eppstein": 0, "eq": 0, "equal": 0, "equival": 0, "especi": 0, "estim": 0, "estimate_funct": 0, "even": 0, "everi": 0, "exactposit": 0, "excactli": 0, "excel": 0, "except": 0, "exist": 0, "exo": 0, "exo1_end": 0, "exo1_front": 0, "exonucleas": 0, "expect": 0, "explan": 0, "explicitli": 0, "explor": 0, "express": 0, "extern": 0, "extra": 0, "extract": 0, "extract_featur": 0, "extract_from_text": 0, "f": 0, "f64": 0, "fa": 0, "fa1": 0, "fa2": 0, "facilit": 0, "factor": 0, "fall": 0, "fals": 0, "fasta": 0, "faster": 0, "fb": 0, "fc": 0, "featur": 0, "feb": 0, "field": 0, "figur": 0, "file": 0, "filenam": 0, "fill": 0, "fill_in": 0, "final": 0, "find": 0, "find_aa": 0, "find_aminoacid": 0, "find_duplicate_prim": 0, "first": 0, "fit": 0, "five": 0, "five_prime_end": 0, "fix": 0, "flank": 0, "flatten": 0, "flexibl": 0, "float": 0, "folder": 0, "follow": 0, "footprint": 0, "fore": 0, "form": 0, "format": 0, "formula": 0, "forward": 0, "forward_prim": 0, "found": 0, "four": 0, "fp": 0, "fr": 0, "frag": 0, "frag1": 0, "frag14": 0, "frag2": 0, "frag20": 0, "frag23": 0, "fragment": 0, "frame": 0, "fring": 0, "from": 0, "from_bio_seqrecord": 0, "from_full_sequence_and_overhang": 0, "from_represent": 0, "from_seqrecord": 0, "from_str": 0, "ft": 0, "ft2": 0, "full": 0, "full_sequ": 0, "func": 0, "function": 0, "funtion": 0, "further": 0, "fuse": 0, "fusion": 0, "fwd": 0, "g": 0, "gaaat": 0, "gaat": 0, "gaattc": 0, "gac": 0, "gacccat": 0, "gacgt": 0, "gagacgtaaatata": 0, "gagacgtaaatatagcgtactgagaagaaa": 0, "gap": 0, "gat": 0, "gatc": 0, "gatcc": 0, "gatccnnngaattc": 0, "gatccttt": 0, "gatcg": 0, "gatcga": 0, "gatcgat": 0, "gatcgatc": 0, "gatcgatg": 0, "gattaca": 0, "gb": 0, "gbkstring": 0, "gbtext": 0, "gbtext_clean": 0, "gbw0jp907tg_yx3jngs4qqwttj": 0, "gbw0jp907tg_yx3jngs4qqwttju": 0, "gc": 0, "gcaagctttgaatgctac5": 0, "gcatacgac": 0, "gcatcgtagtctatttgcttac": 0, "gcta": 0, "gctag": 0, "gctgacatagtagactatcgtg5": 0, "gel_length": 0, "genbank_nucleotid": 0, "gener": 0, "get_cut_paramet": 0, "get_cutsit": 0, "get_cutsite_pair": 0, "get_env": 0, "getcwd": 0, "gf7iorxmniu": 0, "ggaatt": 0, "ggatc": 0, "ggatcc": 0, "ggatcca": 0, "ggatccatgactgct": 0, "ggatccatgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatgggatcc": 0, "ggatcccatcgtaag": 0, "ggatccnnngaattc": 0, "ggcct": 0, "gggaaat": 0, "ggggtttcccc": 0, "gibson": 0, "gip0": 0, "gist": 0, "github": 0, "given": 0, "gmail": 0, "gnnncttaag": 0, "googl": 0, "gov": 0, "govern": 0, "gram": 0, "graph": 0, "greater": 0, "greedi": 0, "greedili": 0, "greyc": 0, "group": 0, "gt": 0, "gtagcta": 0, "gtagctag": 0, "gtt": 0, "gttcttaa": 0, "gttt": 0, "gtttc": 0, "guess": 0, "ha": 0, "half": 0, "handl": 0, "happen": 0, "have": 0, "helix": 0, "high": 0, "highlight": 0, "hold": 0, "home": 0, "homolog": 0, "homologi": 0, "http": 0, "i": 0, "id": 0, "ident": 0, "identifi": 0, "identifier_from_str": 0, "ignor": 0, "imm_tabl": 0, "immedi": 0, "immut": 0, "implement": 0, "import": 0, "includ": 0, "incorpor": 0, "index": 0, "indexerror": 0, "inform": 0, "ing": 0, "inhibit": 0, "inhibitor": 0, "ini": 0, "initi": 0, "initlist": 0, "inplac": 0, "input": 0, "insensit": 0, "insert": 0, "inspect": 0, "instanc": 0, "instanti": 0, "instead": 0, "instread": 0, "int": 0, "integ": 0, "intermedi": 0, "interpol": 0, "interpret": 0, "introspect": 0, "invers": 0, "involv": 0, "ipython": 0, "is_left": 0, "isblunt": 0, "isorf": 0, "issu": 0, "item": 0, "iter": 0, "its": 0, "itself": 0, "iupac": 0, "j": 0, "j2": 0, "jean": 0, "johansson": 0, "join": 0, "jorgensen": 0, "journal": 0, "jseq": 0, "json": 0, "jun": 0, "junction": 0, "just": 0, "k": 0, "kb": 0, "keep": 0, "kei": 0, "keyword": 0, "klenow": 0, "klenow_frag": 0, "kwarg": 0, "l": 0, "l_": 0, "label": 0, "lactamas": 0, "larger": 0, "last": 0, "lc": 0, "ldseguid": 0, "least": 0, "left": 0, "left_cut": 0, "left_end_posit": 0, "len": 0, "lenght": 0, "length": 0, "length1": 0, "length2": 0, "less": 0, "letter": 0, "levskaya": 0, "lib": 0, "licenc": 0, "licens": 0, "lift": 0, "like": 0, "lim": 0, "limit": 0, "line": 0, "linear": 0, "link": 0, "linux": 0, "list": 0, "list_featur": 0, "lkutrl4": 0, "lkynqhtivh": 0, "loc": 0, "loc1": 0, "loc2": 0, "local": 0, "locat": 0, "location_boundari": 0, "locations_overlap": 0, "locstr": 0, "locu": 0, "log": 0, "log_dir": 0, "loglevel": 0, "logo": 0, "logotyp": 0, "long": 0, "longer": 0, "longest": 0, "look": 0, "loop": 0, "lost": 0, "lower": 0, "lowercas": 0, "lp002422": 0, "lseguid": 0, "lsseguid": 0, "lst": 0, "lyndon": 0, "m": 0, "made": 0, "mai": 0, "main": 0, "maivmgrt": 0, "maivmgru": 0, "maivmgrwkgar": 0, "make": 0, "malform": 0, "manag": 0, "mani": 0, "manual": 0, "map": 0, "map_trace_fil": 0, "mar": 0, "margin": 0, "mass": 0, "match": 0, "max": 0, "max_nod": 0, "maximum": 0, "maxlength": 0, "maxlink": 0, "maxsiz": 0, "mean": 0, "meant": 0, "melt": 0, "memor": 0, "mention": 0, "mer": 0, "merg": 0, "meta": 0, "metalailevalmetglyargtrplysglyalaargt": 0, "metallo": 0, "method": 0, "methyl": 0, "mg": 0, "might": 0, "minimum": 0, "minsiz": 0, "misc": 0, "miscellan": 0, "mit": 0, "mix": 0, "mixtur": 0, "mm": 0, "mmm": 0, "mode": 0, "modif": 0, "modifi": 0, "mol": 0, "mol_typ": 0, "molecul": 0, "molecular": 0, "molecule_typ": 0, "monoval": 0, "most": 0, "mostli": 0, "move": 0, "mung": 0, "mung_bean_nucleas": 0, "must": 0, "mutableseq": 0, "mw": 0, "mwstd": 0, "my_protein": 0, "my_seq": 0, "mydrmlvif": 0, "myemail": 0, "n": 0, "n_cutter": 0, "na": 0, "name": 0, "ncbi": 0, "neb": 0, "nebswebsit": 0, "necessari": 0, "need": 0, "neg": 0, "networkx": 0, "new": 0, "new_dna": 0, "newcom": 0, "next": 0, "nicer": 0, "nih": 0, "nlm": 0, "nm": 0, "nn_tabl": 0, "nnn": 0, "nnnn": 0, "nnnnn": 0, "no_cutt": 0, "node": 0, "nodemap": 0, "non": 0, "none": 0, "normal": 0, "note": 0, "noth": 0, "notion": 0, "now": 0, "nucleas": 0, "nucleotid": 0, "nuclotid": 0, "number": 0, "number_of_cut": 0, "numer": 0, "o": 0, "o3": 0, "o4": 0, "o59": 0, "o6": 0, "o7": 0, "o8": 0, "obj": 0, "object": 0, "obtain": 0, "occur": 0, "occurr": 0, "off": 0, "old": 0, "oligonuceotid": 0, "onc": 0, "once_cutt": 0, "one": 0, "onli": 0, "onlin": 0, "open": 0, "open_cache_fold": 0, "open_config_fold": 0, "open_current_fold": 0, "open_fold": 0, "open_log_fold": 0, "optim": 0, "option": 0, "order": 0, "orf": 0, "orfs_to_featur": 0, "org": 0, "organ": 0, "orient": 0, "origin": 0, "original_loc": 0, "originstr": 0, "other": 0, "otherwis": 0, "out": 0, "output": 0, "outsid": 0, "over": 0, "overhang": 0, "overlap": 0, "ovhg": 0, "own": 0, "p": 0, "p1": 0, "p2": 0, "p3": 0, "pad": 0, "padfirst": 0, "page": 0, "pair": 0, "param": 0, "parament": 0, "paramet": 0, "pars": 0, "parse_prim": 0, "parsegbloc": 0, "part": 0, "part_nam": 0, "pass": 0, "past": 0, "pat": 0, "patent": 0, "path": 0, "pathlib": 0, "pcr": 0, "pcr_prod": 0, "perform": 0, "permanantli": 0, "permut": 0, "pf": 0, "pfu": 0, "pfu_sso7d_program": 0, "php": 0, "phusion": 0, "pierr": 0, "pl": 0, "place": 0, "plain": 0, "plasmid": 0, "plausibl": 0, "pleas": 0, "plu": 0, "po": 0, "point": 0, "polymeras": 0, "pop": 0, "posit": 0, "possibl": 0, "power": 0, "pr": 0, "practic": 0, "preceed": 0, "prefer": 0, "presenc": 0, "present": 0, "press": 0, "pretty_str": 0, "previou": 0, "prime": 0, "primer1": 0, "primer_design": 0, "primerc": 0, "primerdict": 0, "primerlist": 0, "prinmer": 0, "print": 0, "probabl": 0, "process": 0, "prodcod": 0, "produc": 0, "product": 0, "productcod": 0, "program": 0, "properti": 0, "protein": 0, "proteinseqrecord": 0, "protocol": 0, "protrud": 0, "provid": 0, "pth": 0, "pubm": 0, "purpos": 0, "put": 0, "py": 0, "pydna_": 0, "pydna_cached_func": 0, "pydna_cod": 0, "pydna_code_from_list": 0, "pydna_config_dir": 0, "pydna_data_dir": 0, "pydna_email": 0, "pydna_prim": 0, "pydnaseqrecord": 0, "pyl": 0, "pypars": 0, "python": 0, "python2": 0, "python3": 0, "python_packag": 0, "q5": 0, "qht": 0, "qualifi": 0, "quick": 0, "quicker": 0, "quit": 0, "r": 0, "r64": 0, "rais": 0, "randomdna": 0, "randomorf": 0, "randomprot": 0, "randomrna": 0, "rarecodon": 0, "ration": 0, "rbrixtel_at_gmail_dot_com": 0, "rc": 0, "reaction": 0, "read": 0, "read_prim": 0, "readabl": 0, "reason": 0, "rec": 0, "recent": 0, "recognit": 0, "recombin": 0, "record": 0, "ref": 0, "refer": 0, "reflect": 0, "region": 0, "relat": 0, "reli": 0, "rememb": 0, "remov": 0, "render": 0, "repeat": 0, "replac": 0, "report": 0, "repositori": 0, "repr": 0, "repres": 0, "represent": 0, "requir": 0, "resect": 0, "reserv": 0, "respect": 0, "restrict": 0, "restrictionbatch": 0, "restrictionenzym": 0, "result": 0, "return": 0, "retwingl": 0, "rev": 0, "revers": 0, "reverse_compl": 0, "reverse_prim": 0, "rhoad": 0, "right": 0, "right_cut": 0, "right_end_posit": 0, "rml": 0, "rna": 0, "romain": 0, "rotat": 0, "roundtrip": 0, "rowend": 0, "rowstart": 0, "rp": 0, "rstr": 0, "rule": 0, "rychlik": 0, "s2": 