From bfd47e20f7b7d91fd6965c4134917546b78f6153 Mon Sep 17 00:00:00 2001 From: Noa Aviel Dove Date: Tue, 20 Aug 2024 15:40:55 -0700 Subject: [PATCH] Convert hca_metadata_api cans to new format --- ...a3fb4204953.2018-08-03T082009.272868Z.json | 607 + .../2018-08-03T082009.272868Z/manifest.json | 158 - .../2018-08-03T082009.272868Z/metadata.json | 447 - ...a3fb4204953.2018-08-03T082009.272868Z.json | 659 + .../2018-08-03T082009.272868Z/manifest.json | 194 - .../2018-08-03T082009.272868Z/metadata.json | 463 - ...a3fb4204953.2018-08-03T082009.272868Z.json | 1982 +++ .../2018-08-03T082009.272868Z/manifest.json | 602 - .../2018-08-03T082009.272868Z/metadata.json | 1378 -- ...a3fb4204953.2018-08-03T082009.272868Z.json | 563 + .../2018-08-03T082009.272868Z/manifest.json | 158 - .../2018-08-03T082009.272868Z/metadata.json | 403 - ...a3fb4204953.2018-08-03T082009.272868Z.json | 592 + .../2018-08-03T082009.272868Z/manifest.json | 170 - .../2018-08-03T082009.272868Z/metadata.json | 420 - ...a3fb4204953.2018-08-03T082009.272868Z.json | 498 + .../2018-08-03T082009.272868Z/manifest.json | 170 - .../2018-08-03T082009.272868Z/metadata.json | 326 - ...a3fb4204953.2018-08-03T082009.272868Z.json | 878 ++ .../2018-08-03T082009.272868Z/manifest.json | 338 - .../2018-08-03T082009.272868Z/metadata.json | 538 - ...318dbb86000.2019-01-03T163633.780215Z.json | 2049 +++ .../2019-01-03T163633.780215Z/manifest.json | 598 - .../2019-01-03T163633.780215Z/metadata.json | 1449 -- ...61d6da02d44.2019-09-20T103932.395795Z.json | 1072 ++ .../2019-09-20T103932.395795Z/manifest.json | 326 - .../2019-09-20T103932.395795Z/metadata.json | 744 - ...a3fb4204953.2018-03-29T142048.835519Z.json | 678 + .../2018-03-29T142048.835519Z/manifest.json | 98 - .../2018-03-29T142048.835519Z/metadata.json | 578 - ...d019d1c9439.2019-05-15T222432.561000Z.json | 425 + .../2019-05-15T222432.561000Z/manifest.json | 194 - .../2019-05-15T222432.561000Z/metadata.json | 233 - ...08092b2dabe.2019-04-17T175706.867000Z.json | 933 ++ .../2019-04-17T175706.867000Z/manifest.json | 230 - .../2019-04-17T175706.867000Z/metadata.json | 701 - ...68e20ec4a2e.2019-02-02T065454.662896Z.json | 2704 ++++ .../2019-02-02T065454.662896Z/manifest.json | 1046 -- .../2019-02-02T065454.662896Z/metadata.json | 1656 --- ...19c1c2d9018.2018-10-07T130111.835234Z.json | 672 + .../2018-10-07T130111.835234Z/manifest.json | 194 - .../2018-10-07T130111.835234Z/metadata.json | 476 - ...406a478d5ab.2018-09-05T182535.846470Z.json | 501 + .../2018-09-05T182535.846470Z/manifest.json | 194 - .../2018-09-05T182535.846470Z/metadata.json | 305 - ...95a3f8deb9c.2019-04-03T103426.471000Z.json | 11982 ++++++++++++++++ .../2019-04-03T103426.471000Z/manifest.json | 5582 ------- .../2019-04-03T103426.471000Z/metadata.json | 6398 --------- ...720f33a5dde.2019-03-17T220646.332108Z.json | 790 + .../2019-03-17T220646.332108Z/manifest.json | 230 - .../2019-03-17T220646.332108Z/metadata.json | 558 - test/hca_metadata_api/test.py | 26 +- 52 files changed, 27596 insertions(+), 27570 deletions(-) create mode 100644 test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json delete mode 100644 test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000.2019-01-03T163633.780215Z.json delete mode 100644 test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44.2019-09-20T103932.395795Z.json delete mode 100644 test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-03-29T142048.835519Z.json delete mode 100644 test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439.2019-05-15T222432.561000Z.json delete mode 100644 test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe.2019-04-17T175706.867000Z.json delete mode 100644 test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/metadata.json create mode 100644 test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e.2019-02-02T065454.662896Z.json delete mode 100644 test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/metadata.json create mode 100644 test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018.2018-10-07T130111.835234Z.json delete mode 100644 test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/metadata.json create mode 100644 test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab.2018-09-05T182535.846470Z.json delete mode 100644 test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/metadata.json create mode 100644 test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c.2019-04-03T103426.471000Z.json delete mode 100644 test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/metadata.json create mode 100644 test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde.2019-03-17T220646.332108Z.json delete mode 100644 test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/manifest.json delete mode 100644 test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/metadata.json diff --git a/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..01627b98e --- /dev/null +++ b/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,607 @@ +{ + "manifest": [ + { + "crc32c": "1C09FCE0", + "sha1": "f1aeb2b94ce28ee524388730c9b63b7dafc895c7", + "sha256": "b3f554280c892aecfc235a64f924843b2484f73cb0cd21aacdd1d796383a6d69", + "s3_etag": "bceb1c61bab478faf3f70e0ff832b4c0", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 770, + "uuid": "84354fad-8890-41df-b808-48f9ed4e1cc3", + "version": "1" + }, + { + "crc32c": "28EA16F2", + "sha1": "7cc7ac34f3c2c00befb398a63b5303d636ca4711", + "sha256": "de429783e1308851f7f5e8320d8612e7c1ad90975698fec9a481c836db2e9543", + "s3_etag": "61eb8b831af8c1fdf1105ee9cb66fb16", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 711, + "uuid": "30cf9805-82f5-4725-a7ad-7411c276b4a9", + "version": "1" + }, + { + "crc32c": "C2C08857", + "sha1": "8f1b7481a5dc77f3a6c90530a957952102a92e35", + "sha256": "94be68544f8a5a0171fd918e070150a29fa1c8f4380ec351a302bb56b980b491", + "s3_etag": "d98de4db8b42b8def2aa2591da2f8569", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1358, + "uuid": "491a22fb-3a6c-4a8f-9c5b-f009e080d280", + "version": "1" + }, + { + "crc32c": "0B85C35C", + "sha1": "dd9a81c11165c742d94b1cb8561e3789854a8ca7", + "sha256": "e215aceb61560e510592eb1f4247c501ea0d756659bd781d995df0546ecb9696", + "s3_etag": "abc3a4a3dbec4beab0e2cacf50b831c4", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1087, + "uuid": "821601f1-64e8-4427-8680-34a743b35b69", + "version": "1" + }, + { + "crc32c": "DDAABBB6", + "sha1": "82c4c5273e31923bf6e12139804c3a4cf10b338d", + "sha256": "3de258c171a757d80e53a617ce1834e14710c87db0289c9b2012d0a14a3ea705", + "s3_etag": "4dc6069c891063f28a0ee155c6cd7b65", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 1856, + "uuid": "04e79979-489e-4cd8-93c3-1d8e99d09ec8", + "version": "1" + }, + { + "crc32c": "522D96A7", + "sha1": "9876adb67827ea0328566811a1304bcf49a31b02", + "sha256": "ecc1b1a2cd924933311c28e9b00f841c0beaa918f3c29722a36ff3fa6600440b", + "s3_etag": "4f939c7dae692b468e4741b56ccfbe3e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 386, + "uuid": "c4175b47-1767-48c5-b408-f9e97c01f94e", + "version": "1" + }, + { + "crc32c": "51B043A0", + "sha1": "9b17c9cd8e3d7c3bc4685e24bbcba9e528792d05", + "sha256": "98d9878e05b6a56fed6d00153aa5c0664de07185994e2cf080ec1be4b4776933", + "s3_etag": "8ff1e91a29e51311d5252889599eb709", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 386, + "uuid": "88b3b728-e9c6-4b1b-a030-97f6670469c2", + "version": "1" + }, + { + "crc32c": "1FAD27D0", + "sha1": "b2a61619fa1922cb899d993aace4fa0f6b30a232", + "sha256": "31eab93a5c0e39c58ee16d16c0ce5331e2185cc271891fbd63e7f62a75336e4b", + "s3_etag": "a781ef10618d4bd5c11bf5bb923d4d12", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 384, + "uuid": "317b3c35-e0f6-48d6-9154-80db47ff8f20", + "version": "1" + }, + { + "crc32c": "68AEC241", + "sha1": "1296d3c9b98cef091f1aecd6d9df25fa7f780d5c", + "sha256": "c9cd608014bb3cfd7b0ab891cd597272f0e860f0d5e7f0eab38338d828ba2bec", + "s3_etag": "93f27be5baa191e55406b1b54af4bd1e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 6018, + "uuid": "a34d2ddc-1433-4a3c-b1de-ad3a26adca9e", + "version": "1" + }, + { + "crc32c": "29B559F9", + "sha1": "0587673d7d88efa40a6f4d25d34d2eba14cf8e8b", + "sha256": "df8b88b6f32f494a53687f79724a6ebd8bbb9c5c0474b9a857d467a0bdb83c2d", + "s3_etag": "ef8edc4bf0ba07805a052cd7686b5ea7", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 566, + "uuid": "6832e250-33c6-469a-b105-efa0d6f61309", + "version": "1" + }, + { + "crc32c": "29B559F9", + "sha1": "0587673d7d88efa40a6f4d25d34d2eba14cf8e8b", + "sha256": "df8b88b6f32f494a53687f79724a6ebd8bbb9c5c0474b9a857d467a0bdb83c2d", + "s3_etag": "ef8edc4bf0ba07805a052cd7686b5ea7", + "content-type": "application/octet-stream", + "indexed": false, + "name": "MantonBM1_HiSeq_1_S1_L007_I1_001.fastq.gz", + "size": 566, + "uuid": "c8a4ea32-6d66-48f3-b480-9421743b9c0a", + "version": "1" + }, + { + "crc32c": "5B68EDBD", + "sha1": "189a903531d1b9fe78e035945ed29bc004636526", + "sha256": "87854958090c0868f38be4ac5c7aa2324ff027b2b4803a5a2fd9a8eb01af4f21", + "s3_etag": "2c0a2cf2cc963e8f01e85cc324763c4c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 864, + "uuid": "86417b00-f90f-409d-a9dd-717d077c3cf4", + "version": "1" + }, + { + "crc32c": "290F5DCB", + "sha1": "3d4837dacac05df3adb29fa05874a5841b4661f7", + "sha256": "62e38c88e4038b73e52abafeb08440ccb6eb4417c1f56fd3fc7bc10a2aec32ff", + "s3_etag": "9512af43df021d47adc83a34d49046b9", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 852, + "uuid": "169096e5-f310-4c67-9a70-e139a3576e9e", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1_BM1_cells", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "selected_cell_type": [ + { + "text": "bone marrow hematopoietic cell", + "ontology": "CL:1001610" + } + ], + "total_estimated_cells": 4294, + "provenance": { + "document_id": "7b53bae2-2424-44c0-9d80-ad72e8bca136", + "submission_date": "2018-09-04T12:26:41.629Z", + "update_date": "2018-09-04T12:27:19.625Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "mononuclear cell isolation", + "protocol_description": "We isolated mononuclear cells for all samples in preparation for 10x sequencing." + }, + "dissociation_method": { + "text": "10x sequencing", + "ontology": "EFO:0008995" + }, + "provenance": { + "document_id": "eebf404f-4fbb-41b0-a9c6-81586f729599", + "submission_date": "2018-09-04T12:26:54.982Z", + "update_date": "2018-09-04T12:26:56.433Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "BM1", + "biomaterial_name": "Bone Marrow donor 1", + "biomaterial_description": "Bone Marrow donor 1", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organism_age": "52", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272" + }, + "is_living": "yes", + "sex": "female", + "medical_history": { + "smoking_history": "no" + }, + "human_specific": { + "ethnicity": [ + { + "text": "Caucasian" + } + ] + }, + "weight": "69", + "weight_unit": { + "text": "kilogram", + "ontology": "UO:0000009" + }, + "height": "165", + "height_unit": { + "text": "centimeter", + "ontology": "UO:0000015" + }, + "provenance": { + "document_id": "628e8b1d-a1ce-4dee-b15a-3fd33290eafe", + "submission_date": "2018-09-04T12:26:40.051Z", + "update_date": "2018-09-04T12:27:10.175Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Preparing RNA for sequencing by 10x" + }, + "cell_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_approach": { + "text": "10X sequencing", + "ontology": "EFO:0008995" + }, + "nucleic_acid_source": "single cell", + "end_bias": "3 prime tag", + "primer": "poly-dT", + "strand": "second", + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 16, + "barcode_length": 10 + }, + "provenance": { + "document_id": "e4024c4a-dbce-4bda-bed8-21414091e7ce", + "submission_date": "2018-09-04T12:26:54.992Z", + "update_date": "2018-09-04T12:27:50.909Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "d691bda4-ed01-48b6-a4ea-65b70f6a3946", + "inputs": [ + "7b53bae2-2424-44c0-9d80-ad72e8bca136" + ], + "input_type": "biomaterial", + "outputs": [ + "36d7f891-8a43-4ae4-8472-a34dcb2be643" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "e4024c4a-dbce-4bda-bed8-21414091e7ce" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "aaa08845-5150-4a4f-9c44-5ea22add1fc3" + } + ] + }, + { + "process": "98442f49-9afb-491e-8347-f891f39d8d70", + "inputs": [ + "6228558b-436a-46c9-9cd3-ea9b5c123070" + ], + "input_type": "biomaterial", + "outputs": [ + "7b53bae2-2424-44c0-9d80-ad72e8bca136" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "eebf404f-4fbb-41b0-a9c6-81586f729599" + } + ] + }, + { + "process": "5aa4645b-2802-4140-9b15-d1008338b1c9", + "inputs": [ + "628e8b1d-a1ce-4dee-b15a-3fd33290eafe" + ], + "input_type": "biomaterial", + "outputs": [ + "6228558b-436a-46c9-9cd3-ea9b5c123070" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + }, + "process_0.json": { + "process_core": { + "process_id": "process_id_128" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "98442f49-9afb-491e-8347-f891f39d8d70", + "submission_date": "2018-09-04T12:26:57.064Z", + "update_date": "2018-09-04T12:28:00.426Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_255" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "d691bda4-ed01-48b6-a4ea-65b70f6a3946", + "submission_date": "2018-09-04T12:26:58.574Z", + "update_date": "2018-09-04T12:28:06.541Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "5aa4645b-2802-4140-9b15-d1008338b1c9", + "submission_date": "2018-09-04T12:26:55.041Z", + "update_date": "2018-09-04T12:27:51.508Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "1M Immune Cells", + "project_title": "Census of Immune Cells", + "project_description": "Diverse cells of the immune system maintain and protect tissue function, integrity, and homeostasis upon changes in functional demands and diverse perturbations. Recent advances such as massively parallel single-cell RNA-sequencing and sophisticated computational methods help shed new light on this complexity. This immune cell census aims to profile up to 2M immunocytes, the first tranche of this is currently available. With computational methods optimized to a massive scale, we can readily identify cell types and markers, as well as the process of hematopoietic differentiation. The high quality and comprehensive reference map is provided as an open community resource for understanding human health and disease." + }, + "contributors": [ + { + "contact_name": "Aviv,,Regev", + "email": "aregev@broadinstitute.org", + "phone": "(617) 714-7020", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Bo,,Li", + "email": "libo@broadinstitute.org", + "phone": "(617) 714-8681", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Monika,S,Kowalczyk", + "email": "msk.kowalczyk@gmail.com", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Danielle,,Dionne", + "email": "dionne@broadinstitute.org", + "phone": "(617) 714-8147", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Timothy,,Tickle", + "email": "ttickle@broadinstitute.org", + "phone": "(617) 714-7084", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Jane,,Lee", + "email": "janelee@broadinstitute.org", + "phone": "(617) 714-7448", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Orit,,Rozenblatt-Rosen", + "email": "orit@broadinstitute.org", + "phone": "(617) 714-7789", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Orr,,Ashenberg", + "email": "orr@broadinstitute.org", + "phone": "(617) 714-8681", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Marcin,,Tabaka", + "email": "mtabaka@broadinstitute.org", + "phone": "(617) 714-7470", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Karthik,,Shekhar", + "email": "karthik@broadinstitute.org", + "phone": "(617) 714-8067", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Michal,,Slyper", + "email": "mslyper@broadinstitute.org", + "phone": "(617) 714-7199", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Julia,,Waldman", + "email": "jwaldman@broadinstitute.org", + "institution": "Broad Institute", + "laboratory": "Regev Lab", + "address": "415 Main Street, Cambridge, MA", + "country": "USA" + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Danielle,,Welter", + "email": "dwelter@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-1058-2668", + "corresponding_contributor": false + } + ], + "provenance": { + "document_id": "617eb7c1-a3bc-4dd3-9a2a-50a77c998e22", + "submission_date": "2018-09-04T12:26:40.041Z", + "update_date": "2018-09-04T12:27:09.930Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "MantonBM1_HiSeq_1_S1_L007_I1_001.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "index1", + "lane_index": 7, + "read_length": 8, + "technical_replicate_group": "1_BM1_cells_r1", + "provenance": { + "document_id": "36d7f891-8a43-4ae4-8472-a34dcb2be643", + "submission_date": "2018-09-04T12:26:43.089Z", + "update_date": "2018-09-04T12:27:39.827Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "10x_v2_sequencing_protocol_1", + "protocol_name": "Sequencing bone marrow donor 1-4", + "protocol_description": "Single cell sequencing of cDNAs by 10x" + }, + "instrument_manufacturer_model": { + "text": "Illumina Hiseq X 10", + "ontology": "EFO:0008567" + }, + "local_machine_name": "HXE", + "paired_end": true, + "sequencing_approach": { + "text": "tag based single cell RNA sequencing", + "ontology": "EFO:0008440" + }, + "provenance": { + "document_id": "aaa08845-5150-4a4f-9c44-5ea22add1fc3", + "submission_date": "2018-09-04T12:26:55.003Z", + "update_date": "2018-09-04T12:27:50.911Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1_BM1", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "bone", + "ontology": "UBERON:0001474" + }, + "organ_part": { + "text": "bone marrow", + "ontology": "UBERON:0002371" + }, + "purchased_specimen": { + "manufacturer": "Stem Cell Technologies" + }, + "provenance": { + "document_id": "6228558b-436a-46c9-9cd3-ea9b5c123070", + "submission_date": "2018-09-04T12:26:40.206Z", + "update_date": "2018-09-04T12:27:13.378Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index b0a606b26..000000000 --- a/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,158 +0,0 @@ -[ - { - "crc32c": "1C09FCE0", - "sha1": "f1aeb2b94ce28ee524388730c9b63b7dafc895c7", - "sha256": "b3f554280c892aecfc235a64f924843b2484f73cb0cd21aacdd1d796383a6d69", - "s3_etag": "bceb1c61bab478faf3f70e0ff832b4c0", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 770, - "uuid": "84354fad-8890-41df-b808-48f9ed4e1cc3", - "version": "1" - }, - { - "crc32c": "28EA16F2", - "sha1": "7cc7ac34f3c2c00befb398a63b5303d636ca4711", - "sha256": "de429783e1308851f7f5e8320d8612e7c1ad90975698fec9a481c836db2e9543", - "s3_etag": "61eb8b831af8c1fdf1105ee9cb66fb16", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 711, - "uuid": "30cf9805-82f5-4725-a7ad-7411c276b4a9", - "version": "1" - }, - { - "crc32c": "C2C08857", - "sha1": "8f1b7481a5dc77f3a6c90530a957952102a92e35", - "sha256": "94be68544f8a5a0171fd918e070150a29fa1c8f4380ec351a302bb56b980b491", - "s3_etag": "d98de4db8b42b8def2aa2591da2f8569", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1358, - "uuid": "491a22fb-3a6c-4a8f-9c5b-f009e080d280", - "version": "1" - }, - { - "crc32c": "0B85C35C", - "sha1": "dd9a81c11165c742d94b1cb8561e3789854a8ca7", - "sha256": "e215aceb61560e510592eb1f4247c501ea0d756659bd781d995df0546ecb9696", - "s3_etag": "abc3a4a3dbec4beab0e2cacf50b831c4", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1087, - "uuid": "821601f1-64e8-4427-8680-34a743b35b69", - "version": "1" - }, - { - "crc32c": "DDAABBB6", - "sha1": "82c4c5273e31923bf6e12139804c3a4cf10b338d", - "sha256": "3de258c171a757d80e53a617ce1834e14710c87db0289c9b2012d0a14a3ea705", - "s3_etag": "4dc6069c891063f28a0ee155c6cd7b65", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 1856, - "uuid": "04e79979-489e-4cd8-93c3-1d8e99d09ec8", - "version": "1" - }, - { - "crc32c": "522D96A7", - "sha1": "9876adb67827ea0328566811a1304bcf49a31b02", - "sha256": "ecc1b1a2cd924933311c28e9b00f841c0beaa918f3c29722a36ff3fa6600440b", - "s3_etag": "4f939c7dae692b468e4741b56ccfbe3e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 386, - "uuid": "c4175b47-1767-48c5-b408-f9e97c01f94e", - "version": "1" - }, - { - "crc32c": "51B043A0", - "sha1": "9b17c9cd8e3d7c3bc4685e24bbcba9e528792d05", - "sha256": "98d9878e05b6a56fed6d00153aa5c0664de07185994e2cf080ec1be4b4776933", - "s3_etag": "8ff1e91a29e51311d5252889599eb709", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 386, - "uuid": "88b3b728-e9c6-4b1b-a030-97f6670469c2", - "version": "1" - }, - { - "crc32c": "1FAD27D0", - "sha1": "b2a61619fa1922cb899d993aace4fa0f6b30a232", - "sha256": "31eab93a5c0e39c58ee16d16c0ce5331e2185cc271891fbd63e7f62a75336e4b", - "s3_etag": "a781ef10618d4bd5c11bf5bb923d4d12", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 384, - "uuid": "317b3c35-e0f6-48d6-9154-80db47ff8f20", - "version": "1" - }, - { - "crc32c": "68AEC241", - "sha1": "1296d3c9b98cef091f1aecd6d9df25fa7f780d5c", - "sha256": "c9cd608014bb3cfd7b0ab891cd597272f0e860f0d5e7f0eab38338d828ba2bec", - "s3_etag": "93f27be5baa191e55406b1b54af4bd1e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 6018, - "uuid": "a34d2ddc-1433-4a3c-b1de-ad3a26adca9e", - "version": "1" - }, - { - "crc32c": "29B559F9", - "sha1": "0587673d7d88efa40a6f4d25d34d2eba14cf8e8b", - "sha256": "df8b88b6f32f494a53687f79724a6ebd8bbb9c5c0474b9a857d467a0bdb83c2d", - "s3_etag": "ef8edc4bf0ba07805a052cd7686b5ea7", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 566, - "uuid": "6832e250-33c6-469a-b105-efa0d6f61309", - "version": "1" - }, - { - "crc32c": "29B559F9", - "sha1": "0587673d7d88efa40a6f4d25d34d2eba14cf8e8b", - "sha256": "df8b88b6f32f494a53687f79724a6ebd8bbb9c5c0474b9a857d467a0bdb83c2d", - "s3_etag": "ef8edc4bf0ba07805a052cd7686b5ea7", - "content-type": "application/octet-stream", - "indexed": false, - "name": "MantonBM1_HiSeq_1_S1_L007_I1_001.fastq.gz", - "size": 