0, "s3": 0, "safe": 0, "salt": 0, "saltc": 0, "saltcorr": 0, "same": 0, "sampl": 0, "scanner": 0, "sce": 0, "search": 0, "second": 0, "section": 0, "see": 0, "seguid": 0, "sel": 0, "selenocystein": 0, "self": 0, "selfcomp": 0, "sens": 0, "sensit": 0, "separ": 0, "seq": 0, "seq3": 0, "seq31": 0, "seq_len": 0, "seq_to_open": 0, "seqenc": 0, "seqfeatur": 0, "seqio": 0, "sequec": 0, "sequenc": 0, "sequtil": 0, "set": 0, "set_forward_primer_footprint": 0, "set_reverse_primer_footprint": 0, "sever": 0, "shape": 0, "share": 0, "shaw": 0, "shell": 0, "shell_command_for_editor": 0, "shift": 0, "shift_featur": 0, "shift_loc": 0, "short": 0, "shortest": 0, "should": 0, "show": 0, "side": 0, "sign": 0, "similar": 0, "simpl": 0, "simpleloc": 0, "simpler": 0, "simplifi": 0, "simul": 0, "sinc": 0, "singl": 0, "site": 0, "size": 0, "slc": 0, "slice": 0, "slightli": 0, "slow": 0, "smallest": 0, "smallest_rot": 0, "snippet": 0, "so": 0, "softwar": 0, "some": 0, "someon": 0, "sort": 0, "sorted_featur": 0, "spacer": 0, "specif": 0, "specifi": 0, "spencer": 0, "split": 0, "spyder": 0, "sr": 0, "sso7d": 0, "sta": 0, "stagger": 0, "stamp": 0, "standard": 0, "start": 0, "startcodon": 0, "startposit": 0, "startx1": 0, "startx2": 0, "starty1": 0, "starty2": 0, "stdin": 0, "stdout": 0, "sticki": 0, "sticky3": 0, "sticky5": 0, "stop": 0, "stop_symbol": 0, "stopcodon": 0, "store": 0, "str": 0, "str_": 0, "strand": 0, "stretch": 0, "strict": 0, "string": 0, "stringi": 0, "stringx": 0, "strip_ind": 0, "strip_multilin": 0, "strorbyt": 0, "structur": 0, "stuff": 0, "sub": 0, "subclass": 0, "subfrag": 0, "sublcass": 0, "subsequ": 0, "substitut": 0, "substr": 0, "suggest": 0, "suppli": 0, "support": 0, "surviv": 0, "switch": 0, "symbol": 0, "syn": 0, "sync": 0, "synhtes": 0, "synthet": 0, "system": 0, "t": 0, "t4": 0, "ta": 0, "ta_dbd": 0, "ta_default": 0, "taa": 0, "taaa": 0, "tab": 0, "tac": 0, "tacactcaccgtctatcattatc": 0, "tacactcaccgtctatcattatctactatcgactgtatcatctgatagcac": 0, "tact": 0, "tactggg": 0, "tag": 0, "tagctag": 0, "tagctgactgcacaa": 0, "tail": 0, "take": 0, "taq": 0, "taq_program": 0, "target": 0, "target_tm": 0, "tattctggctgtatc": 0, "tattctggctgtatcgggggtacgatgctatactg": 0, "taxon": 0, "taxonomi": 0, "tccgga": 0, "tcctag": 0, "tcgcatgactcttcttt": 0, "tcggatagtagaacca": 0, "tcggatagtagaaccagagacgt": 0, "tcggatagtagaaccagagacgtaaatata": 0, "tcggatagtagaaccagagacgtaaatatagcgtactgagaagaaa": 0, "tcl": 0, "tclsh": 0, "tclsh8": 0, "tcttggtctctgcatttatat": 0, "tech": 0, "techniqu": 0, "technologi": 0, "tell": 0, "temp": 0, "temperatur": 0, "templat": 0, "temprari": 0, "ter": 0, "term": 0, "termin": 0, "terminal_overlap": 0, "terminal_transferas": 0, "test": 0, "tewydy0ugvgxh3vjnvwgtxoydqa": 0, "texa": 0, "text": 0, "tga": 0, "tgagtagtcgtagtcgtcgtat": 0, "tgatcgtcatgctgactatactat": 0, "tggatcc": 0, "tgtactggtgctgaaccttgtatcaagttgggtgttgacgccattgccccaggtggtcgtttcgtt": 0, "tgtgctgtgctcta": 0, "tgtgctgtgctctattttttattctggctgtatc": 0, "than": 0, "the_exo": 0, "thei": 0, "them": 0, "thermodynam": 0, "thi": 0, "thing": 0, "those": 0, "three": 0, "three_frame_orf": 0, "three_prime_end": 0, "threonin": 0, "through": 0, "throw": 0, "thrown": 0, "time": 0, "titl": 0, "tm_dbd": 0, "tm_default": 0, "tm_func": 0, "tm_neb": 0, "tm_nn": 0, "tm_product": 0, "tmapi": 0, "tmbresluc": 0, "tmf": 0, "tmm_tabl": 0, "tmpdir": 0, "tmr": 0, "to_stop": 0, "togb": 0, "togeth": 0, "toint": 0, "tojson": 0, "tolinear": 0, "tool": 0, "top": 0, "topologi": 0, "tp2jzecm2e3w4yxtrrx09cmka_8": 0, "trace": 0, "traceback": 0, "track": 0, "transcrib": 0, "translat": 0, "treatment": 0, "tri": 0, "trick": 0, "true": 0, "trunc": 0, "try": 0, "tt": 0, "ttaagg": 0, "ttat": 0, "ttc": 0, "ttcaagaa": 0, "ttcttaa": 0, "ttcttaagtt": 0, "ttg": 0, "ttt": 0, "ttta": 0, "tttac": 0, "tttat": 0, "tttatatcgcatgactcttcttt": 0, "tttc": 0, "tttcccc": 0, "tttg": 0, "tttt": 0, "tttttt": 0, "tupl": 0, "turn": 0, "tweak": 0, "twice": 0, "twice_cutt": 0, "two": 0, "txt": 0, "type": 0, "type3": 0, "type5": 0, "type_": 0, "typeerror": 0, "typic": 0, "u": 0, "unassign": 0, "undefined_sequ": 0, "underli": 0, "union": 0, "unique_cutt": 0, "univers": 0, "unk": 0, "unknown": 0, "up": 0, "upper": 0, "uppercas": 0, "url": 0, "urlsaf": 0, "usag": 0, "user": 0, "userlist": 0, "users_email": 0, "usr": 0, "usual": 0, "utah": 0, "v": 0, "val": 0, "valid": 0, "valu": 0, "valueerror": 0, "variabl": 0, "variou": 0, "vector": 0, "veri": 0, "version": 0, "vf": 0, "view": 0, "visual": 0, "vitro": 0, "vivo": 0, "w": 0, "wa": 0, "wai": 0, "watson": 0, "watson_ovhg": 0, "wayn": 0, "we": 0, "weight": 0, "well": 0, "when": 0, "where": 0, "which": 0, "while": 0, "who": 0, "whole": 0, "whose": 0, "wiki": 0, "wikidata": 0, "wikipedia": 0, "window": 0, "without": 0, "wo": 0, "wo2007025016": 0, "word": 0, "work": 0, "would": 0, "wprintgc": 0, "wrap": 0, "wrapstr": 0, "write": 0, "written": 0, "www": 0, "x": 0, "x1b": 0, "xaa": 0, "xle": 0, "xxx": 0, "y": 0, "yet": 0, "you": 0, "z": 0}, "titles": ["Welcome to pydna\u2019s documentation!"], "titleterms": {"": 0, "amplicon": 0, "amplifi": 0, "assembli": 0, "code": 0, "common_sub_str": 0, "content": 0, "contig": 0, "design": 0, "document": 0, "download": 0, "dseq": 0, "dseqrecord": 0, "editor": 0, "exampl": 0, "gel": 0, "genbank": 0, "genbankfil": 0, "genbankfix": 0, "genbankrecord": 0, "get": 0, "help": 0, "how": 0, "indic": 0, "layout": 0, "modul": 0, "more": 0, "myprim": 0, "packag": 0, "parser": 0, "primer": 0, "pydna": 0, "reader": 0, "seqrecord": 0, "sourc": 0, "tabl": 0, "tm": 0, "us": 0, "util": 0, "welcom": 0}}) \ No newline at end of file +Search.setIndex({"alltitles": {"Examples of pydna in use": [[0, "examples-of-pydna-in-use"]], "How to get more help": [[0, "how-to-get-more-help"]], "How to use the documentation": [[0, "how-to-use-the-documentation"]], "Indices and tables": [[0, "indices-and-tables"]], "Module contents": [[0, "module-pydna"]], "Welcome to pydna\u2019s documentation!": [[0, null]], "pydna": [[0, "pydna"]], "pydna package layout": [[0, "pydna-package-layout"]], "pydna source code": [[0, "pydna-source-code"]], "pydna.amplicon module": [[0, "module-pydna.amplicon"]], "pydna.amplify module": [[0, "module-pydna.amplify"]], "pydna.assembly module": [[0, "module-pydna.assembly"]], "pydna.common_sub_strings module": [[0, "module-pydna.common_sub_strings"]], "pydna.contig module": [[0, "module-pydna.contig"]], "pydna.design module": [[0, "module-pydna.design"]], "pydna.download module": [[0, "module-pydna.download"]], "pydna.dseq module": [[0, "module-pydna.dseq"]], "pydna.dseqrecord module": [[0, "module-pydna.dseqrecord"]], "pydna.editor module": [[0, "module-pydna.editor"]], "pydna.gel module": [[0, "module-pydna.gel"]], "pydna.genbank module": [[0, "module-pydna.genbank"]], "pydna.genbankfile module": [[0, "module-pydna.genbankfile"]], "pydna.genbankfixer module": [[0, "module-pydna.genbankfixer"]], "pydna.genbankrecord module": [[0, "module-pydna.genbankrecord"]], "pydna.myprimers module": [[0, "module-pydna.myprimers"]], "pydna.parsers module": [[0, "module-pydna.parsers"]], "pydna.primer module": [[0, "module-pydna.primer"]], "pydna.readers module": [[0, "module-pydna.readers"]], "pydna.seqrecord module": [[0, "module-pydna.seqrecord"]], "pydna.tm module": [[0, "module-pydna.tm"]], "pydna.utils module": [[0, "module-pydna.utils"]]}, "docnames": ["index"], "envversion": {"sphinx": 63, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1}, "filenames": ["index.rst"], "indexentries": {"accessed (pydna.myprimers.primerlist property)": [[0, "pydna.myprimers.PrimerList.accessed", false]], "accession (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.accession", false]], "add_colors_to_features_for_ape() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_colors_to_features_for_ape", false]], "add_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.add_feature", false]], "add_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.add_feature", false]], "amplicon (class in pydna.amplicon)": [[0, "pydna.amplicon.Amplicon", false]], "anneal (class in pydna.amplify)": [[0, "pydna.amplify.Anneal", false]], "ape() (in module pydna.editor)": [[0, "pydna.editor.ape", false]], "apply_cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.apply_cut", false]], "apply_cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.apply_cut", false]], "assemble_circular() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_circular", false]], "assemble_linear() (pydna.assembly.assembly method)": [[0, "pydna.assembly.Assembly.assemble_linear", false]], "assembly (class in pydna.assembly)": [[0, "pydna.assembly.Assembly", false]], "assembly_fragments() (in module pydna.design)": [[0, "pydna.design.assembly_fragments", false]], "assign_numbers() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.assign_numbers", false]], "biopython_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.biopython_code", false]], "cai() (in module pydna.utils)": [[0, "pydna.utils.cai", false]], "cai() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.cai", false]], "cai() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.cai", false]], "cas9() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cas9", false]], "cas9() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cas9", false]], "check_primer_numbers() (in module pydna.myprimers)": [[0, "pydna.myprimers.check_primer_numbers", false]], "circular (pydna.dseqrecord.dseqrecord property)": [[0, "pydna.dseqrecord.Dseqrecord.circular", false]], "circular_assembly_fragments() (in module pydna.design)": [[0, "pydna.design.circular_assembly_fragments", false]], "code() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.code", false]], "comment() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.comment", false]], "common_sub_strings() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.common_sub_strings", false]], "complement() (in module pydna.utils)": [[0, "pydna.utils.complement", false]], "concat_dict() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.concat_dict", false]], "contig (class in pydna.contig)": [[0, "pydna.contig.Contig", false]], "copy() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.copy", false]], "copy_fasta_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_fasta_to_clipboard", false]], "copy_gb_to_clipboard() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.copy_gb_to_clipboard", false]], "cut() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cut", false]], "cut() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cut", false]], "cuts_overlap() (in module pydna.utils)": [[0, "pydna.utils.cuts_overlap", false]], "cutsite_is_valid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutsite_is_valid", false]], "cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.cutters", false]], "cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.cutters", false]], "datefunction() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.datefunction", false]], "dbd_program() (in module pydna.tm)": [[0, "pydna.tm.dbd_program", false]], "dbd_program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.dbd_program", false]], "definition (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.definition", false]], "detailed_figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.detailed_figure", false]], "dseq (class in pydna.dseq)": [[0, "pydna.dseq.Dseq", false]], "dseqrecord (class in pydna.dseqrecord)": [[0, "pydna.dseqrecord.Dseqrecord", false]], "dump() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.dump", false]], "editor (class in pydna.editor)": [[0, "pydna.editor.Editor", false]], "embl_gb_fasta() (in module pydna.parsers)": [[0, "pydna.parsers.embl_gb_fasta", false]], "eq() (in module pydna.utils)": [[0, "pydna.utils.eq", false]], "exo1_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_end", false]], "exo1_front() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.exo1_front", false]], "express() (in module pydna.utils)": [[0, "pydna.utils.express", false]], "express() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.express", false]], "express() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.express", false]], "extract_feature() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.extract_feature", false]], "extract_feature() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.extract_feature", false]], "extract_from_text() (in module pydna.parsers)": [[0, "pydna.parsers.extract_from_text", false]], "figure() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.figure", false]], "figure() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.figure", false]], "figure() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.figure", false]], "fill_in() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.fill_in", false]], "find() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.find", false]], "find() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find", false]], "find_aa() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aa", false]], "find_aminoacids() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.find_aminoacids", false]], "find_duplicate_primers() (in module pydna.myprimers)": [[0, "pydna.myprimers.find_duplicate_primers", false]], "five_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.five_prime_end", false]], "flatten() (in module pydna.utils)": [[0, "pydna.utils.flatten", false]], "footprint (pydna.primer.primer property)": [[0, "pydna.primer.Primer.footprint", false]], "format() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.format", false]], "forward_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.forward_primers", false]], "from_bio_seqrecord() (pydna.seqrecord.seqrecord class method)": [[0, "pydna.seqrecord.SeqRecord.from_Bio_SeqRecord", false]], "from_full_sequence_and_overhangs() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_full_sequence_and_overhangs", false]], "from_representation() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_representation", false]], "from_seqrecord() (pydna.amplicon.amplicon class method)": [[0, "pydna.amplicon.Amplicon.from_SeqRecord", false]], "from_seqrecord() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_SeqRecord", false]], "from_seqrecord() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankfile.genbankfile class method)": [[0, "pydna.genbankfile.GenbankFile.from_SeqRecord", false]], "from_seqrecord() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_SeqRecord", false]], "from_string() (pydna.contig.contig class method)": [[0, "pydna.contig.Contig.from_string", false]], "from_string() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.from_string", false]], "from_string() (pydna.dseqrecord.dseqrecord class method)": [[0, "pydna.dseqrecord.Dseqrecord.from_string", false]], "from_string() (pydna.genbankrecord.genbankrecord class method)": [[0, "pydna.genbankrecord.GenbankRecord.from_string", false]], "gbtext_clean() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.gbtext_clean", false]], "gc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.gc", false]], "gc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.gc", false]], "gel() (in module pydna.gel)": [[0, "pydna.gel.gel", false]], "genbank (class in pydna.genbank)": [[0, "pydna.genbank.Genbank", false]], "genbank() (in module pydna.genbank)": [[0, "pydna.genbank.genbank", false]], "genbankfile (class in pydna.genbankfile)": [[0, "pydna.genbankfile.GenbankFile", false]], "genbankrecord (class in pydna.genbankrecord)": [[0, "pydna.genbankrecord.GenbankRecord", false]], "get_cut_parameters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cut_parameters", false]], "get_cutsite_pairs() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsite_pairs", false]], "get_cutsites() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.get_cutsites", false]], "get_env() (in module pydna)": [[0, "pydna.get_env", false]], "identifier_from_string() (in module pydna.utils)": [[0, "pydna.utils.identifier_from_string", false]], "interpolator() (in module pydna.gel)": [[0, "pydna.gel.interpolator", false]], "isblunt() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.isblunt", false]], "isorf() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.isorf", false]], "isorf() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.isorf", false]], "lcs() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.lcs", false]], "left_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.left_end_position", false]], "limit (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.limit", false]], "linearize() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.linearize", false]], "list_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.list_features", false]], "location_boundaries() (in module pydna.utils)": [[0, "pydna.utils.location_boundaries", false]], "locations_overlap() (in module pydna.utils)": [[0, "pydna.utils.locations_overlap", false]], "locstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.locstr", false]], "locus (pydna.seqrecord.seqrecord property)": [[0, "pydna.seqrecord.SeqRecord.locus", false]], "logo() (in module pydna)": [[0, "pydna.logo", false]], "looped() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.looped", false]], "looped() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.looped", false]], "lower() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.lower", false]], "lower() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.lower", false]], "m() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.m", false]], "map_trace_files() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.map_trace_files", false]], "memorize() (in