566, - "uuid": "c8a4ea32-6d66-48f3-b480-9421743b9c0a", - "version": "1" - }, - { - "crc32c": "5B68EDBD", - "sha1": "189a903531d1b9fe78e035945ed29bc004636526", - "sha256": "87854958090c0868f38be4ac5c7aa2324ff027b2b4803a5a2fd9a8eb01af4f21", - "s3_etag": "2c0a2cf2cc963e8f01e85cc324763c4c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 864, - "uuid": "86417b00-f90f-409d-a9dd-717d077c3cf4", - "version": "1" - }, - { - "crc32c": "290F5DCB", - "sha1": "3d4837dacac05df3adb29fa05874a5841b4661f7", - "sha256": "62e38c88e4038b73e52abafeb08440ccb6eb4417c1f56fd3fc7bc10a2aec32ff", - "s3_etag": "9512af43df021d47adc83a34d49046b9", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 852, - "uuid": "169096e5-f310-4c67-9a70-e139a3576e9e", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index 3a2e44de9..000000000 --- a/test/hca_metadata_api/cans/examples/1M Immune Cells/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,447 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1_BM1_cells", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "selected_cell_type": [ - { - "text": "bone marrow hematopoietic cell", - "ontology": "CL:1001610" - } - ], - "total_estimated_cells": 4294, - "provenance": { - "document_id": "7b53bae2-2424-44c0-9d80-ad72e8bca136", - "submission_date": "2018-09-04T12:26:41.629Z", - "update_date": "2018-09-04T12:27:19.625Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "mononuclear cell isolation", - "protocol_description": "We isolated mononuclear cells for all samples in preparation for 10x sequencing." - }, - "dissociation_method": { - "text": "10x sequencing", - "ontology": "EFO:0008995" - }, - "provenance": { - "document_id": "eebf404f-4fbb-41b0-a9c6-81586f729599", - "submission_date": "2018-09-04T12:26:54.982Z", - "update_date": "2018-09-04T12:26:56.433Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "BM1", - "biomaterial_name": "Bone Marrow donor 1", - "biomaterial_description": "Bone Marrow donor 1", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organism_age": "52", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272" - }, - "is_living": "yes", - "sex": "female", - "medical_history": { - "smoking_history": "no" - }, - "human_specific": { - "ethnicity": [ - { - "text": "Caucasian" - } - ] - }, - "weight": "69", - "weight_unit": { - "text": "kilogram", - "ontology": "UO:0000009" - }, - "height": "165", - "height_unit": { - "text": "centimeter", - "ontology": "UO:0000015" - }, - "provenance": { - "document_id": "628e8b1d-a1ce-4dee-b15a-3fd33290eafe", - "submission_date": "2018-09-04T12:26:40.051Z", - "update_date": "2018-09-04T12:27:10.175Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Preparing RNA for sequencing by 10x" - }, - "cell_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_approach": { - "text": "10X sequencing", - "ontology": "EFO:0008995" - }, - "nucleic_acid_source": "single cell", - "end_bias": "3 prime tag", - "primer": "poly-dT", - "strand": "second", - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 16, - "barcode_length": 10 - }, - "provenance": { - "document_id": "e4024c4a-dbce-4bda-bed8-21414091e7ce", - "submission_date": "2018-09-04T12:26:54.992Z", - "update_date": "2018-09-04T12:27:50.909Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "d691bda4-ed01-48b6-a4ea-65b70f6a3946", - "inputs": [ - "7b53bae2-2424-44c0-9d80-ad72e8bca136" - ], - "input_type": "biomaterial", - "outputs": [ - "36d7f891-8a43-4ae4-8472-a34dcb2be643" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "e4024c4a-dbce-4bda-bed8-21414091e7ce" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "aaa08845-5150-4a4f-9c44-5ea22add1fc3" - } - ] - }, - { - "process": "98442f49-9afb-491e-8347-f891f39d8d70", - "inputs": [ - "6228558b-436a-46c9-9cd3-ea9b5c123070" - ], - "input_type": "biomaterial", - "outputs": [ - "7b53bae2-2424-44c0-9d80-ad72e8bca136" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "eebf404f-4fbb-41b0-a9c6-81586f729599" - } - ] - }, - { - "process": "5aa4645b-2802-4140-9b15-d1008338b1c9", - "inputs": [ - "628e8b1d-a1ce-4dee-b15a-3fd33290eafe" - ], - "input_type": "biomaterial", - "outputs": [ - "6228558b-436a-46c9-9cd3-ea9b5c123070" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - }, - "process_0.json": { - "process_core": { - "process_id": "process_id_128" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "98442f49-9afb-491e-8347-f891f39d8d70", - "submission_date": "2018-09-04T12:26:57.064Z", - "update_date": "2018-09-04T12:28:00.426Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_255" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "d691bda4-ed01-48b6-a4ea-65b70f6a3946", - "submission_date": "2018-09-04T12:26:58.574Z", - "update_date": "2018-09-04T12:28:06.541Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "5aa4645b-2802-4140-9b15-d1008338b1c9", - "submission_date": "2018-09-04T12:26:55.041Z", - "update_date": "2018-09-04T12:27:51.508Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "1M Immune Cells", - "project_title": "Census of Immune Cells", - "project_description": "Diverse cells of the immune system maintain and protect tissue function, integrity, and homeostasis upon changes in functional demands and diverse perturbations. Recent advances such as massively parallel single-cell RNA-sequencing and sophisticated computational methods help shed new light on this complexity. This immune cell census aims to profile up to 2M immunocytes, the first tranche of this is currently available. With computational methods optimized to a massive scale, we can readily identify cell types and markers, as well as the process of hematopoietic differentiation. The high quality and comprehensive reference map is provided as an open community resource for understanding human health and disease." - }, - "contributors": [ - { - "contact_name": "Aviv,,Regev", - "email": "aregev@broadinstitute.org", - "phone": "(617) 714-7020", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Bo,,Li", - "email": "libo@broadinstitute.org", - "phone": "(617) 714-8681", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Monika,S,Kowalczyk", - "email": "msk.kowalczyk@gmail.com", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Danielle,,Dionne", - "email": "dionne@broadinstitute.org", - "phone": "(617) 714-8147", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Timothy,,Tickle", - "email": "ttickle@broadinstitute.org", - "phone": "(617) 714-7084", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Jane,,Lee", - "email": "janelee@broadinstitute.org", - "phone": "(617) 714-7448", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Orit,,Rozenblatt-Rosen", - "email": "orit@broadinstitute.org", - "phone": "(617) 714-7789", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Orr,,Ashenberg", - "email": "orr@broadinstitute.org", - "phone": "(617) 714-8681", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Marcin,,Tabaka", - "email": "mtabaka@broadinstitute.org", - "phone": "(617) 714-7470", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Karthik,,Shekhar", - "email": "karthik@broadinstitute.org", - "phone": "(617) 714-8067", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Michal,,Slyper", - "email": "mslyper@broadinstitute.org", - "phone": "(617) 714-7199", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Julia,,Waldman", - "email": "jwaldman@broadinstitute.org", - "institution": "Broad Institute", - "laboratory": "Regev Lab", - "address": "415 Main Street, Cambridge, MA", - "country": "USA" - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Danielle,,Welter", - "email": "dwelter@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-1058-2668", - "corresponding_contributor": false - } - ], - "provenance": { - "document_id": "617eb7c1-a3bc-4dd3-9a2a-50a77c998e22", - "submission_date": "2018-09-04T12:26:40.041Z", - "update_date": "2018-09-04T12:27:09.930Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "MantonBM1_HiSeq_1_S1_L007_I1_001.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "index1", - "lane_index": 7, - "read_length": 8, - "technical_replicate_group": "1_BM1_cells_r1", - "provenance": { - "document_id": "36d7f891-8a43-4ae4-8472-a34dcb2be643", - "submission_date": "2018-09-04T12:26:43.089Z", - "update_date": "2018-09-04T12:27:39.827Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "10x_v2_sequencing_protocol_1", - "protocol_name": "Sequencing bone marrow donor 1-4", - "protocol_description": "Single cell sequencing of cDNAs by 10x" - }, - "instrument_manufacturer_model": { - "text": "Illumina Hiseq X 10", - "ontology": "EFO:0008567" - }, - "local_machine_name": "HXE", - "paired_end": true, - "sequencing_approach": { - "text": "tag based single cell RNA sequencing", - "ontology": "EFO:0008440" - }, - "provenance": { - "document_id": "aaa08845-5150-4a4f-9c44-5ea22add1fc3", - "submission_date": "2018-09-04T12:26:55.003Z", - "update_date": "2018-09-04T12:27:50.911Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1_BM1", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "bone", - "ontology": "UBERON:0001474" - }, - "organ_part": { - "text": "bone marrow", - "ontology": "UBERON:0002371" - }, - "purchased_specimen": { - "manufacturer": "Stem Cell Technologies" - }, - "provenance": { - "document_id": "6228558b-436a-46c9-9cd3-ea9b5c123070", - "submission_date": "2018-09-04T12:26:40.206Z", - "update_date": "2018-09-04T12:27:13.378Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..1a798a5a8 --- /dev/null +++ b/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,659 @@ +{ + "manifest": [ + { + "crc32c": "A78360AF", + "sha1": "e71327f467a43cca405794f5bf59856d78d93243", + "sha256": "f3c7f5fa20f3a57093de7e3d4afebfe0e79e0fc4199787f0527b83cbd548a462", + "s3_etag": "06621a64a5764cd05279e6de5c45940d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 1084, + "uuid": "23e6c6f8-8bc4-4f18-81fd-1803e5628f6e", + "version": "1" + }, + { + "crc32c": "D8097612", + "sha1": "f7eef7c5deab2669f7f19bc8b136564481dce1fa", + "sha256": "13949d71db41b28215ef855e41b63c16b88908eda26a24de405955f678125632", + "s3_etag": "8bf3ce1178c2204273571e1b4840ae25", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "collection_protocol_0.json", + "size": 698, + "uuid": "49c1ee68-51ea-476e-8432-c7419adb366b", + "version": "1" + }, + { + "crc32c": "8A734C29", + "sha1": "94744afce8a76a828338a74cd1e0448b37ed9968", + "sha256": "d0a8f924a7861d9022a2199f106e35a643a0d1d0bb5d56f6d1201cd2890a850d", + "s3_etag": "ee2968d79156fdb69de1a6ef61af7fea", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 759, + "uuid": "35cf0ab5-c983-4da8-bb1c-c6504d74db8e", + "version": "1" + }, + { + "crc32c": "477C14C4", + "sha1": "69e19c2322780bb6c31140214036e7286a66c022", + "sha256": "17a1c4f8a5f28028654a3e279d97695c6f3387a6ce20dd744381a2d8d4beae2b", + "s3_etag": "ee99d4e6d6da4ffdf0b321cdcf9d229d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1129, + "uuid": "b7ef3cae-d65e-474d-ab6c-adbed59ed1ff", + "version": "1" + }, + { + "crc32c": "FCDAF214", + "sha1": "23f4a2abf4456b2f2939645c7a1b65de59f460e6", + "sha256": "ba0c9eaf5361a1b3b8ec71f0050c01951cf756aff725b7bbe8ca5ec08c2e8305", + "s3_etag": "918e63ffedd853d5cb5418c89ec71f3c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "enrichment_protocol_0.json", + "size": 