module pydna.utils)": [[0, "pydna.utils.memorize", false]], "module": [[0, "module-pydna", false], [0, "module-pydna.amplicon", false], [0, "module-pydna.amplify", false], [0, "module-pydna.assembly", false], [0, "module-pydna.common_sub_strings", false], [0, "module-pydna.contig", false], [0, "module-pydna.design", false], [0, "module-pydna.download", false], [0, "module-pydna.dseq", false], [0, "module-pydna.dseqrecord", false], [0, "module-pydna.editor", false], [0, "module-pydna.gel", false], [0, "module-pydna.genbank", false], [0, "module-pydna.genbankfile", false], [0, "module-pydna.genbankfixer", false], [0, "module-pydna.genbankrecord", false], [0, "module-pydna.myprimers", false], [0, "module-pydna.parsers", false], [0, "module-pydna.primer", false], [0, "module-pydna.readers", false], [0, "module-pydna.seqrecord", false], [0, "module-pydna.tm", false], [0, "module-pydna.utils", false]], "mung() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mung", false]], "mw() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.mw", false]], "n_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.n_cutters", false]], "n_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.n_cutters", false]], "no_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.no_cutters", false]], "no_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.no_cutters", false]], "nucleotide() (pydna.genbank.genbank method)": [[0, "pydna.genbank.Genbank.nucleotide", false]], "number_of_cuts() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.number_of_cuts", false]], "once_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.once_cutters", false]], "once_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.once_cutters", false]], "open() (pydna.editor.editor method)": [[0, "pydna.editor.Editor.open", false]], "open_cache_folder() (in module pydna)": [[0, "pydna.open_cache_folder", false]], "open_config_folder() (in module pydna)": [[0, "pydna.open_config_folder", false]], "open_current_folder() (in module pydna)": [[0, "pydna.open_current_folder", false]], "open_folder() (in module pydna.utils)": [[0, "pydna.utils.open_folder", false]], "open_folder() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.open_folder", false]], "open_log_folder() (in module pydna)": [[0, "pydna.open_log_folder", false]], "orfs() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs", false]], "orfs_to_features() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.orfs_to_features", false]], "originstr() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.originstr", false]], "parse() (in module pydna.parsers)": [[0, "pydna.parsers.parse", false]], "parse_primers() (in module pydna.parsers)": [[0, "pydna.parsers.parse_primers", false]], "parsegbloc() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.parseGBLoc", false]], "pcr() (in module pydna.amplify)": [[0, "pydna.amplify.pcr", false]], "pfu_sso7d_program() (in module pydna.tm)": [[0, "pydna.tm.pfu_sso7d_program", false]], "primer (class in pydna.primer)": [[0, "pydna.primer.Primer", false]], "primer_design() (in module pydna.design)": [[0, "pydna.design.primer_design", false]], "primerlist (class in pydna.myprimers)": [[0, "pydna.myprimers.PrimerList", false]], "primers() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.primers", false]], "products (pydna.amplify.anneal property)": [[0, "pydna.amplify.Anneal.products", false]], "program() (in module pydna.tm)": [[0, "pydna.tm.program", false]], "program() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.program", false]], "proteinseqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.ProteinSeqRecord", false]], "pydna": [[0, "module-pydna", false]], "pydna.amplicon": [[0, "module-pydna.amplicon", false]], "pydna.amplify": [[0, "module-pydna.amplify", false]], "pydna.assembly": [[0, "module-pydna.assembly", false]], "pydna.common_sub_strings": [[0, "module-pydna.common_sub_strings", false]], "pydna.contig": [[0, "module-pydna.contig", false]], "pydna.design": [[0, "module-pydna.design", false]], "pydna.download": [[0, "module-pydna.download", false]], "pydna.dseq": [[0, "module-pydna.dseq", false]], "pydna.dseqrecord": [[0, "module-pydna.dseqrecord", false]], "pydna.editor": [[0, "module-pydna.editor", false]], "pydna.gel": [[0, "module-pydna.gel", false]], "pydna.genbank": [[0, "module-pydna.genbank", false]], "pydna.genbankfile": [[0, "module-pydna.genbankfile", false]], "pydna.genbankfixer": [[0, "module-pydna.genbankfixer", false]], "pydna.genbankrecord": [[0, "module-pydna.genbankrecord", false]], "pydna.myprimers": [[0, "module-pydna.myprimers", false]], "pydna.parsers": [[0, "module-pydna.parsers", false]], "pydna.primer": [[0, "module-pydna.primer", false]], "pydna.readers": [[0, "module-pydna.readers", false]], "pydna.seqrecord": [[0, "module-pydna.seqrecord", false]], "pydna.tm": [[0, "module-pydna.tm", false]], "pydna.utils": [[0, "module-pydna.utils", false]], "pydna_code() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.pydna_code", false]], "pydna_code_from_list() (pydna.myprimers.primerlist method)": [[0, "pydna.myprimers.PrimerList.pydna_code_from_list", false]], "q5() (in module pydna.tm)": [[0, "pydna.tm.Q5", false]], "quick() (pydna.dseq.dseq class method)": [[0, "pydna.dseq.Dseq.quick", false]], "randomdna() (in module pydna.utils)": [[0, "pydna.utils.randomDNA", false]], "randomorf() (in module pydna.utils)": [[0, "pydna.utils.randomORF", false]], "randomprot() (in module pydna.utils)": [[0, "pydna.utils.randomprot", false]], "randomrna() (in module pydna.utils)": [[0, "pydna.utils.randomRNA", false]], "rarecodons() (in module pydna.utils)": [[0, "pydna.utils.rarecodons", false]], "rarecodons() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rarecodons", false]], "rarecodons() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rarecodons", false]], "rc() (in module pydna.utils)": [[0, "pydna.utils.rc", false]], "rc() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.rc", false]], "rc() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.rc", false]], "rc() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.rc", false]], "rc() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.rc", false]], "rc() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.rc", false]], "rc() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.rc", false]], "rc() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.rc", false]], "rc() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.rc", false]], "read() (in module pydna.readers)": [[0, "pydna.readers.read", false]], "read_primer() (in module pydna.readers)": [[0, "pydna.readers.read_primer", false]], "report() (pydna.amplify.anneal method)": [[0, "pydna.amplify.Anneal.report", false]], "reverse_complement() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.reverse_complement", false]], "reverse_complement() (pydna.contig.contig method)": [[0, "pydna.contig.Contig.reverse_complement", false]], "reverse_complement() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.reverse_complement", false]], "reverse_complement() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.reverse_complement", false]], "reverse_complement() (pydna.genbankfile.genbankfile method)": [[0, "pydna.genbankfile.GenbankFile.reverse_complement", false]], "reverse_complement() (pydna.genbankrecord.genbankrecord method)": [[0, "pydna.genbankrecord.GenbankRecord.reverse_complement", false]], "reverse_complement() (pydna.primer.primer method)": [[0, "pydna.primer.Primer.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.reverse_complement", false]], "reverse_complement() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.reverse_complement", false]], "reverse_primers (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.reverse_primers", false]], "right_end_position() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.right_end_position", false]], "seguid() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.seguid", false]], "seguid() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.seguid", false]], "seguid() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.seguid", false]], "seq31() (in module pydna.utils)": [[0, "pydna.utils.seq31", false]], "seqrecord (class in pydna.seqrecord)": [[0, "pydna.seqrecord.SeqRecord", false]], "set_forward_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_forward_primer_footprint", false]], "set_reverse_primer_footprint() (pydna.amplicon.amplicon method)": [[0, "pydna.amplicon.Amplicon.set_reverse_primer_footprint", false]], "shift_feature() (in module pydna.utils)": [[0, "pydna.utils.shift_feature", false]], "shift_location() (in module pydna.utils)": [[0, "pydna.utils.shift_location", false]], "shifted() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.shifted", false]], "shifted() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.shifted", false]], "smallest_rotation() (in module pydna.utils)": [[0, "pydna.utils.smallest_rotation", false]], "sorted_features() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.sorted_features", false]], "stamp() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stamp", false]], "startcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.startcodon", false]], "startcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.startcodon", false]], "stopcodon() (pydna.seqrecord.proteinseqrecord method)": [[0, "pydna.seqrecord.ProteinSeqRecord.stopcodon", false]], "stopcodon() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.stopcodon", false]], "strip_indent() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_indent", false]], "strip_multiline() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.strip_multiline", false]], "synced() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.synced", false]], "t4() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.T4", false], [0, "pydna.dseq.Dseq.t4", false]], "ta_dbd() (in module pydna.tm)": [[0, "pydna.tm.ta_dbd", false]], "ta_default() (in module pydna.tm)": [[0, "pydna.tm.ta_default", false]], "tail (pydna.primer.primer property)": [[0, "pydna.primer.Primer.tail", false]], "taq_program() (in module pydna.tm)": [[0, "pydna.tm.taq_program", false]], "template (pydna.amplify.anneal attribute)": [[0, "pydna.amplify.Anneal.template", false]], "terminal_overlap() (in module pydna.common_sub_strings)": [[0, "pydna.common_sub_strings.terminal_overlap", false]], "terminal_transferase() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.terminal_transferase", false]], "terminal_transferase() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.terminal_transferase", false]], "three_frame_orfs() (in module pydna.utils)": [[0, "pydna.utils.three_frame_orfs", false]], "three_prime_end() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.three_prime_end", false]], "tm_dbd() (in module pydna.tm)": [[0, "pydna.tm.tm_dbd", false]], "tm_default() (in module pydna.tm)": [[0, "pydna.tm.tm_default", false]], "tm_neb() (in module pydna.tm)": [[0, "pydna.tm.tm_neb", false]], "tm_product() (in module pydna.tm)": [[0, "pydna.tm.tm_product", false]], "tmbresluc() (in module pydna.tm)": [[0, "pydna.tm.tmbresluc", false]], "togb() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toGB", false]], "toint() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toInt", false]], "tojson() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.toJSON", false]], "tolinear() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.tolinear", false]], "tolinear() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.tolinear", false]], "transcribe() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.transcribe", false]], "translate() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.translate", false]], "translate() (pydna.seqrecord.seqrecord method)": [[0, "pydna.seqrecord.SeqRecord.translate", false]], "trunc (pydna.dseq.dseq attribute)": [[0, "pydna.dseq.Dseq.trunc", false]], "twice_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.twice_cutters", false]], "twice_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.twice_cutters", false]], "undefined_sequence() (in module pydna.myprimers)": [[0, "pydna.myprimers.undefined_sequence", false]], "unique_cutters() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.unique_cutters", false]], "unique_cutters() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.unique_cutters", false]], "upper() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.upper", false]], "upper() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.upper", false]], "watson_ovhg() (pydna.dseq.dseq method)": [[0, "pydna.dseq.Dseq.watson_ovhg", false]], "wrapstring() (in module pydna.genbankfixer)": [[0, "pydna.genbankfixer.wrapstring", false]], "write() (pydna.dseqrecord.dseqrecord method)": [[0, "pydna.dseqrecord.Dseqrecord.write", false]]}, "objects": {"": [[0, 0, 0, "-", "pydna"]], "pydna": [[0, 0, 0, "-", "amplicon"], [0, 0, 0, "-", "amplify"], [0, 0, 0, "-", "assembly"], [0, 0, 0, "-", "common_sub_strings"], [0, 0, 0, "-", "contig"], [0, 0, 0, "-", "design"], [0, 0, 0, "-", "download"], [0, 0, 0, "-", "dseq"], [0, 0, 0, "-", "dseqrecord"], [0, 0, 0, "-", "editor"], [0, 0, 0, "-", "gel"], [0, 0, 0, "-", "genbank"], [0, 0, 0, "-", "genbankfile"], [0, 0, 0, "-", "genbankfixer"], [0, 0, 0, "-", "genbankrecord"], [0, 5, 1, "", "get_env"], [0, 5, 1, "", "logo"], [0, 0, 0, "-", "myprimers"], [0, 5, 1, "", "open_cache_folder"], [0, 5, 1, "", "open_config_folder"], [0, 5, 1, "", "open_current_folder"], [0, 5, 1, "", "open_log_folder"], [0, 0, 0, "-", "parsers"], [0, 0, 0, "-", "primer"], [0, 0, 0, "-", "readers"], [0, 0, 0, "-", "seqrecord"], [0, 0, 0, "-", "tm"], [0, 0, 0, "-", "utils"]], "pydna.amplicon": [[0, 1, 1, "", "Amplicon"]], "pydna.amplicon.Amplicon": [[0, 2, 1, "", "dbd_program"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "primers"], [0, 2, 1, "", "program"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "set_forward_primer_footprint"], [0, 2, 1, "", "set_reverse_primer_footprint"]], "pydna.amplify": [[0, 1, 1, "", "Anneal"], [0, 5, 1, "", "pcr"]], "pydna.amplify.Anneal": [[0, 3, 1, "", "forward_primers"], [0, 3, 1, "", "limit"], [0, 4, 1, "", "products"], [0, 2, 1, "", "report"], [0, 3, 1, "", "reverse_primers"], [0, 3, 1, "", "template"]], "pydna.assembly": [[0, 1, 1, "", "Assembly"]], "pydna.assembly.Assembly": [[0, 2, 1, "", "assemble_circular"], [0, 2, 1, "", "assemble_linear"]], "pydna.common_sub_strings": [[0, 5, 1, "", "common_sub_strings"], [0, 5, 1, "", "terminal_overlap"]], "pydna.contig": [[0, 1, 1, "", "Contig"]], "pydna.contig.Contig": [[0, 2, 1, "", "detailed_figure"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.design": [[0, 5, 1, "", "assembly_fragments"], [0, 5, 1, "", "circular_assembly_fragments"], [0, 5, 1, "", "primer_design"]], "pydna.dseq": [[0, 1, 1, "", "Dseq"]], "pydna.dseq.Dseq": [[0, 2, 1, "", "T4"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutsite_is_valid"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "exo1_end"], [0, 2, 1, "", "exo1_front"], [0, 2, 1, "", "fill_in"], [0, 2, 1, "", "find"], [0, 2, 1, "", "five_prime_end"], [0, 2, 1, "", "from_full_sequence_and_overhangs"], [0, 2, 1, "", "from_representation"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "get_cut_parameters"], [0, 2, 1, "", "get_cutsite_pairs"], [0, 2, 1, "", "get_cutsites"], [0, 2, 1, "", "isblunt"], [0, 2, 1, "", "left_end_position"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "mung"], [0, 2, 1, "", "mw"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "quick"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "right_end_position"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "t4"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "three_prime_end"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "transcribe"], [0, 2, 1, "", "translate"], [0, 3, 1, "", "trunc"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "watson_ovhg"]], "pydna.dseqrecord": [[0, 1, 1, "", "Dseqrecord"]], "pydna.dseqrecord.Dseqrecord": [[0, 2, 1, "", "add_feature"], [0, 2, 1, "", "apply_cut"], [0, 2, 1, "", "cas9"], [0, 4, 1, "", "circular"], [0, 2, 1, "", "copy_fasta_to_clipboard"], [0, 2, 1, "", "copy_gb_to_clipboard"], [0, 2, 1, "", "cut"], [0, 2, 1, "", "cutters"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "figure"], [0, 2, 1, "", "find"], [0, 2, 1, "", "find_aa"], [0, 2, 1, "", "find_aminoacids"], [0, 2, 1, "", "format"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "linearize"], [0, 2, 1, "", "looped"], [0, 2, 1, "", "lower"], [0, 2, 1, "", "m"], [0, 2, 1, "", "map_trace_files"], [0, 2, 1, "", "n_cutters"], [0, 2, 1, "", "no_cutters"], [0, 2, 1, "", "number_of_cuts"], [0, 2, 1, "", "once_cutters"], [0, 2, 1, "", "orfs"], [0, 2, 1, "", "orfs_to_features"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "shifted"], [0, 2, 1, "", "synced"], [0, 2, 1, "", "terminal_transferase"], [0, 2, 1, "", "tolinear"], [0, 2, 1, "", "twice_cutters"], [0, 2, 1, "", "unique_cutters"], [0, 2, 1, "", "upper"], [0, 2, 1, "", "write"]], "pydna.editor": [[0, 1, 1, "", "Editor"], [0, 5, 1, "", "ape"]], "pydna.editor.Editor": [[0, 2, 1, "", "open"]], "pydna.gel": [[0, 5, 1, "", "gel"], [0, 5, 1, "", "interpolator"]], "pydna.genbank": [[0, 1, 1, "", "Genbank"], [0, 5, 1, "", "genbank"]], "pydna.genbank.Genbank": [[0, 2, 1, "", "nucleotide"]], "pydna.genbankfile": [[0, 1, 1, "", "GenbankFile"]], "pydna.genbankfile.GenbankFile": [[0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.genbankfixer": [[0, 5, 1, "", "concat_dict"], [0, 5, 1, "", "gbtext_clean"], [0, 5, 1, "", "locstr"], [0, 5, 1, "", "originstr"], [0, 