948, + "uuid": "67f56a17-0a66-42c6-aac6-5aebe13aaf89", + "version": "1" + }, + { + "crc32c": "20D5D16C", + "sha1": "5ce58077eed436a134c1a4baf4a838269e74e8bc", + "sha256": "0efe158e06b9d22ba10c72173ba3d175c5d33f3e0b1665a88cb49a1e90bc19f6", + "s3_etag": "fa5cd0c751962d1691218e5a99b02b14", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "enrichment_protocol_1.json", + "size": 1294, + "uuid": "5ee5c81d-0ad3-4351-bac5-f25f800492c9", + "version": "1" + }, + { + "crc32c": "86BE78FD", + "sha1": "380c119013406240db0cd5521be3cefdcb25f860", + "sha256": "85aee1c90518a16173a03cc9b8ada0fbfda272ea302c6365a513cf50fad8f5e6", + "s3_etag": "bf171fb356c5cb9e4400794c1cb47f82", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1471, + "uuid": "5910c207-1093-4ef1-9537-dc614d128d14", + "version": "1" + }, + { + "crc32c": "1CAA5E57", + "sha1": "e3d6064f20fa85351d9446be179ebb15458324e6", + "sha256": "e4529c8501160b286824388a51f50b6e94110d3f9a55998a3b088f918e92ae53", + "s3_etag": "1e11ded031de78c2c7cec5e5fb3b48a7", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 2381, + "uuid": "2aea848d-fbe7-472a-953d-2cd77716b939", + "version": "1" + }, + { + "crc32c": "17049723", + "sha1": "df812b18c751efd55e21318be9411200f3066513", + "sha256": "4e82048876caa5f5def97e23c481e864d53cbd44e9692e4c75fd00ff3d51ecf6", + "s3_etag": "e3033356747551134f923f4ae17bc8f2", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 461, + "uuid": "53e9b35d-0dca-49c8-b08b-e9dd90291107", + "version": "1" + }, + { + "crc32c": "E8C13AED", + "sha1": "0c1fad482baa3f7de2e1e6dc189eca315ac5094e", + "sha256": "2218a054a130618a97023537f926f7642809b9c3b8f933ac8ab824e8d90f5852", + "s3_etag": "f3836ec07acacce1bf68b9471e9f8d53", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 385, + "uuid": "42f32ec2-8e7a-41bc-9a22-0d35e4d7dac3", + "version": "1" + }, + { + "crc32c": "455BBFEC", + "sha1": "99aa6318164b67ffd9834d8e063359d12d05dcc5", + "sha256": "4f4e89bb9d0b2c5939db92ab6eb57d53fe04852a444e2a8543011108bb41dafe", + "s3_etag": "f5132847fc461d27d1c1d7c242b4ad5b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 426, + "uuid": "f6d4ed60-9bba-41fc-a0cb-bcc3286cc00e", + "version": "1" + }, + { + "crc32c": "25B4475B", + "sha1": "4feabdd41e56f1ea1f7b0dd77a572fe0d2a7658a", + "sha256": "068673c5372937bf982f7065ba62d012016a5c6bd20126d0ba6026eb0f6d9cb8", + "s3_etag": "14687d2a59cefa3d8ce35d70cddf4a46", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 5017, + "uuid": "a6ba8ac5-e314-4cae-8afc-a2293e401748", + "version": "1" + }, + { + "crc32c": "E0404A01", + "sha1": "2d85a788acb4a291d5d13fb918dfbb25d4205de9", + "sha256": "895c57e9ca2bccbcd306086fd691c55b8e9303a864f1791d9a924b599a3c5313", + "s3_etag": "2f991645e73f650f6ad740cea4202d04", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 519, + "uuid": "358e8e9e-88c3-46d3-9e85-6ec3e714dd30", + "version": "1" + }, + { + "crc32c": "E0404A01", + "sha1": "2d85a788acb4a291d5d13fb918dfbb25d4205de9", + "sha256": "895c57e9ca2bccbcd306086fd691c55b8e9303a864f1791d9a924b599a3c5313", + "s3_etag": "2f991645e73f650f6ad740cea4202d04", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SRR6257787.fastq.gz", + "size": 519, + "uuid": "6ac13e04-d123-42de-bed9-f874b0d2fed2", + "version": "1" + }, + { + "crc32c": "EDCA012A", + "sha1": "7af61784e4161bcf1ab7a5de9e36a8b1fdad8f24", + "sha256": "d6eef7948662074a17a9d6cd18f68f52f124f484707e8701d9d66efd1eb9fc62", + "s3_etag": "f110de13025c205035da128277811b0b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 972, + "uuid": "d9744965-5fbc-4da2-8e6b-f1c991948a3c", + "version": "1" + }, + { + "crc32c": "ECC85615", + "sha1": "c0630167c6cf904df7c4c1d6bbe073e0f2a03bce", + "sha256": "fe538370762296480db4c7ee3c440bbaa707c72aa4968e493b9c9b4ee427dc01", + "s3_etag": "a24f4b29940b6dd27f7b8cf724b2f078", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 1102, + "uuid": "564ed776-1edb-4b3e-b697-6af9174ed98a", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", + "biomaterial_name": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", + "biomaterial_description": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", + "ncbi_taxon_id": [ + 9606 + ], + "insdc_biomaterial": "SRS2661967" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "selected_cell_type": [ + { + "text": "TEMRA", + "ontology": "CL:0000625" + } + ], + "total_estimated_cells": 1, + "plate_based_sequencing": { + "plate_id": "subject9-10_batch1", + "cell_quality": "OK" + }, + "provenance": { + "document_id": "cc0d9bf0-6ad5-4489-994b-db26ff761c5a", + "submission_date": "2018-09-05T09:47:21.355Z", + "update_date": "2018-09-05T09:53:09.415Z" + } + }, + "collection_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.6/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "collection_protocol_2", + "protocol_name": "Blood sample collection", + "protocol_description": "Blood sample collection", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "collection_method": { + "text": "blood draw", + "ontology": "EFO:0009121" + }, + "provenance": { + "document_id": "f8d9778f-0f72-4432-a929-1096fd9ca2f4", + "submission_date": "2018-09-05T09:48:40.196Z", + "update_date": "2018-09-05T09:52:05.472Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "Dissociation by FACS into single cells", + "protocol_description": "Dissociation by FACS into single cells", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "dissociation_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "provenance": { + "document_id": "a934e15c-e1ce-423b-b554-9203d4e93f41", + "submission_date": "2018-09-05T09:48:40.205Z", + "update_date": "2018-09-05T09:51:59.418Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Subject10", + "biomaterial_name": "Subject10", + "biomaterial_description": "Subject10", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "is_living": "yes", + "sex": "unknown", + "medical_history": { + "test_results": "dengue virus negative" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272" + }, + "organism_age": "18-60", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "provenance": { + "document_id": "25e083e3-d747-4295-86c8-c7ddc4b975be", + "submission_date": "2018-09-05T09:47:20.947Z", + "update_date": "2018-09-05T09:50:15.914Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_1", + "protocol_name": "PBMC Enrichment", + "protocol_description": "CD4 memory cell types were isolated from PBMCs and directly sorted by Flow cytometry into a 96-well plate wells with lysis buffer with RNAase inhibitor (Takara) - Described in Picelli et al. Nat Protoc. 2014, PMID:24385147. No particular cell growth procedure was required.", + "publication_doi": "10.1073/pnas.1305227110" + }, + "enrichment_method": { + "text": "Ficoll-Hypaque method", + "ontology": "EFO:0009110" + }, + "provenance": { + "document_id": "80921b90-fe8d-45e1-a5e5-4fdb55f9a3fa", + "submission_date": "2018-09-05T09:48:40.213Z", + "update_date": "2018-09-05T09:52:05.683Z" + } + }, + "enrichment_protocol_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_2", + "protocol_name": "TEMRA Enrichment", + "protocol_description": "For single-cell RNA-seq experiments, live and singlet gated cells were further gated to sort 1) TCM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7+, 2) TEM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7-, 3) TEMRA; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-, 4) IL-7Rhigh TEMRA (CD4-CTL precursors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-CD127high, 5) IL-7R- TEMRA (CD4-CTL effectors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7- CD127-. Single cells were directly sorted into 96 well plate with lysis buffer for downstream processing using Smart-seq2 method", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "markers": "CD3+CD4+CD8alpha/CD14/CD19-CD45RA+CCR7-", + "provenance": { + "document_id": "77c71448-fb32-472f-9d44-ea9a42867a41", + "submission_date": "2018-09-05T09:48:40.222Z", + "update_date": "2018-09-05T09:51:58.823Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", + "protocol_description": "Single cell RNAseq was performed as described in Picelli et al.Nat Protoc. 2014, PMID:24385147. We performed 23 cycles of amplification. Barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) were prepared as following manufacturers protocol.", + "publication_doi": "10.1038/nprot.2014.006" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "nucleic_acid_source": "single cell", + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_kit": { + "retail_name": "Nextera XT library preparation kit", + "manufacturer": "Illumina" + }, + "library_preamplification_method": { + "text": "PCR", + "ontology": "OBI:0000415" + }, + "provenance": { + "document_id": "0ea30fa0-7183-4ffc-a4b8-537c6de32e65", + "submission_date": "2018-09-05T09:48:40.286Z", + "update_date": "2018-09-05T09:52:00.867Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "bcfcb3d7-674a-429f-8bf9-347a0f222db2", + "inputs": [ + "cc0d9bf0-6ad5-4489-994b-db26ff761c5a" + ], + "input_type": "biomaterial", + "outputs": [ + "a5806f2e-3f85-486a-9015-e02e5c805285" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "0ea30fa0-7183-4ffc-a4b8-537c6de32e65" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "2d0f835b-ced1-4cf1-a053-0cf109fdefeb" + } + ] + }, + { + "process": "f8e3c0b7-ed2a-464d-bff4-b80fac2a3849", + "inputs": [ + "ff63b5d7-e702-40da-bbe9-619e52131b63" + ], + "input_type": "biomaterial", + "outputs": [ + "cc0d9bf0-6ad5-4489-994b-db26ff761c5a" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "a934e15c-e1ce-423b-b554-9203d4e93f41" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "77c71448-fb32-472f-9d44-ea9a42867a41" + } + ] + }, + { + "process": "4e504efb-a65b-4fe5-97f5-8148f6a8ed4d", + "inputs": [ + "25e083e3-d747-4295-86c8-c7ddc4b975be" + ], + "input_type": "biomaterial", + "outputs": [ + "ff63b5d7-e702-40da-bbe9-619e52131b63" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "f8d9778f-0f72-4432-a929-1096fd9ca2f4" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "80921b90-fe8d-45e1-a5e5-4fdb55f9a3fa" + } + ] + } + ] + }, + "process_0.json": { + "insdc_experiment": { + "insdc_experiment": "SRX3364233" + }, + "process_core": { + "process_id": "process_id_2273" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "bcfcb3d7-674a-429f-8bf9-347a0f222db2", + "submission_date": "2018-09-05T09:49:29.182Z", + "update_date": "2018-09-05T09:56:34.501Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_29" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "f8e3c0b7-ed2a-464d-bff4-b80fac2a3849", + "submission_date": "2018-09-05T09:48:40.598Z", + "update_date": "2018-09-05T09:55:08.938Z" + } + }, + "process_2.json": { + "process_core": { + "process_location": "Sri