5, 1, "", "parseGBLoc"], [0, 5, 1, "", "strip_indent"], [0, 5, 1, "", "strip_multiline"], [0, 5, 1, "", "toGB"], [0, 5, 1, "", "toInt"], [0, 5, 1, "", "toJSON"], [0, 5, 1, "", "wrapstring"]], "pydna.genbankrecord": [[0, 1, 1, "", "GenbankRecord"]], "pydna.genbankrecord.GenbankRecord": [[0, 2, 1, "", "biopython_code"], [0, 2, 1, "", "from_SeqRecord"], [0, 2, 1, "", "from_string"], [0, 2, 1, "", "pydna_code"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"]], "pydna.myprimers": [[0, 1, 1, "", "PrimerList"], [0, 5, 1, "", "check_primer_numbers"], [0, 5, 1, "", "find_duplicate_primers"], [0, 5, 1, "", "undefined_sequence"]], "pydna.myprimers.PrimerList": [[0, 4, 1, "", "accessed"], [0, 2, 1, "", "assign_numbers"], [0, 2, 1, "", "code"], [0, 2, 1, "", "open_folder"], [0, 2, 1, "", "pydna_code_from_list"]], "pydna.parsers": [[0, 5, 1, "", "embl_gb_fasta"], [0, 5, 1, "", "extract_from_text"], [0, 5, 1, "", "parse"], [0, 5, 1, "", "parse_primers"]], "pydna.primer": [[0, 1, 1, "", "Primer"]], "pydna.primer.Primer": [[0, 4, 1, "", "footprint"], [0, 2, 1, "", "reverse_complement"], [0, 4, 1, "", "tail"]], "pydna.readers": [[0, 5, 1, "", "read"], [0, 5, 1, "", "read_primer"]], "pydna.seqrecord": [[0, 1, 1, "", "ProteinSeqRecord"], [0, 1, 1, "", "SeqRecord"]], "pydna.seqrecord.ProteinSeqRecord": [[0, 2, 1, "", "cai"], [0, 2, 1, "", "express"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"]], "pydna.seqrecord.SeqRecord": [[0, 4, 1, "", "accession"], [0, 2, 1, "", "add_colors_to_features_for_ape"], [0, 2, 1, "", "add_feature"], [0, 2, 1, "", "cai"], [0, 2, 1, "", "comment"], [0, 2, 1, "", "copy"], [0, 2, 1, "", "datefunction"], [0, 4, 1, "", "definition"], [0, 2, 1, "", "dump"], [0, 2, 1, "", "express"], [0, 2, 1, "", "extract_feature"], [0, 2, 1, "", "from_Bio_SeqRecord"], [0, 2, 1, "", "gc"], [0, 2, 1, "", "isorf"], [0, 2, 1, "", "lcs"], [0, 2, 1, "", "list_features"], [0, 4, 1, "", "locus"], [0, 2, 1, "", "rarecodons"], [0, 2, 1, "", "rc"], [0, 2, 1, "", "reverse_complement"], [0, 2, 1, "", "seguid"], [0, 2, 1, "", "sorted_features"], [0, 2, 1, "", "stamp"], [0, 2, 1, "", "startcodon"], [0, 2, 1, "", "stopcodon"], [0, 2, 1, "", "translate"]], "pydna.tm": [[0, 5, 1, "", "Q5"], [0, 5, 1, "", "dbd_program"], [0, 5, 1, "", "pfu_sso7d_program"], [0, 5, 1, "", "program"], [0, 5, 1, "", "ta_dbd"], [0, 5, 1, "", "ta_default"], [0, 5, 1, "", "taq_program"], [0, 5, 1, "", "tm_dbd"], [0, 5, 1, "", "tm_default"], [0, 5, 1, "", "tm_neb"], [0, 5, 1, "", "tm_product"], [0, 5, 1, "", "tmbresluc"]], "pydna.utils": [[0, 5, 1, "", "cai"], [0, 5, 1, "", "complement"], [0, 5, 1, "", "cuts_overlap"], [0, 5, 1, "", "eq"], [0, 5, 1, "", "express"], [0, 5, 1, "", "flatten"], [0, 5, 1, "", "identifier_from_string"], [0, 5, 1, "", "location_boundaries"], [0, 5, 1, "", "locations_overlap"], [0, 5, 1, "", "memorize"], [0, 5, 1, "", "open_folder"], [0, 5, 1, "", "randomDNA"], [0, 5, 1, "", "randomORF"], [0, 5, 1, "", "randomRNA"], [0, 5, 1, "", "randomprot"], [0, 5, 1, "", "rarecodons"], [0, 5, 1, "", "rc"], [0, 5, 1, "", "seq31"], [0, 5, 1, "", "shift_feature"], [0, 5, 1, "", "shift_location"], [0, 5, 1, "", "smallest_rotation"], [0, 5, 1, "", "three_frame_orfs"]]}, "objnames": {"0": ["py", "module", "Python module"], "1": ["py", "class", "Python class"], "2": ["py", "method", "Python method"], "3": ["py", "attribute", "Python attribute"], "4": ["py", "property", "Python property"], "5": ["py", "function", "Python function"]}, "objtypes": {"0": "py:module", "1": "py:class", "2": "py:method", "3": "py:attribute", "4": "py:property", "5": "py:function"}, "terms": {"0": 0, "01": 0, "02": 0, "050": 0, "0_first_prim": 0, "0m": 0, "1": 0, "10": 0, "100": 0, "100bp": 0, "101": 0, "101bp": 0, "102": 0, "102bp": 0, "1051bp": 0, "11": 0, "11m": 0, "12": 0, "13": 0, "1388": 0, "14": 0, "14bp": 0, "15": 0, "15058bp": 0, "166": 0, "169": 0, "17": 0, "18": 0, "19": 0, "1950267": 0, "1983": 0, "1990": 0, "1_second_prim": 0, "1c": 0, "1st": 0, "2": 0, "2007": 0, "2007025016": 0, "2011": 0, "2013": 0, "2023": 0, "2243783": 0, "23": 0, "231": 0, "2389": 0, "24": 0, "25": 0, "250": 0, "2577": 0, "27": 0, "289": 0, "2_third_prim": 0, "3": 0, "30": 0, "300": 0, "304": 0, "308": 0, "313": 0, "32": 0, "32630": 0, "329": 0, "33bp": 0, "34bp": 0, "35": 0, "357": 0, "35bp": 0, "36": 0, "363": 0, "381": 0, "3atgtgagtggcagatagtaatag": 0, "3c": 0, "3gcaagctttgaatgctac5": 0, "3gcaagctttgaatgctaccctagg5": 0, "3gctgacatagtagactatcgtg5": 0, "3min": 0, "3tactgacgattgggaag": 0, "4": 0, "40": 0, "41": 0, "42": 0, "45": 0, "48": 0, "5": 0, "50": 0, "500": 0, "51": 0, "52": 0, "53": 0, "54": 0, "55": 0, "557": 0, "5681": 0, "57": 0, "59": 0, "5atgactgctaacccttc": 0, "5atgactgctaacccttc3": 0, "5e": 0, "5ggatccatgactgctaacccttc3": 0, "5min": 0, "5tacactcaccgtctatcattatc": 0, "5tacactcaccgtctatcattatc3": 0, "6": 0, "60": 0, "600": 0, "61": 0, "64": 0, "7": 0, "72": 0, "72c": 0, "75": 0, "79": 0, "8": 0, "82": 0, "84": 0, "85t6tfcvwav0wnxeib": 0, "9": 0, "95": 0, "98": 0, "A": 0, "AND": 0, "As": 0, "At": 0, "By": 0, "For": 0, "If": 0, "In": 0, "It": 0, "NOT": 0, "No": 0, "One": 0, "The": 0, "Then": 0, "There": 0, "These": 0, "To": 0, "_": 0, "____": 0, "_____": 0, "______": 0, "________": 0, "_________": 0, "__________": 0, "____________": 0, "___________________": 0, "______________________": 0, "__init__": 0, "_abstractcut": 0, "_klenow_frag": 0, "_mt": 0, "_mwstd": 0, "_new": 0, "_pretty_str": 0, "_restrictionbatch": 0, "_seqabstractbaseclass": 0, "_sy": 0, "_tm_default": 0, "_weight": 0, "a1": 0, "aa": 0, "aaa": 0, "aaaa": 0, "aaaaaa": 0, "aaac": 0, "aaacccc": 0, "aaagcccta": 0, "aaagcctag": 0, "aaagttct": 0, "aaat": 0, "aaatatagcgtactgagaagaaa": 0, "aaatg": 0, "aag": 0, "aagaattcaa": 0, "aagaattcaagaattc": 0, "aagaattcaagaattcaa": 0, "aat": 0, "aata": 0, "aattcaa": 0, "aattcaag": 0, "aattcc": 0, "about": 0, "abov": 0, "absolut": 0, "accept": 0, "access": 0, "accompani": 0, "accord": 0, "acg": 0, "acgatgctatactg": 0, "acgatgctatactgccccctgtgctgtgctcta": 0, "acgatgctatactgccccctgtgctgtgctctattttttattctggctgtatcgggggt": 0, "acid": 0, "acitivti": 0, "actgt": 0, "activ": 0, "actta": 0, "ad": 0, "adapt": 0, "add": 0, "add_colors_to_features_for_ap": 0, "add_featur": 0, "addition": 0, "address": 0, "adjac": 0, "advanc": 0, "after": 0, "agaaa": 0, "agaattcaa": 0, "agaros": 0, "agcct": 0, "agcctatcatcttggtctctgca": 0, "agcctatcatcttggtctctgcatttatat": 0, "agcctatcatcttggtctctgcatttatatcgcatgactcttcttt": 0, "agctag": 0, "agctatgtatcttgcatcgta": 0, "aggcct": 0, "agt": 0, "ala": 0, "algorithm": 0, "alia": 0, "all": 0, "allow": 0, "almost": 0, "alon": 0, "alphabet": 0, "alreadi": 0, "also": 0, "altern": 0, "alwai": 0, "ambigu": 0, "amino": 0, "amount": 0, "ampl": 0, "amplicon1": 0, "amplicon1amplicon2amplicon3": 0, "amplicon1amplicon2amplicon3amplicon4": 0, "amplicon1dseqrecd1amplicon2dseqrecd2": 0, "amplicon2": 0, "amplicon3": 0, "amplicon4": 0, "amplif": 0, "amplify_ann": 0, "an": 0, "anaconda3": 0, "analysi": 0, "analyz": 0, "ani": 0, "anneal": 0, "annot": 0, "anoth": 0, "anselm": 0, "antisens": 0, "ap": 0, "apeextractor": 0, "apeinfo": 0, "api": 0, "app": 0, "appear": 0, "apply_cut": 0, "appmain": 0, "aptam": 0, "ar": 0, "arg": 0, "argument": 0, "around": 0, "art": 0, "artifici": 0, "ascii": 0, "assembl": 0, "assemble_circular": 0, "assemble_linear": 0, "assembly_assembli": 0, "assembly_frag": 0, "assemblyobj": 0, "assign": 0, "assign_numb": 0, "assign_numbers_to_new_prim": 0, "associ": 0, "assum": 0, "asterisk": 0, "asx": 0, "ataa": 0, "atc": 0, "atcg": 0, "atcgactgacgtgtt": 0, "atcgtgt": 0, "atcgtgtactgtcatattc": 0, "atg": 0, "atga": 0, "atgaaa": 0, "atgaccc": 0, "atgactgctaaccct": 0, "atgactgctaacccttc": 0, "atgactgctaacccttccttggtgttg": 0, "atgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatg": 0, "atggccattgtaatgggccgctgaaagggtgcccgatag": 0, "atgtaa": 0, "atgtacgatcgtatgctggttatattttag": 0, "atgttcctac": 0, "attca": 0, "attempt": 0, "attribut": 0, "atttaa": 0, "auggccauuguaaugggccgcugaaagggugcccgauag": 0, "author": 0, "automat": 0, "automaticli": 0, "avail": 0, "b": 0, "back": 0, "backward": 0, "bamhi": 0, "base": 0, "base64": 0, "basic": 0, "batch": 0, "bean": 0, "becaus": 0, "becom": 0, "been": 0, "befor": 0, "begin": 0, "behav": 0, "below": 0, "best": 0, "beta": 0, "between": 0, "bind": 0, "bio": 0, "biojson": 0, "biolog": 0, "biologi": 0, "biologylab": 0, "biopython": 0, "biopython_cod": 0, "biopythonparserwarn": 0, "bjorn": 0, "bjorn36": 0, "bjornjobb": 0, "bj\u00f6rn": 0, "bkgnebmkia5kng": 0, "blunt": 0, "bool": 0, "both": 0, "bp": 0, "bring": 0, "brixtel": 0, "broken": 0, "bug": 0, "built": 0, "byte": 0, "bytearrai": 0, "c": 0, "c_seq": 0, "ca": 0, "caaa": 0, "caaag": 0, "cach": 0, "cached_func": 0, "cai": 0, "calcul": 0, "call": 0, "callabl": 0, "can": 0, "cannot": 0, "capabl": 0, "capac": 0, "capit": 0, "care": 0, "carefulli": 0, "cas9": 0, "case": 0, "catattc": 0, "catattcaaagttct": 0, "catcga": 0, "catcgat": 0, "catcgatc": 0, "catcgtaagtttcga": 0, "catcgtaagtttcgaacg": 0, "catgatctacgt": 0, "catgatctacgtatcgtgt": 0, "cation": 0, "ccaaacccaccaggtaccttatgtaagtacttcaagtcgccagaagacttcttggtcaagttgcc": 0, "ccc": 0, "ccccaaa": 0, "ccccc": 0, "ccccttt": 0, "ccgga": 0, "cctag": 0, "cctagg": 0, "cctaggnnncttaag": 0, "ccttaa": 0, "cd": 0, "cdseguid": 0, "cgactgtatcatctgatagcac": 0, "cgactgtatcatctgatagcac3": 0, "cgi": 0, "cgtatgctg": 0, "cgttcgaaacttacgatg3": 0, "chang": 0, "charact": 0, "check": 0, "check_primer_numb": 0, "checksum": 0, "chew": 0, "christophchamp": 0, "circular": 0, "circular_assembly_frag": 0, "class": 0, "classmethod": 0, "clean": 0, "clone": 0, "closest": 0, "coding_dna": 0, "coerc": 0, "collect": 0, "color": 0, "com": 0, "combin": 0, "combo": 0, "comma": 0, "command": 0, "comment": 0, "common": 0, "compact": 0, "compar": 0, "comparison": 0, "compat": 0, "complement": 0, "complet": 0, "compoundloc": 0, "comput": 0, "conc": 0, "concat_dict": 0, "concaten": 0, "concentr": 0, "concept": 0, "configpars": 0, "configur": 0, "connect": 0, "consid": 0, "considi": 0, "construct": 0, "contact": 0, "contain": 0, "control": 0, "conveni": 0, "convens": 0, "convent": 0, "copi": 0, "copy_fasta_to_clipboard": 0, "copy_gb_to_clipboard": 0, "copyright": 0, "correct": 0, "correctli": 0, "cottenoir": 0, "could": 0, "cover": 0, "creat": 0, "creation": 0, "crick": 0, "crick_ovhg": 0, "cs570233": 0, "cseguid": 0, "cta": 0, "ctag": 0, "ctagctac": 0, "ctagctag": 0, "ctagg": 0, "ctaggatcgtagatctagctg": 0, "ctaggg": 0, "ctctgcatttatat": 0, "ctctgcatttatatcgcatgactcttcttt": 0, "ctg": 0, "ctgggta": 0, "ctrl": 0, "ctta": 0, "cttt": 0, "cttta": 0, "current": 0, "cursor": 0, "custom": 0, "cut": 0, "cut_crick": 0, "cut_watson": 0, "cuts_overlap": 0, "cutsit": 0, "cutsite_is_valid": 0, "cutter": 0, "d": 0, "data": 0, "data_dir": 0, "date": 0, "datefunct": 0, "david": 0, "db_xref": 0, "dbd_program": 0, "dbxref": 0, "de_tabl": 0, "deal": 0, "debug": 0, "decemb": 0, "deduc": 0, "default": 0, "defin": 0, "definit": 0, "depict": 0, "deprec": 0, "describ": 0, "descript": 0, "detail": 0, "detailed_figur": 0, "detect": 0, "determin": 0, "develop": 0, "dict": 0, "differ": 0, "difficult": 0, "digest": 0, "dir": 0, "direct": 0, "directli": 0, "directori": 0, "dist": 0, "dlist": 0, "dna": 0, "dna_nn3": 0, "dna_nn4": 0, "dnac1": 0, "dnac2": 0, "dntp": 0, "do": 0, "doc": 0, "docstr": 0, "doctr": 0, "doe": 0, "domain": 0, "done": 0, "doubl": 0, "down": 0, "download_text": 0, "dropbox": 0, "dsdna": 0, "dseqr": 0, "dseqrecd1": 0, "dseqrecd1amplicon1amplicon2": 0, "dseqrecd1amplicon1dseqrecd2amplicon2": 0, "dseqrecd2": 0, "dseqrecord_frag": 0, "dseqrecord_sync": 0, "dseqtyp": 0, "dump": 0, "duplic": 0, "dure": 0, "duval": 0, "dvberkel": 0, "e": 0, "each": 0, "earlier": 0, "easier": 0, "easiest": 0, "ecori": 0, "edg": 0, "edit": 0, "edu": 0, "effect": 0, "either": 0, "element": 0, "els": 0, "email": 0, "embl": 0, "embl_gb_fasta": 0, "empti": 0, "en": 0, "encod": 0, "end": 0, "engin": 0, "enough": 0, "ensur": 0, "enter": 0, "entir": 0, "entri": 0, "env": 0, "environ": 0, "environment": 0, "enz": 0, "enzym": 0, "enzymestyp": 0, "eppstein": 0, "eq": 0, "equal": 0, "equival": 0, "especi": 0, "estim": 0, "estimate_funct": 0, "even": 0, "everi": 0, "exactposit": 0, "excactli": 0, "excel": 0, "except": 0, "exist": 0, "exo": 0, "exo1_end": 0, "exo1_front": 0, "exonucleas": 0, "expect": 0, "explan": 0, "explicitli": 0, "explor": 0, "express": 0, "extern": 0, "extra": 0, "extract": 0, "extract_featur": 0, "extract_from_text": 0, "f": 0, "f64": 0, "fa": 0, "fa1": 0, "fa2": 0, "facilit": 0, "factor": 0, "fall": 0, "fals": 0, "fasta": 0, "faster": 0, "fb": 0, "fc": 0, "featur": 0, "feb": 0, "field": 0, "figur": 0, "file": 0, "filenam": 0, "fill": 0, "fill_in": 0, "final": 0, "find": 0, "find_aa": 0, "find_aminoacid": 0, "find_duplicate_prim": 0, "first": 0, "fit": 0, "five": 0, "five_prime_end": 0, "fix": 0, "flank": 0, "flatten": 0, "flexibl": 0, "float": 0, "folder": 0, "follow": 0, "footprint": 0, "fore": 0, "form": 0, "format": 0, "formula": 0, "forward": 0, "forward_prim": 0, "found": 0, "four": 0, "fp": 0, "fr": 0, "frag": 0, "frag1": 0, "frag14": 0, "frag2": 0, "frag20": 0, "frag23": 0, "fragment": 0, "frame": 0, "fring": 0, "from": 0, "from_bio_seqrecord": 0, "from_full_sequence_and_overhang": 0, "from_represent": 0, "from_seqrecord": 0, "from_str": 0, "ft": 0, "ft2": 0, "full": 0, "full_sequ": 0, "func": 0, "function": 0, "funtion": 0, "further": 0, "fuse": 0, "fusion": 0, "fwd": 0, "g": 0, "gaaat": 0, "gaat": 0, "gaattc": 0, "gac": 0, "gacccat": 0, "gacgt": 0, "gagacgtaaatata": 0, "gagacgtaaatatagcgtactgagaagaaa": 0, "gap": 0, "gat": 0, "gatc": 0, "gatcc": 0, "gatccnnngaattc": 0, "gatccttt": 0, "gatcg": 0, "gatcga": 0, "gatcgat": 0, "gatcgatc": 0, "gatcgatg": 0, "gattaca": 0, "gb": 0, "gbkstring": 0, "gbtext": 0, "gbtext_clean": 0, "gbw0jp907tg_yx3jngs4qqwttj": 0, "gbw0jp907tg_yx3jngs4qqwttju": 0, "gc": 0, "gcaagctttgaatgctac5": 0, "gcatacgac": 0, "gcatcgtagtctatttgcttac": 0, "gcta": 0, "gctag": 0, "gctgacatagtagactatcgtg5": 0, "gel_length": 0, "genbank_nucleotid": 0, "gener": 0, "get_cut_paramet": 0, "get_cutsit": 0, "get_cutsite_pair": 0, "get_env": 0, "getcwd": 0, "gf7iorxmniu": 0, "ggaatt": 0, "ggatc": 0, "ggatcc": 0, "ggatcca": 0, "ggatccatgactgct": 0, "ggatccatgactgctaacccttccttggtgttgaacaagatcgacgacatttcgttcgaaacttacgatgggatcc": 0, "ggatcccatcgtaag": 0, "ggatccnnngaattc": 0, "ggcct": 0, "gggaaat": 0, "ggggtttcccc": 0, "gibson": 0, "gip0": 0, "gist": 0, "github": 0, "given": 0, "gmail": 0, "gnnncttaag": 0, "googl": 0, "gov": 0, "govern": 0, "gram": 0, "graph": 0, "greater": 0, "greedi": 0, "greedili": 0, "greyc": 0, "group": 0, "gt": 0, "gtagcta": 0, "gtagctag": 0, "gtt": 0, "gttcttaa": 0, "gttt": 0, "gtttc": 0, "guess": 0, "ha": 0, "half": 0, "handl": 0, "happen": 0, "have": 0, "helix": 0, "high": 0, "highlight": 0, "hold": 0, "home": 0, "homolog": 0, "homologi": 0, "http": 0, "i": 0, "id": 0, "ident": 0, "identifi": 0, "identifier_from_str": 0, "ignor": 0, "imm_tabl": 0, "immedi": 0, "immut": 0, "implement": 0, "import": 0, "includ": 0, "incorpor": 0, "index": 0, "indexerror": 0, "inform": 0, "ing": 0, "inhibit": 0, "inhibitor": 0, "ini": 0, "initi": 0, "initlist": 0, "inplac": 0, "input": 0, "insensit": 0, "insert": 0, "inspect": 0, "instanc": 0, "instanti": 0, "instead": 0, "instread": 0, "int": 0, "integ": 0, "intermedi": 0, "interpol": 0, "interpret": 0, "introspect": 0, "invers": 0, "involv": 0, "ipython": 0, "is_left": 0, "isblunt": 0, "isorf": 0, "issu": 0, "item": 0, "iter": 0, "its": 0, "itself": 0, "iupac": 0, "j": 0, "j2": 0, "jean": 0, "johansson": 0, "join": 0, "jorgensen": 0, "journal": 0, "jseq": 0, "json": 0, "jun": 0, "junction": 0, "just": 0, "k": 0, "kb": 0, "keep": 0, "kei": 0, "kept": 0, "keyword": 0, "klenow": 0, "klenow_frag": 0, "kwarg": 0, "l": 0, "l_": 0, "label": 0, "lactamas": 0, "larger": 0, "last": 0, "lc": 0, "ldseguid": 0, "least": 0, "left": 0, "left_cut": 0, "left_end_posit": 0, "len": 0, "lenght": 0, "length": 0, "length1": 0, "length2": 0, "less": 0, "letter": 0, "levskaya": 0, "lib": 0, "licenc": 0, "licens": 0, "lift": 0, "like": 0, "lim": 0, "limit": 0, "line": 0, "linear": 0, "link": 0, "linux": 0, "list": 0, "list_featur": 0, "lkutrl4": 0, "lkynqhtivh": 0, "loc": 0, "loc1": 0, "loc2": 0, "local": 0, "locat": 0, "location_boundari": 0, "locations_overlap": 0, "locstr": 0, "locu": 0, "log": 0, "log_dir": 0, "loglevel": 0, "logo": 0, "logotyp": 0, "long": 0, "longer": 0, "longest": 0, "look": 0, "loop": 0, "lost": 0, "lower": 0, "lowercas": 0, "lp002422": 0, "lseguid": 0, "lsseguid": 0, "lst": 0, "lyndon": 0, "m": 0, "made": 0, "mai": 0, "main": 0, "maivmgrt": 0, "maivmgru": 0, "maivmgrwkgar": 0, "make": 0, "malform": 0, "manag": 0, "mani": 0, "manual": 0, "map": 0, "map_trace_fil": 0, "mar": 0, "margin": 0, "mass": 0, "match": 0, "max": 0, "max_nod": 0, "maximum": 0, "maxlength": 0, "maxlink": 0, "maxsiz": 0, "mean": 0, "meant": 0, "melt": 0, "memor": 0, "mention": 0, "mer": 0, "merg": 0, "meta": 0, "metalailevalmetglyargtrplysglyalaargt": 0, "metallo": 0, "method": 0, "methyl": 0, "mg": 0, "might": 0, "minimum": 0, "minsiz": 0, "misc": 0, "miscellan": 0, "mit": 0, "mix": 0, "mixtur": 0, "mm": 0, "mmm": 0, "mode": 0, "modif": 0, "modifi": 0, "mol": 0, "mol_typ": 0, "molecul": 0, "molecular": 0, "molecule_typ": 0, "monoval": 0, "most": 0, "mostli": 0, "move": 0, "mung": 0, "mung_bean_nucleas": 0, "must": 0, "mutableseq": 0, "mw": 0, "mwstd": 0, "my_protein": 0, "my_seq": 0, "mydrmlvif": 0, "myemail": 0, "n": 0, "n_cutter": 0, "na": 0, "name": 0, "ncbi": 0, "neb": 0, "nebswebsit": 0, "necessari": 0, "need": 0, "neg": 0, "networkx": 0, "new": 0, "new_dna": 0, "newcom": 