Lanka", + "process_id": "process_id_16" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "4e504efb-a65b-4fe5-97f5-8148f6a8ed4d", + "submission_date": "2018-09-05T09:48:40.463Z", + "update_date": "2018-09-05T09:55:08.214Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "CD4+ cytotoxic T lymphocytes", + "project_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis", + "project_description": "CD4+ cytotoxic T lymphocytes (CD4-CTLs) have been reported to play a protective role in several viral infections. However, little is known in humans about the biology of CD4-CTL generation, their functional properties, heterogeneity and clonal diversity, especially in relation to other well-described CD4+ memory T cell subsets. We performed single-cell RNA-seq in over 9000 cells to unravel CD4-CTL heterogeneity, transcriptional profile and clonality in humans. The single-cell differential gene expression analysis, revealed a spectrum of known transcripts, including several linked to cytotoxic and co-stimulatory function, and transcripts of unknown cytotoxicity-related function that are expressed at higher levels in the TEMRA subset, which is highly enriched for CD4-CTLs, compared to cells in the central and effector memory subsets (TCM, TEM). Simultaneous T cells antigen receptor (TCR) analysis in single-cells and bulk subsets revealed that CD4-TEMRA cells show marked clonal expansion compared to TCM and TEM cells and that the majority of CD4-TEMRA were dengue virus (DENV)-specific in subjects with previous DENV infection. The profile of CD4-TEMRA was highly heterogeneous across subjects, with four distinct clusters identified by the single-cell analysis. Most importantly, we identified distinct clusters of CD4-CTL effector and precursor cells in the TEMRA subset; the precursor cells shared TCR clonotypes with CD4-CTL effectors and were distinguished by high expression of the interleukin-7 receptor. Our identification of a CD4-CTL precursor population may allow further investigation of how CD4-CTLs arise in humans and thus could provide insights into the mechanisms that may be utilized to generate durable and effective CD4-CTL immunity." + }, + "insdc_project": "SRP124157", + "geo_series": "GSE106540", + "insdc_study": "PRJNA417191", + "supplementary_links": [ + "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-106540/Results" + ], + "contributors": [ + { + "contact_name": "Pandurangan,,Vijayanand", + "email": "vijay@lji.org", + "institution": "La Jolla Institute for Allergy and Immunology", + "laboratory": "Division of Vaccine Discovery", + "address": "La Jolla, CA 92037", + "country": "USA", + "corresponding_contributor": true + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Laura,,Huerta", + "email": "lauhuema@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Molecular Atlas", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8748-599X", + "corresponding_contributor": false + } + ], + "funders": [ + { + "grant_id": "U19AI118626", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "U19AI118610", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "R01HL114093", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "R24AI108564", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "funder_name": "William K. Bowes Jr. Foundation" + } + ], + "publications": [ + { + "authors": [ + "Patil VS, Madrigal A, Schmiedel BJ, Clarke J, O'Rourke P, Harris E, de Silva AD, Harris E, Peters B, Seumois G, Weiskopf D, Sette A, Vijayanand P" + ], + "publication_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis.", + "doi": "10.1126/sciimmunol.aan8664", + "pmid": 29352091, + "publication_url": "http://immunology.sciencemag.org/content/3/19/eaan8664.long" + } + ], + "provenance": { + "document_id": "ee5b3a17-4128-40ff-88f4-44903ef1ab54", + "submission_date": "2018-09-05T09:47:20.825Z", + "update_date": "2018-09-05T09:50:15.608Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR6257787.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "read_length": 50, + "insdc_run": [ + "SRR6257787" + ], + "provenance": { + "document_id": "a5806f2e-3f85-486a-9015-e02e5c805285", + "submission_date": "2018-09-05T09:48:00.065Z", + "update_date": "2018-09-05T09:54:36.578Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "SmartSeq 2 single cell sequencing", + "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2500 platform to obtain 50-bp single end reads (barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina))." + }, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565" + }, + "paired_end": false, + "provenance": { + "document_id": "2d0f835b-ced1-4cf1-a053-0cf109fdefeb", + "submission_date": "2018-09-05T09:48:40.296Z", + "update_date": "2018-09-05T09:51:58.194Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Subject10_DENV negative_PBMC_TEMRA", + "biomaterial_name": "Subject10_DENV negative_PBMC_TEMRA", + "biomaterial_description": "Subject10_DENV negative_PBMC_TEMRA", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "blood", + "ontology": "UBERON:0000178" + }, + "organ_part": { + "text": "peripheral blood mononuclear cell", + "ontology": "CL:2000001" + }, + "preservation_storage": { + "preservation_method": "cryopreservation, other", + "storage_method": "frozen, liquid nitrogen" + }, + "provenance": { + "document_id": "ff63b5d7-e702-40da-bbe9-619e52131b63", + "submission_date": "2018-09-05T09:47:21.215Z", + "update_date": "2018-09-05T09:50:44.523Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index c4871bb0e..000000000 --- a/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,194 +0,0 @@ -[ - { - "crc32c": "A78360AF", - "sha1": "e71327f467a43cca405794f5bf59856d78d93243", - "sha256": "f3c7f5fa20f3a57093de7e3d4afebfe0e79e0fc4199787f0527b83cbd548a462", - "s3_etag": "06621a64a5764cd05279e6de5c45940d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 1084, - "uuid": "23e6c6f8-8bc4-4f18-81fd-1803e5628f6e", - "version": "1" - }, - { - "crc32c": "D8097612", - "sha1": "f7eef7c5deab2669f7f19bc8b136564481dce1fa", - "sha256": "13949d71db41b28215ef855e41b63c16b88908eda26a24de405955f678125632", - "s3_etag": "8bf3ce1178c2204273571e1b4840ae25", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "collection_protocol_0.json", - "size": 698, - "uuid": "49c1ee68-51ea-476e-8432-c7419adb366b", - "version": "1" - }, - { - "crc32c": "8A734C29", - "sha1": "94744afce8a76a828338a74cd1e0448b37ed9968", - "sha256": "d0a8f924a7861d9022a2199f106e35a643a0d1d0bb5d56f6d1201cd2890a850d", - "s3_etag": "ee2968d79156fdb69de1a6ef61af7fea", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 759, - "uuid": "35cf0ab5-c983-4da8-bb1c-c6504d74db8e", - "version": "1" - }, - { - "crc32c": "477C14C4", - "sha1": "69e19c2322780bb6c31140214036e7286a66c022", - "sha256": "17a1c4f8a5f28028654a3e279d97695c6f3387a6ce20dd744381a2d8d4beae2b", - "s3_etag": "ee99d4e6d6da4ffdf0b321cdcf9d229d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1129, - "uuid": "b7ef3cae-d65e-474d-ab6c-adbed59ed1ff", - "version": "1" - }, - { - "crc32c": "FCDAF214", - "sha1": "23f4a2abf4456b2f2939645c7a1b65de59f460e6", - "sha256": "ba0c9eaf5361a1b3b8ec71f0050c01951cf756aff725b7bbe8ca5ec08c2e8305", - "s3_etag": "918e63ffedd853d5cb5418c89ec71f3c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "enrichment_protocol_0.json", - "size": 948, - "uuid": "67f56a17-0a66-42c6-aac6-5aebe13aaf89", - "version": "1" - }, - { - "crc32c": "20D5D16C", - "sha1": "5ce58077eed436a134c1a4baf4a838269e74e8bc", - "sha256": "0efe158e06b9d22ba10c72173ba3d175c5d33f3e0b1665a88cb49a1e90bc19f6", - "s3_etag": "fa5cd0c751962d1691218e5a99b02b14", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "enrichment_protocol_1.json", - "size": 1294, - "uuid": "5ee5c81d-0ad3-4351-bac5-f25f800492c9", - "version": "1" - }, - { - "crc32c": "86BE78FD", - "sha1": "380c119013406240db0cd5521be3cefdcb25f860", - "sha256": "85aee1c90518a16173a03cc9b8ada0fbfda272ea302c6365a513cf50fad8f5e6", - "s3_etag": "bf171fb356c5cb9e4400794c1cb47f82", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1471, - "uuid": "5910c207-1093-4ef1-9537-dc614d128d14", - "version": "1" - }, - { - "crc32c": "1CAA5E57", - "sha1": "e3d6064f20fa85351d9446be179ebb15458324e6", - "sha256": "e4529c8501160b286824388a51f50b6e94110d3f9a55998a3b088f918e92ae53", - "s3_etag": "1e11ded031de78c2c7cec5e5fb3b48a7", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 2381, - "uuid": "2aea848d-fbe7-472a-953d-2cd77716b939", - "version": "1" - }, - { - "crc32c": "17049723", - "sha1": "df812b18c751efd55e21318be9411200f3066513", - "sha256": "4e82048876caa5f5def97e23c481e864d53cbd44e9692e4c75fd00ff3d51ecf6", - "s3_etag": "e3033356747551134f923f4ae17bc8f2", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 461, - "uuid": "53e9b35d-0dca-49c8-b08b-e9dd90291107", - "version": "1" - }, - { - "crc32c": "E8C13AED", - "sha1": "0c1fad482baa3f7de2e1e6dc189eca315ac5094e", - "sha256": "2218a054a130618a97023537f926f7642809b9c3b8f933ac8ab824e8d90f5852", - "s3_etag": "f3836ec07acacce1bf68b9471e9f8d53", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 385, - "uuid": "42f32ec2-8e7a-41bc-9a22-0d35e4d7dac3", - "version": "1" - }, - { - "crc32c": "455BBFEC", - "sha1": "99aa6318164b67ffd9834d8e063359d12d05dcc5", - "sha256": "4f4e89bb9d0b2c5939db92ab6eb57d53fe04852a444e2a8543011108bb41dafe", - "s3_etag": "f5132847fc461d27d1c1d7c242b4ad5b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 426, - "uuid": "f6d4ed60-9bba-41fc-a0cb-bcc3286cc00e", - "version": "1" - }, - { - "crc32c": "25B4475B", - "sha1": "4feabdd41e56f1ea1f7b0dd77a572fe0d2a7658a", - "sha256": "068673c5372937bf982f7065ba62d012016a5c6bd20126d0ba6026eb0f6d9cb8", - "s3_etag": "14687d2a59cefa3d8ce35d70cddf4a46", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 5017, - "uuid": "a6ba8ac5-e314-4cae-8afc-a2293e401748", - "version": "1" - }, - { - "crc32c": "E0404A01", - "sha1": "2d85a788acb4a291d5d13fb918dfbb25d4205de9", - "sha256": "895c57e9ca2bccbcd306086fd691c55b8e9303a864f1791d9a924b599a3c5313", - "s3_etag": "2f991645e73f650f6ad740cea4202d04", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 519, - "uuid": "358e8e9e-88c3-46d3-9e85-6ec3e714dd30", - "version": "1" - }, - { - "crc32c": "E0404A01", - "sha1": "2d85a788acb4a291d5d13fb918dfbb25d4205de9", - "sha256": "895c57e9ca2bccbcd306086fd691c55b8e9303a864f1791d9a924b599a3c5313", - "s3_etag": "2f991645e73f650f6ad740cea4202d04", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SRR6257787.fastq.gz", - "size": 519, - "uuid": "6ac13e04-d123-42de-bed9-f874b0d2fed2", - "version": "1" - }, - { - "crc32c": "EDCA012A", - "sha1": "7af61784e4161bcf1ab7a5de9e36a8b1fdad8f24", - "sha256": "d6eef7948662074a17a9d6cd18f68f52f124f484707e8701d9d66efd1eb9fc62", - "s3_etag": "f110de13025c205035da128277811b0b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 972, - "uuid": "d9744965-5fbc-4da2-8e6b-f1c991948a3c", - "version": "1" - }, - { - "crc32c": "ECC85615", - "sha1": "c0630167c6cf904df7c4c1d6bbe073e0f2a03bce", - "sha256": "fe538370762296480db4c7ee3c440bbaa707c72aa4968e493b9c9b4ee427dc01", - "s3_etag": "a24f4b29940b6dd27f7b8cf724b2f078", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 