0, "next": 0, "nicer": 0, "nih": 0, "nlm": 0, "nm": 0, "nn_tabl": 0, "nnn": 0, "nnnn": 0, "nnnnn": 0, "no_cutt": 0, "node": 0, "nodemap": 0, "non": 0, "none": 0, "normal": 0, "note": 0, "noth": 0, "notion": 0, "now": 0, "nucleas": 0, "nucleotid": 0, "nuclotid": 0, "number": 0, "number_of_cut": 0, "numer": 0, "o": 0, "o3": 0, "o4": 0, "o59": 0, "o6": 0, "o7": 0, "o8": 0, "obj": 0, "object": 0, "obtain": 0, "occur": 0, "occurr": 0, "off": 0, "old": 0, "oligonuceotid": 0, "onc": 0, "once_cutt": 0, "one": 0, "onli": 0, "onlin": 0, "open": 0, "open_cache_fold": 0, "open_config_fold": 0, "open_current_fold": 0, "open_fold": 0, "open_log_fold": 0, "optim": 0, "option": 0, "order": 0, "orf": 0, "orfs_to_featur": 0, "org": 0, "organ": 0, "orient": 0, "origin": 0, "original_loc": 0, "originstr": 0, "other": 0, "otherwis": 0, "out": 0, "output": 0, "outsid": 0, "over": 0, "overhang": 0, "overlap": 0, "ovhg": 0, "own": 0, "p": 0, "p1": 0, "p2": 0, "p3": 0, "pad": 0, "padfirst": 0, "page": 0, "pair": 0, "param": 0, "parament": 0, "paramet": 0, "pars": 0, "parse_prim": 0, "parsegbloc": 0, "part": 0, "part_nam": 0, "pass": 0, "past": 0, "pat": 0, "patent": 0, "path": 0, "pathlib": 0, "pcr": 0, "pcr_prod": 0, "perform": 0, "permanantli": 0, "permut": 0, "pf": 0, "pfu": 0, "pfu_sso7d_program": 0, "php": 0, "phusion": 0, "pierr": 0, "pl": 0, "place": 0, "plain": 0, "plasmid": 0, "plausibl": 0, "pleas": 0, "plu": 0, "po": 0, "point": 0, "polymeras": 0, "pop": 0, "posit": 0, "possibl": 0, "power": 0, "pr": 0, "practic": 0, "preceed": 0, "prefer": 0, "presenc": 0, "present": 0, "press": 0, "pretty_str": 0, "previou": 0, "prime": 0, "primer1": 0, "primer_design": 0, "primerc": 0, "primerdict": 0, "primerlist": 0, "prinmer": 0, "print": 0, "probabl": 0, "process": 0, "prodcod": 0, "produc": 0, "product": 0, "productcod": 0, "program": 0, "properti": 0, "protein": 0, "proteinseqrecord": 0, "protocol": 0, "protrud": 0, "provid": 0, "pth": 0, "pubm": 0, "purpos": 0, "put": 0, "py": 0, "pydna_": 0, "pydna_cached_func": 0, "pydna_cod": 0, "pydna_code_from_list": 0, "pydna_config_dir": 0, "pydna_data_dir": 0, "pydna_email": 0, "pydna_prim": 0, "pydnaseqrecord": 0, "pyl": 0, "pypars": 0, "python": 0, "python2": 0, "python3": 0, "python_packag": 0, "q5": 0, "qht": 0, "qualifi": 0, "quick": 0, "quicker": 0, "quit": 0, "r": 0, "r64": 0, "rais": 0, "randomdna": 0, "randomorf": 0, "randomprot": 0, "randomrna": 0, "rarecodon": 0, "ration": 0, "rbrixtel_at_gmail_dot_com": 0, "rc": 0, "reaction": 0, "read": 0, "read_prim": 0, "readabl": 0, "reason": 0, "rec": 0, "recent": 0, "recognit": 0, "recombin": 0, "record": 0, "ref": 0, "refer": 0, "reflect": 0, "region": 0, "relat": 0, "reli": 0, "rememb": 0, "remov": 0, "render": 0, "repeat": 0, "replac": 0, "report": 0, "repositori": 0, "repr": 0, "repres": 0, "represent": 0, "requir": 0, "resect": 0, "reserv": 0, "respect": 0, "restrict": 0, "restrictionbatch": 0, "restrictionenzym": 0, "result": 0, "return": 0, "retwingl": 0, "rev": 0, "revers": 0, "reverse_compl": 0, "reverse_prim": 0, "rhoad": 0, "right": 0, "right_cut": 0, "right_end_posit": 0, "rml": 0, "rna": 0, "romain": 0, "rotat": 0, "roundtrip": 0, "rowend": 0, "rowstart": 0, "rp": 0, "rstr": 0, "rule": 0, "rychlik": 0, "s2": 0, "s3": 0, "safe": 0, "salt": 0, "saltc": 0, "saltcorr": 0, "same": 0, "sampl": 0, "scanner": 0, "sce": 0, "search": 0, "second": 0, "section": 0, "see": 0, "seguid": 0, "sel": 0, "selenocystein": 0, "self": 0, "selfcomp": 0, "sens": 0, "sensit": 0, "separ": 0, "seq": 0, "seq3": 0, "seq31": 0, "seq_len": 0, "seq_to_open": 0, "seqenc": 0, "seqfeatur": 0, "seqio": 0, "sequec": 0, "sequenc": 0, "sequtil": 0, "set": 0, "set_forward_primer_footprint": 0, "set_reverse_primer_footprint": 0, "sever": 0, "shape": 0, "share": 0, "shaw": 0, "shell": 0, "shell_command_for_editor": 0, "shift": 0, "shift_featur": 0, "shift_loc": 0, "short": 0, "shortest": 0, "should": 0, "show": 0, "side": 0, "sign": 0, "similar": 0, "simpl": 0, "simpleloc": 0, "simpler": 0, "simplifi": 0, "simul": 0, "sinc": 0, "singl": 0, "site": 0, "size": 0, "slc": 0, "slice": 0, "slightli": 0, "slow": 0, "smallest": 0, "smallest_rot": 0, "snippet": 0, "so": 0, "softwar": 0, "some": 0, "someon": 0, "sort": 0, "sorted_featur": 0, "spacer": 0, "specif": 0, "specifi": 0, "spencer": 0, "split": 0, "spyder": 0, "sr": 0, "sso7d": 0, "sta": 0, "stagger": 0, "stamp": 0, "standard": 0, "start": 0, "startcodon": 0, "startposit": 0, "startx1": 0, "startx2": 0, "starty1": 0, "starty2": 0, "stdin": 0, "stdout": 0, "sticki": 0, "sticky3": 0, "sticky5": 0, "stop": 0, "stop_symbol": 0, "stopcodon": 0, "store": 0, "str": 0, "str_": 0, "strand": 0, "stretch": 0, "strict": 0, "string": 0, "stringi": 0, "stringx": 0, "strip_ind": 0, "strip_multilin": 0, "strorbyt": 0, "structur": 0, "stuff": 0, "sub": 0, "subclass": 0, "subfrag": 0, "sublcass": 0, "subsequ": 0, "substitut": 0, "substr": 0, "suggest": 0, "suppli": 0, "support": 0, "surviv": 0, "switch": 0, "symbol": 0, "syn": 0, "sync": 0, "synhtes": 0, "synthet": 0, "system": 0, "t": 0, "t4": 0, "ta": 0, "ta_dbd": 0, "ta_default": 0, "taa": 0, "taaa": 0, "tab": 0, "tac": 0, "tacactcaccgtctatcattatc": 0, "tacactcaccgtctatcattatctactatcgactgtatcatctgatagcac": 0, "tact": 0, "tactggg": 0, "tag": 0, "tagctag": 0, "tagctgactgcacaa": 0, "tail": 0, "take": 0, "taq": 0, "taq_program": 0, "target": 0, "target_tm": 0, "tattctggctgtatc": 0, "tattctggctgtatcgggggtacgatgctatactg": 0, "taxon": 0, "taxonomi": 0, "tccgga": 0, "tcctag": 0, "tcgcatgactcttcttt": 0, "tcggatagtagaacca": 0, "tcggatagtagaaccagagacgt": 0, "tcggatagtagaaccagagacgtaaatata": 0, "tcggatagtagaaccagagacgtaaatatagcgtactgagaagaaa": 0, "tcl": 0, "tclsh": 0, "tclsh8": 0, "tcttggtctctgcatttatat": 0, "tech": 0, "techniqu": 0, "technologi": 0, "tell": 0, "temp": 0, "temperatur": 0, "templat": 0, "temprari": 0, "ter": 0, "term": 0, "termin": 0, "terminal_overlap": 0, "terminal_transferas": 0, "test": 0, "tewydy0ugvgxh3vjnvwgtxoydqa": 0, "texa": 0, "text": 0, "tga": 0, "tgagtagtcgtagtcgtcgtat": 0, "tgatcgtcatgctgactatactat": 0, "tggatcc": 0, "tgtactggtgctgaaccttgtatcaagttgggtgttgacgccattgccccaggtggtcgtttcgtt": 0, "tgtgctgtgctcta": 0, "tgtgctgtgctctattttttattctggctgtatc": 0, "than": 0, "the_exo": 0, "thei": 0, "them": 0, "thermodynam": 0, "thi": 0, "thing": 0, "those": 0, "three": 0, "three_frame_orf": 0, "three_prime_end": 0, "threonin": 0, "through": 0, "throw": 0, "thrown": 0, "time": 0, "titl": 0, "tm_dbd": 0, "tm_default": 0, "tm_func": 0, "tm_neb": 0, "tm_nn": 0, "tm_product": 0, "tmapi": 0, "tmbresluc": 0, "tmf": 0, "tmm_tabl": 0, "tmpdir": 0, "tmr": 0, "to_stop": 0, "togb": 0, "togeth": 0, "toint": 0, "tojson": 0, "tolinear": 0, "tool": 0, "top": 0, "topologi": 0, "tp2jzecm2e3w4yxtrrx09cmka_8": 0, "trace": 0, "traceback": 0, "track": 0, "transcrib": 0, "translat": 0, "treatment": 0, "tri": 0, "trick": 0, "true": 0, "trunc": 0, "try": 0, "tt": 0, "ttaagg": 0, "ttat": 0, "ttc": 0, "ttcaagaa": 0, "ttcttaa": 0, "ttcttaagtt": 0, "ttg": 0, "ttt": 0, "ttta": 0, "tttac": 0, "tttat": 0, "tttatatcgcatgactcttcttt": 0, "tttc": 0, "tttcccc": 0, "tttg": 0, "tttt": 0, "tttttt": 0, "tupl": 0, "turn": 0, "tweak": 0, "twice": 0, "twice_cutt": 0, "two": 0, "txt": 0, "type": 0, "type3": 0, "type5": 0, "type_": 0, "typeerror": 0, "typic": 0, "u": 0, "unassign": 0, "undefined_sequ": 0, "underli": 0, "union": 0, "unique_cutt": 0, "univers": 0, "unk": 0, "unknown": 0, "up": 0, "upper": 0, "uppercas": 0, "url": 0, "urlsaf": 0, "usag": 0, "user": 0, "userlist": 0, "users_email": 0, "usr": 0, "usual": 0, "utah": 0, "v": 0, "val": 0, "valid": 0, "valu": 0, "valueerror": 0, "variabl": 0, "variou": 0, "vector": 0, "veri": 0, "version": 0, "vf": 0, "view": 0, "visual": 0, "vitro": 0, "vivo": 0, "w": 0, "wa": 0, "wai": 0, "watson": 0, "watson_ovhg": 0, "wayn": 0, "we": 0, "weight": 0, "well": 0, "when": 0, "where": 0, "which": 0, "while": 0, "who": 0, "whole": 0, "whose": 0, "wiki": 0, "wikidata": 0, "wikipedia": 0, "window": 0, "without": 0, "wo": 0, "wo2007025016": 0, "word": 0, "work": 0, "would": 0, "wprintgc": 0, "wrap": 0, "wrapstr": 0, "write": 0, "written": 0, "www": 0, "x": 0, "x1b": 0, "xaa": 0, "xle": 0, "xxx": 0, "y": 0, "yet": 0, "you": 0, "z": 0}, "titles": ["Welcome to pydna\u2019s documentation!"], "titleterms": {"": 0, "amplicon": 0, "amplifi": 0, "assembli": 0, "code": 0, "common_sub_str": 0, "content": 0, "contig": 0, "design": 0, "document": 0, "download": 0, "dseq": 0, "dseqrecord": 0, "editor": 0, "exampl": 0, "gel": 0, "genbank": 0, "genbankfil": 0, "genbankfix": 0, "genbankrecord": 0, "get": 0, "help": 0, "how": 0, "indic": 0, "layout": 0, "modul": 0, "more": 0, "myprim": 0, "packag": 0, "parser": 0, "primer": 0, "pydna": 0, "reader": 0, "seqrecord": 0, "sourc": 0, "tabl": 0, "tm": 0, "us": 0, "util": 0, "welcom": 0}}) \ No newline at end of file