1102, - "uuid": "564ed776-1edb-4b3e-b697-6af9174ed98a", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index a534b298f..000000000 --- a/test/hca_metadata_api/cans/examples/CD4+ cytotoxic T lymphocytes/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,463 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", - "biomaterial_name": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", - "biomaterial_description": "Single-cell_RNA-seq_Subject10_TEMRA_Cell001", - "ncbi_taxon_id": [ - 9606 - ], - "insdc_biomaterial": "SRS2661967" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "selected_cell_type": [ - { - "text": "TEMRA", - "ontology": "CL:0000625" - } - ], - "total_estimated_cells": 1, - "plate_based_sequencing": { - "plate_id": "subject9-10_batch1", - "cell_quality": "OK" - }, - "provenance": { - "document_id": "cc0d9bf0-6ad5-4489-994b-db26ff761c5a", - "submission_date": "2018-09-05T09:47:21.355Z", - "update_date": "2018-09-05T09:53:09.415Z" - } - }, - "collection_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.6/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "collection_protocol_2", - "protocol_name": "Blood sample collection", - "protocol_description": "Blood sample collection", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "collection_method": { - "text": "blood draw", - "ontology": "EFO:0009121" - }, - "provenance": { - "document_id": "f8d9778f-0f72-4432-a929-1096fd9ca2f4", - "submission_date": "2018-09-05T09:48:40.196Z", - "update_date": "2018-09-05T09:52:05.472Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "Dissociation by FACS into single cells", - "protocol_description": "Dissociation by FACS into single cells", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "dissociation_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "provenance": { - "document_id": "a934e15c-e1ce-423b-b554-9203d4e93f41", - "submission_date": "2018-09-05T09:48:40.205Z", - "update_date": "2018-09-05T09:51:59.418Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Subject10", - "biomaterial_name": "Subject10", - "biomaterial_description": "Subject10", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "is_living": "yes", - "sex": "unknown", - "medical_history": { - "test_results": "dengue virus negative" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272" - }, - "organism_age": "18-60", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "provenance": { - "document_id": "25e083e3-d747-4295-86c8-c7ddc4b975be", - "submission_date": "2018-09-05T09:47:20.947Z", - "update_date": "2018-09-05T09:50:15.914Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_1", - "protocol_name": "PBMC Enrichment", - "protocol_description": "CD4 memory cell types were isolated from PBMCs and directly sorted by Flow cytometry into a 96-well plate wells with lysis buffer with RNAase inhibitor (Takara) - Described in Picelli et al. Nat Protoc. 2014, PMID:24385147. No particular cell growth procedure was required.", - "publication_doi": "10.1073/pnas.1305227110" - }, - "enrichment_method": { - "text": "Ficoll-Hypaque method", - "ontology": "EFO:0009110" - }, - "provenance": { - "document_id": "80921b90-fe8d-45e1-a5e5-4fdb55f9a3fa", - "submission_date": "2018-09-05T09:48:40.213Z", - "update_date": "2018-09-05T09:52:05.683Z" - } - }, - "enrichment_protocol_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_2", - "protocol_name": "TEMRA Enrichment", - "protocol_description": "For single-cell RNA-seq experiments, live and singlet gated cells were further gated to sort 1) TCM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7+, 2) TEM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7-, 3) TEMRA; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-, 4) IL-7Rhigh TEMRA (CD4-CTL precursors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-CD127high, 5) IL-7R- TEMRA (CD4-CTL effectors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7- CD127-. Single cells were directly sorted into 96 well plate with lysis buffer for downstream processing using Smart-seq2 method", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "markers": "CD3+CD4+CD8alpha/CD14/CD19-CD45RA+CCR7-", - "provenance": { - "document_id": "77c71448-fb32-472f-9d44-ea9a42867a41", - "submission_date": "2018-09-05T09:48:40.222Z", - "update_date": "2018-09-05T09:51:58.823Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", - "protocol_description": "Single cell RNAseq was performed as described in Picelli et al.Nat Protoc. 2014, PMID:24385147. We performed 23 cycles of amplification. Barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) were prepared as following manufacturers protocol.", - "publication_doi": "10.1038/nprot.2014.006" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "nucleic_acid_source": "single cell", - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_kit": { - "retail_name": "Nextera XT library preparation kit", - "manufacturer": "Illumina" - }, - "library_preamplification_method": { - "text": "PCR", - "ontology": "OBI:0000415" - }, - "provenance": { - "document_id": "0ea30fa0-7183-4ffc-a4b8-537c6de32e65", - "submission_date": "2018-09-05T09:48:40.286Z", - "update_date": "2018-09-05T09:52:00.867Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "bcfcb3d7-674a-429f-8bf9-347a0f222db2", - "inputs": [ - "cc0d9bf0-6ad5-4489-994b-db26ff761c5a" - ], - "input_type": "biomaterial", - "outputs": [ - "a5806f2e-3f85-486a-9015-e02e5c805285" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "0ea30fa0-7183-4ffc-a4b8-537c6de32e65" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "2d0f835b-ced1-4cf1-a053-0cf109fdefeb" - } - ] - }, - { - "process": "f8e3c0b7-ed2a-464d-bff4-b80fac2a3849", - "inputs": [ - "ff63b5d7-e702-40da-bbe9-619e52131b63" - ], - "input_type": "biomaterial", - "outputs": [ - "cc0d9bf0-6ad5-4489-994b-db26ff761c5a" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "a934e15c-e1ce-423b-b554-9203d4e93f41" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "77c71448-fb32-472f-9d44-ea9a42867a41" - } - ] - }, - { - "process": "4e504efb-a65b-4fe5-97f5-8148f6a8ed4d", - "inputs": [ - "25e083e3-d747-4295-86c8-c7ddc4b975be" - ], - "input_type": "biomaterial", - "outputs": [ - "ff63b5d7-e702-40da-bbe9-619e52131b63" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "f8d9778f-0f72-4432-a929-1096fd9ca2f4" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "80921b90-fe8d-45e1-a5e5-4fdb55f9a3fa" - } - ] - } - ] - }, - "process_0.json": { - "insdc_experiment": { - "insdc_experiment": "SRX3364233" - }, - "process_core": { - "process_id": "process_id_2273" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "bcfcb3d7-674a-429f-8bf9-347a0f222db2", - "submission_date": "2018-09-05T09:49:29.182Z", - "update_date": "2018-09-05T09:56:34.501Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_29" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "f8e3c0b7-ed2a-464d-bff4-b80fac2a3849", - "submission_date": "2018-09-05T09:48:40.598Z", - "update_date": "2018-09-05T09:55:08.938Z" - } - }, - "process_2.json": { - "process_core": { - "process_location": "Sri Lanka", - "process_id": "process_id_16" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "4e504efb-a65b-4fe5-97f5-8148f6a8ed4d", - "submission_date": "2018-09-05T09:48:40.463Z", - "update_date": "2018-09-05T09:55:08.214Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "CD4+ cytotoxic T lymphocytes", - "project_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis", - "project_description": "CD4+ cytotoxic T lymphocytes (CD4-CTLs) have been reported to play a protective role in several viral infections. However, little is known in humans about the biology of CD4-CTL generation, their functional properties, heterogeneity and clonal diversity, especially in relation to other well-described CD4+ memory T cell subsets. We performed single-cell RNA-seq in over 9000 cells to unravel CD4-CTL heterogeneity, transcriptional profile and clonality in humans. The single-cell differential gene expression analysis, revealed a spectrum of known transcripts, including several linked to cytotoxic and co-stimulatory function, and transcripts of unknown cytotoxicity-related function that are expressed at higher levels in the TEMRA subset, which is highly enriched for CD4-CTLs, compared to cells in the central and effector memory subsets (TCM, TEM). Simultaneous T cells antigen receptor (TCR) analysis in single-cells and bulk subsets revealed that CD4-TEMRA cells show marked clonal expansion compared to TCM and TEM cells and that the majority of CD4-TEMRA were dengue virus (DENV)-specific in subjects with previous DENV infection. The profile of CD4-TEMRA was highly heterogeneous across subjects, with four distinct clusters identified by the single-cell analysis. Most importantly, we identified distinct clusters of CD4-CTL effector and precursor cells in the TEMRA subset; the precursor cells shared TCR clonotypes with CD4-CTL effectors and were distinguished by high expression of the interleukin-7 receptor. Our identification of a CD4-CTL precursor population may allow further investigation of how CD4-CTLs arise in humans and thus could provide insights into the mechanisms that may be utilized to generate durable and effective CD4-CTL immunity." - }, - "insdc_project": "SRP124157", - "geo_series": "GSE106540", - "insdc_study": "PRJNA417191", - "supplementary_links": [ - "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-106540/Results" - ], - "contributors": [ - { - "contact_name": "Pandurangan,,Vijayanand", - "email": "vijay@lji.org", - "institution": "La Jolla Institute for Allergy and Immunology", - "laboratory": "Division of Vaccine Discovery", - "address": "La Jolla, CA 92037", - "country": "USA", - "corresponding_contributor": true - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Laura,,Huerta", - "email": "lauhuema@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Molecular Atlas", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8748-599X", - "corresponding_contributor": false - } - ], - "funders": [ - { - "grant_id": "U19AI118626", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "U19AI118610", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "R01HL114093", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "R24AI108564", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "funder_name": "William K. Bowes Jr. Foundation" - } - ], - "publications": [ - { - "authors": [ - "Patil VS, Madrigal A, Schmiedel BJ, Clarke J, O'Rourke P, Harris E, de Silva AD, Harris E, Peters B, Seumois G, Weiskopf D, Sette A, Vijayanand P" - ], - "publication_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis.", - "doi": "10.1126/sciimmunol.aan8664", - "pmid": 29352091, - "publication_url": "http://immunology.sciencemag.org/content/3/19/eaan8664.long" - } - ], - "provenance": { - "document_id": "ee5b3a17-4128-40ff-88f4-44903ef1ab54", - "submission_date": "2018-09-05T09:47:20.825Z", - "update_date": "2018-09-05T09:50:15.608Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR6257787.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "read_length": 50, - "insdc_run": [ - "SRR6257787" - ], - "provenance": { - "document_id": "a5806f2e-3f85-486a-9015-e02e5c805285", - "submission_date": "2018-09-05T09:48:00.065Z", - "update_date": "2018-09-05T09:54:36.578Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "SmartSeq 2 single cell sequencing", - "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2500 platform to obtain 50-bp single end reads (barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina))." - }, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565" - }, - "paired_end": false, - "provenance": { - "document_id": "2d0f835b-ced1-4cf1-a053-0cf109fdefeb", - "submission_date": "2018-09-05T09:48:40.296Z", - "update_date": "2018-09-05T09:51:58.194Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Subject10_DENV negative_PBMC_TEMRA", - "biomaterial_name": "Subject10_DENV negative_PBMC_TEMRA", - "biomaterial_description": "Subject10_DENV negative_PBMC_TEMRA", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "blood", - "ontology": "UBERON:0000178" - }, - "organ_part": { - "text": "peripheral blood mononuclear cell", - "ontology": "CL:2000001" - }, - "preservation_storage": { - "preservation_method": "cryopreservation, other", - "storage_method": "frozen, liquid nitrogen" - }, - "provenance": { - "document_id": "ff63b5d7-e702-40da-bbe9-619e52131b63", - "submission_date": "2018-09-05T09:47:21.215Z", - "update_date": "2018-09-05T09:50:44.523Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..eb9525ed0 --- /dev/null +++ b/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,1982 @@ +{ + "manifest": [ + { + "crc32c": "5FB5C074", + "sha1": "0a0b7ed1c1a82e2349bf7c7f2c55169f687d05c3", + "sha256": "99fb280727cdff1f5ae1e5a5f27f261fe0ac4033b34dd5ff505dbdcb2d3e759b", + "s3_etag": "11c4139932510cbd72a250c08c6cb82c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_line_0.json", + "size": 1550, + "uuid": "cdfc49a1-a600-4033-bbce-64e5ee3a67aa", + "version": "1" + }, + { + "crc32c": "F33FDC5E", + "sha1": "27a55a4dcab02acd4add013730794c4cb5158f6a", + "sha256": "a78f437a98dd2bc97c50f85f11a74756e2efdaa1b46c24c034101d1fc292ad5d", + "s3_etag": "908e7a5a3c3618dd38dcc173958d8a3f", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_line_1.json", + "size": 1550, + "uuid": "e9e1a31a-d4a0-458d-97ae-956ec8779f15", + "version": "1" + }, + { + "crc32c": "762C33CA", + "sha1": "1229f946b792a2927e6773b1269075b6562ee81e", + "sha256": "bd1ee60863c05c86cb0c8959f0aaf2dbb99b053905d53a9a9e5ba2de7864b738", + "s3_etag": "526862c44aa198cfd979ecb17dcc38f3", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_line_2.json", + "size": 1550, + "uuid": "ce6bfc46-a7fe-4727-8469-8e6c4d26509a", + "version": "1" + }, + { + "crc32c": "13AA5D45", + "sha1": "4c91f609fdcfe2850ce2d6573e8820c86801980f", + "sha256": "95915233425da95c2d73c9ec6eabbf82408b1e9b1b1bea9340733fd2c3a078c1", + "s3_etag": "d799a453314d517cd17c16c956ba4b8e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_line_3.json", + "size": 1550, + "uuid": "c56293b4-baeb-4551-890e-3e32c62798d1", + "version": "1" + }, + { + "crc32c": "DDAF2641", + "sha1": "19142e0002a43b494b83a1dd76d7adb92b8ffc28", + "sha256": "1edb9a2932e909e892baf0519cff201118ad508aad507bac54564f49a9561ab6", + "s3_etag": "7473ef8331da4a49a63c07b2e5c840d8", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 949, + "uuid": "618f335a-3852-4901-83d9-82daa4177dbc", + "version": "1" + }, + { + "crc32c": "A397FBC5", + "sha1": "5be27ec15298c67153ee558594c85de413b1e06f", + "sha256": "97dbea2a50149e9220eb3f42445307dd0a3d0ac3ddb79ecdea7f63807a29ca12", + "s3_etag": "f4105454d86a649e5ed2faacdf40267b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "differentiation_protocol_0.json", + "size": 892, + "uuid": "cbabc165-8efa-4ad8-b8e4-b626d303abec", + "version": "1" + }, + { + "crc32c": "26CC9E56", + "sha1": "82c10b7f7e7fde821b843a851bd87dcfd7346b64", + "sha256": "3a9b2afeb6d68786b9e2962fd7a61c2af3e8271fa23777185a2915586eea869d", + "s3_etag": "a6fe3d1a7286703909172eb12663a8a0", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 894, + "uuid": "844dc5d2-f028-4f1a-bad9-c93e1cecd3bc", + "version": "1" + }, + { + "crc32c": "1EC942F7", + "sha1": "91165a3ca2ff2f90b064078354a9dfe934279d8a", + "sha256": "44ef118e6332ec0ab6f805ba5af9d929fe019fec5bfd8a24969dbbfd687538ee", + "s3_etag": "dd544abfc3b3747e131367aba87f6029", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1249, + "uuid": "9338e6ae-0739-4ab0-9f57-d2be865e5dff", + "version": "1" + }, + { + "crc32c": "634E048E", + "sha1": "b4c171efbba79e1273140484962ce580b071c964", + "sha256": "6a74ac1688744b305c0f6cc7b76611cc5749e2ec22b4a929d52200253d9b91ef", + "s3_etag": "f72ecca4363919754848fbf5b31a558c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_1.json", + "size": 1241, + "uuid": "950aaa5d-7fb2-4d3b-9576-cd7b038b8bb6", + "version": "1" + }, + { + "crc32c": "F2A1DA41", + "sha1": "1d94489bc26b7bc9d7bef5bea5c564bc96301d02", + "sha256": "9ae2ae48eaf9e6475dac6fdf0328390aadb178446221dff72b3d77a7a36f2597", + "s3_etag": "5b3aaf115f2fca94fb1731d2a9b5fe1c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_2.json", + "size": 1239, + "uuid": "7459dbd0-618a-4b71-93b9-a65f0eeba281", + "version": "1" + }, + { + "crc32c": "B1ABDBAD", + "sha1": "a339b614e9da58d2b294ab9406834fbcd6b3a819", + "sha256": "32deb4381f53c73e2e1c28d6a2a0af552aa7373201ff67b8a3a54c5cab6d6694", + "s3_etag": "e604c108482e9223bd23ebe794f602dc", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_3.json", + "size": 1241, + "uuid": "e91c797e-56ec-4877-bea3-dd0cd999dbfc", + "version": "1" + }, + { + "crc32c": "C33C083F", + "sha1": "cfff160e96b7276b9feaa69ccfd715d9277c9bc5", + "sha256": "a9ef1c267f90af8db06a282c451c9bf9369752da93ecf33c16ea9d5429051151", + "s3_etag": "92a0bc6c22b1e683f973713071d83893", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "ipsc_induction_protocol_0.json", + "size": 1315, + "uuid": "89710eb4-8a04-46d3-adf3-7d18880b9c6e", + "version": "1" + }, + { + "crc32c": "5E158C8F", + "sha1": "abb5f21951e368e15622637638aaace6c8137895", + "sha256": "a7532291beae09ab1c319b975202e4854f8a7c1ffbf8232e9d9abb02b7c3b42b", + "s3_etag": "d229e0b768a4dc143ddb258fdbd4405f", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1423, + "uuid": "597f5fae-db6a-4ebc-b2f0-b9c527f5b3ed", + "version": "1" + }, + { + "crc32c": "E8D34C5D", + "sha1": "e3336e075787d319a239533d8620a4a60a793bac", + "sha256": "062e56b2f314b8fd81b916985767abaedc4e22923e80607b023a3bf68554d4e0", + "s3_etag": "3ae64d0365c9c2d857c4194f41b471a6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 7860, + "uuid": "19f9d2c2-2d30-4262-8d19-a5de9ca13dd7", + "version": "1" + }, + { + "crc32c": "27917E6E", + "sha1": "6be5be8c979bf95b9be25df1f16c9856bb55bff3", + "sha256": "cb67b750844e71cfd0939023c91fb732e08a9307e48f86c0883b35b13f2c8b97", + "s3_etag": "3f08625623379bced02503c3d1a6803d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "organoid_0.json", + "size": 1063, + "uuid": "0ce77825-d03a-465b-83d1-d91eb1acadd9", + "version": "1" + }, + { + "crc32c": "2D7F18D4", + "sha1": "a12847e2c70066f16d1feb05ba875f360a74bdb6", + "sha256": "fa68b259e82c7a0dd06ca3d423f9d870b06152c4004b66e528ad4031e0f78c81", + "s3_etag": "3c27fbba7767ed36ff27dc0f75e59898", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "organoid_1.json", + "size": 1063, + "uuid": "52f4207b-6b02-4446-bbc5-60b2fa2646ef", + "version": "1" + }, + { + "crc32c": "2D91E7F4", + "sha1": "c8b6050f7fe1394e6d35f47f4181f095972cd76c", + "sha256": "99d51a7f66ed152657d9b99cc377388bd66d92b8c35419eac4480b5bda6d9b2f", + "s3_etag": "9b5a314eccf2febdc2b9d4e63395f7c6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "organoid_2.json", + "size": 1063, + "uuid": "612cf5e2-df08-48fa-996b-9c8f4e7a82f7", + "version": "1" + }, + { + "crc32c": "0A6D1D1B", + "sha1": "8abaaaf66902ad063783c48c23effd980a04ee3a", + "sha256": "ccfca57ccc977d0b4d24e395a10c98016875f77bfa45d4db8daec15bef9013f9", + "s3_etag": "a2c4474384c80e4d18b3ebe13b8b97c7", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "organoid_3.json", + "size": 1063, + "uuid": "902d112a-626d-49fe-84f0-0ee5b9ec22ff", + "version": "1" + }, + { + "crc32c": "E384BC74", + "sha1": "cb344b29df5c357f342a246e5f717c51d362a1b0", + "sha256": "d242e65296790abc2df9819e17fb774c5fa32b5d1a86f92c2bb22aa1034c3253", + "s3_etag": "033822f8a62079f8bf6cdae97dd6e8ff", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 384, + "uuid": "0d15aaa5-b91e-47da-96c4-498817c57d32", + "version": "1" + }, + { + "crc32c": "36FA116A", + "sha1": "1182f2552c970ca11b1318f4408ce56b4dffa117", + "sha256": "855a7f1e05d5d52cbf875c570ce50615d82e815084058a44bd12ee2785651972", + "s3_etag": "a87aa7374af26a0726ffc9912beb1587", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 385, + "uuid": "55f11a72-679d-45f1-8e3f-6fefbf47e286", + "version": "1" + }, + { + "crc32c": "E0EAD6A2", + "sha1": "dcc6c890b6c026d2681fc3747465f7996b5640c0", + "sha256": "5b142b32d7f0daa6d986bba130ec4dfa11cc963d9fe5a4c6546189c89988b106", + "s3_etag": "22578d3c025f75723e425e4bbeb2a744", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_10.json", + "size": 384, + "uuid": "7f282ab8-4c62-4941-8a96-9a7fc1c15908", + "version": "1" + }, + { + "crc32c": "2FC7EEE2", + "sha1": "27f28f309af4f3f886b854aae600a2443cbe7bc8", + "sha256": "54cab28bf8f54f2b31c0b1a36d807fd6207f08846b5a4293dac6bed37b1fe088", + "s3_etag": "634a13163ec93509dc77080adb9f5c0b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_11.json", + "size": 384, + "uuid": "eba9a2b4-93af-4e9b-b947-bfee8368eff5", + "version": "1" + }, + { + "crc32c": "9435E3A2", + "sha1": "7671dd66457ce2922eb9716930ee76b86974fb44", + "sha256": "6561055b182a3d5df0402931bde0e41dbd8db5100f6fe581532fb12de3f95e5c", + "s3_etag": "036621819baba70e1285759dea883b80", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_12.json", + "size": 385, + "uuid": "e68b441f-6a3c-4653-82cf-c9e280e4c8ca", + "version": "1" + }, + { + "crc32c": "25FDA39D", + "sha1": "46239a0e2bae7a7664455a75ca5de279084c0362", + "sha256": "56a2e1c84780655b69f02a93d043415540f94e5f029a80f3dae4893b0272d423", + "s3_etag": "26114bd78631d4f9b244e9b951597540", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_13.json", + "size": 382, + "uuid": "29c367d6-1e6e-42aa-929a-53003fcfd2b0", + "version": "1" + }, + { + "crc32c": "946E27FD", + "sha1": "e1888bc7c9f088156bf06a7984d38775dc9097f8", + "sha256": "8b3ac4af71d275a59f71d0f037a0f237bceea0d5937e794fe9c3b9b265350b5c", + "s3_etag": "daabc9e156fccf576377e3c3db5caf58", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 384, + "uuid": "7883354d-d1a6-4b75-b61e-709b78852607", + "version": "1" + }, + { + "crc32c": "A4265197", + "sha1": "af81a9d70a7cc2539518b628e9778984af29d570", + "sha256": "5913546e5c2be620edc06274f1e0d999c7d5127b0a544f52b94c92410bff5e5a", + "s3_etag": "b1534cd56c7915a3b71cbd0554e90772", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_3.json", + "size": 385, + "uuid": "241c3bc4-4916-4117-afd9-dff0a8217a0a", + "version": "1" + }, + { + "crc32c": "25C42DF7", + "sha1": "2ca77ef5a25523c25010e0c7a58ff875f352398f", + "sha256": "6506fe4a1ee82742a54a8a088d607b2f27ad8238abe7ce4f8b1ba0404ffc38a3", + "s3_etag": "a1eeafb889a0a2764646b3766f212d69", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_4.json", + "size": 384, + "uuid": "13c4db36-5b93-49f6-b58e-7c82a18a2363", + "version": "1" + }, + { + "crc32c": "40BE578D", + "sha1": "80cfc6d8481d1fa2cdf28fa41ad91bdb2e51f63e", + "sha256": "e48af834232033ac5ca6bb99466cfad55776c19dd669fb7ebf8d1b51350cf604", + "s3_etag": "96e136d9dc338a856e9e1ed58cf946c8", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_5.json", + "size": 384, + "uuid": "4edabb8e-9860-4190-af5f-e4d6ba4486d0", + "version": "1" + }, + { + "crc32c": "0E1BEEE5", + "sha1": "483baa9f0edd63d0da137ee6a7e998bb1b1d33bc", + "sha256": "8edee18e16d3548adc6d62366764419a13ef9e2fcce31c1ebe458dc4868d69dd", + "s3_etag": "3e77c9793bcb3e78488e37beadd5558d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_6.json", + "size": 384, + "uuid": "27811f12-cb42-4fb4-a79f-f927731d5a63", + "version": "1" + }, + { + "crc32c": "396B84EE", + "sha1": "89f1d1951e475dd244fccc5941320afd3901028a", + "sha256": "fa12706e52327949780c92cc557fefedca9871844dfc39210a916d35641d7011", + "s3_etag": "db3dc2724789e086190206cd01da2a2d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_7.json", + "size": 384, + "uuid": "27d669f7-bdc5-432a-b079-3fc03c373d67", + "version": "1" + }, + { + "crc32c": "5468F0A5", + "sha1": "e48fb1c8abbf9953191fa98c04a678d62d70c82c", + "sha256": "bc57aac0a18fb39a00016ddeb022237707a284df26c2c654dad715325d2824dd", + "s3_etag": "db5c1a4672f848da888bd21bc6acaf7f", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_8.json", + "size": 385, + "uuid": "42c51858-6d1e-4895-adf2-7f482eb32660", + "version": "1" + }, + { + "crc32c": "C514DAC0", + "sha1": "8271cd1f7222a66a8c1e7568ab5fd7db59f6feca", + "sha256": "d3633026d76329c69d54060b20238fd613c5049982c5dbf988cfa6fee74254ff", + "s3_etag": "c713374f928ef43c4a5b8946ddbcd084", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_9.json", + "size": 384, + "uuid": "d1acc502-e544-40a9-93f5-c8d67511f064", + "version": "1" + }, + { + "crc32c": "DB603F5A", + "sha1": "d2e162e643da4968561ed5d86ca5b99bd0b8c6ea", + "sha256": "13e36741987fc5638765780f971a8b348c0755bf344492a45a11140c747fd1e5", + "s3_etag": "6493d7b50fe8dfb1d00e966ffa4974eb", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 3227, + "uuid": "d0f83203-c37b-4150-bae2-116ae78631e8", + "version": "1" + }, + { + "crc32c": "E9B38AA1", + "sha1": "0cec1204162ddfbd3782a1aedce104b373163a9f", + "sha256": "3f29407965e542a4787b6ab1f32ea3f4162017dc88e294ab3e48ddfe76d476e7", + "s3_etag": "ed217eaabe182e88101a33d82db57842", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 574, + "uuid": "112c95fa-ea50-404b-956c-b9ec4c04c085", + "version": "1" + }, + { + "crc32c": "E9B38AA1", + "sha1": "0cec1204162ddfbd3782a1aedce104b373163a9f", + "sha256": "3f29407965e542a4787b6ab1f32ea3f4162017dc88e294ab3e48ddfe76d476e7", + "s3_etag": "ed217eaabe182e88101a33d82db57842", + "content-type": "application/octet-stream", + "indexed": false, + "name": "GAC027_hOrg_HipSci_1_S5_L007_I1_001.fastq.gz", + "size": 574, + "uuid": "b9f26dd4-dddc-426d-97bb-674e8a0a26a2", + "version": "1" + }, + { + "crc32c": "59378C79", + "sha1": "d982fed4c2cfd402a145637f1bc1d6364745a506", + "sha256": "ff3118605c52fd9cb96cb17b96ecc8ec74b72cb75558305e8630568478c03547", + "s3_etag": "7e5fa30788311a17e73c0f468c1f5111", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_1.json", + "size": 574, + "uuid": "11aca137-0150-4b4e-8f06-cfc4a6ece618", + "version": "1" + }, + { + "crc32c": "59378C79", + "sha1": "d982fed4c2cfd402a145637f1bc1d6364745a506", + "sha256": "ff3118605c52fd9cb96cb17b96ecc8ec74b72cb75558305e8630568478c03547", + "s3_etag": "7e5fa30788311a17e73c0f468c1f5111", + "content-type": "application/octet-stream", + "indexed": false, + "name": "GAC027_hOrg_HipSci_1_S5_L007_R1_001.fastq.gz", + "size": 574, + "uuid": "1af1df49-a772-4645-bc0e-e8a599ab7121", + "version": "1" + }, + { + "crc32c": "8F96945F", + "sha1": "9cc9baf78624edf0e2c39e48ab7f559f32cfd7ca", + "sha256": "5a4bc638c31346d1fc4cde4cc8bfaf2341e486ba377edbeafb42a12d49ab6ddc", + "s3_etag": "fb796be961dfacd6fda6643898524312", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_2.json", + "size": 575, + "uuid": "a896db64-bfbc-4037-8961-bca3db82536b", + "version": "1" + }, + { + "crc32c": "8F96945F", + "sha1": "9cc9baf78624edf0e2c39e48ab7f559f32cfd7ca", + "sha256": "5a4bc638c31346d1fc4cde4cc8bfaf2341e486ba377edbeafb42a12d49ab6ddc", + "s3_etag": "fb796be961dfacd6fda6643898524312", + "content-type": "application/octet-stream", + "indexed": false, + "name": "GAC027_hOrg_HipSci_1_S5_L007_R2_001.fastq.gz", + "size": 575, + "uuid": "53c4d13c-d3d3-4294-affe-fd1fecf9d1ef", + "version": "1" + }, + { + "crc32c": "457923DA", + "sha1": "2301fe9dc733bac49eb5ce931e7559e1099ed82b", + "sha256": "3c8b6c4db6b5044813347f7eb2d6660b33f5bc5030f38add8ae0b99d3e9a8ee5", + "s3_etag": "adf854116f11b0959397f9c14b161331", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 867, + "uuid": "9d06f7fc-24ae-4537-85bf-0f7d0c5ddefc", + "version": "1" + }, + { + "crc32c": "E0D93B0C", + "sha1": "3083880e82885baa434d611356c3aada8ea3d4f8", + "sha256": "5a893d7fe914d5828825cb519e8a451c980f5d298f26bf303c0aa98c543a2194", + "s3_etag": "113c66e08c25067da74962bb494f3d1e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 1048, + "uuid": "f0cd3f8e-5503-47bc-8a39-1a3c3e892989", + "version": "1" + }, + { + "crc32c": "8DE73EBE", + "sha1": "ef74df1dae0c23a952cfaeb4ec4660f6062fce0a", + "sha256": "3883f5c02c0f1c38169e0e3322b44cdaf161898e6b4391d27cfd3e63adb11dcd", + "s3_etag": "b77920fe009c976f2fcaa1776e77bbf6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_1.json", + "size": 1048, + "uuid": "c03b694e-2a8a-4942-b166-b13d941fed78", + "version": "1" + }, + { + "crc32c": "7C7C5FF5", + "sha1": "1529730444f99fe070fe4a657f0dd6220d2ebf00", + "sha256": "acf81264458af58539a644186200d30a7d4329c629388b1f72ff6713455acacb", + "s3_etag": "c056979e064eb295ce379d2082c067c6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_2.json", + "size": 1048, + "uuid": "2c49c003-3c74-41e9-baa3-f89142d5b263", + "version": "1" + }, + { + "crc32c": "B08FE1B0", + "sha1": "37feef1a9fa93f0517ca4d48527db6f87b40e3fe", + "sha256": "e774b7e3fdfb8a3e4f6891aa7dfcdbfa91578ce27679fd4366279896b31420ce", + "s3_etag": "fff268413e7f8a3aad4fa526eb194e04", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_3.json", + "size": 1048, + "uuid": "4d100b9f-8c57-44e4-baa7-849225c23906", + "version": "1" + }, + { + "crc32c": "62D4DB03", + "sha1": "32df780ee719286fccafae4d715607d4f05f3c40", + "sha256": "6daea9af107bd45e2666ca2ccd1a2a3d98c42b892a7a783093b638508eccb158", + "s3_etag": "b16ebe4790175d73a26b993dc1802c45", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_0.json", + "size": 531, + "uuid": "d0e8071e-fcb8-4f3a-a697-51828738d58e", + "version": "1" + }, + { + "crc32c": "62D4DB03", + "sha1": "32df780ee719286fccafae4d715607d4f05f3c40", + "sha256": "6daea9af107bd45e2666ca2ccd1a2a3d98c42b892a7a783093b638508eccb158", + "s3_etag": "b16ebe4790175d73a26b993dc1802c45", + "content-type": "application/octet-stream", + "indexed": false, + "name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", + "size": 531, + "uuid": "c7555cbd-d66c-4f9a-b3f4-23e013da6910", + "version": "1" + }, + { + "crc32c": "B9D38666", + "sha1": "095ce1889337b2d8dd5ba3ce21ad85903ebda004", + "sha256": "a8b3535da8ba62f83c31b238c86a6f4b9848f913c6d35824cef5f955748f1ab9", + "s3_etag": "048ed5e075c2e93f61ada1b555ea0ea3", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_1.json", + "size": 495, + "uuid": "7b51ce31-7b7f-4d62-89d5-da551041c818", + "version": "1" + }, + { + "crc32c": "B9D38666", + "sha1": "095ce1889337b2d8dd5ba3ce21ad85903ebda004", + "sha256": "a8b3535da8ba62f83c31b238c86a6f4b9848f913c6d35824cef5f955748f1ab9", + "s3_etag": "048ed5e075c2e93f61ada1b555ea0ea3", + "content-type": "application/octet-stream", + "indexed": false, + "name": "hipsci-ipsc-pipeline.pdf", + "size": 495, + "uuid": "b5bc3187-6553-4410-b589-ac0f3bb6858f", + "version": "1" + }, + { + "crc32c": "47985515", + "sha1": "b12c361c6d4ebb7c255ddb3e67e3babbd1fe0e25", + "sha256": "492641dd1bc0004c879d9fe8599e03a455612892df4802f5a1e9c860216777f6", + "s3_etag": "d1bfcd931b2213f02df82362e2fdc609", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_2.json", + "size": 508, + "uuid": "2d3ea405-db62-4fb8-919b-0ddc44545d07", + "version": "1" + }, + { + "crc32c": "47985515", + "sha1": "b12c361c6d4ebb7c255ddb3e67e3babbd1fe0e25", + "sha256": "492641dd1bc0004c879d9fe8599e03a455612892df4802f5a1e9c860216777f6", + "s3_etag": "d1bfcd931b2213f02df82362e2fdc609", + "content-type": "application/octet-stream", + "indexed": false, + "name": "Dissociation_protocol_130-092-628.pdf", + "size": 508, + "uuid": "28aa156f-3eee-481b-8849-ab68ddf4b67d", + "version": "1" + } + ], + "metadata": { + "cell_line_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg_2", + "biomaterial_name": "iPS cell line kucg_2", + "biomaterial_description": "iPS cell line kucg_2", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2645814" + }, + "diseases": { + "text": "normal", + "ontology": "PATO:0000461" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248" + }, + "catalog_number": "77650065", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-kucg_2", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 25, + "growth_medium": "E8", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2014-11-03T00:00:00Z", + "provenance": { + "document_id": "304fadde-e22a-4ff9-9544-f8ec097b6135", + "submission_date": "2018-09-05T09:25:02.372Z", + "update_date": "2018-09-05T09:25:11.221Z" + } + }, + "cell_line_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj_2", + "biomaterial_name": "iPS cell line wibj_2", + "biomaterial_description": "iPS cell line wibj_2", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2627567" + }, + "diseases": { + "text": "normal", + "ontology": "PATO:0000461" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248" + }, + "catalog_number": "77650057", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-wibj_2", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 24, + "growth_medium": "E8", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2014-10-24T00:00:00Z", + "provenance": { + "document_id": "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4", + "submission_date": "2018-09-05T09:25:02.352Z", + "update_date": "2018-09-05T09:25:10.838Z" + } + }, + "cell_line_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd_3", + "biomaterial_name": "iPS cell line sojd_3", + "biomaterial_description": "iPS cell line sojd_3", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2627569" + }, + "diseases": { + "text": "normal", + "ontology": "PATO:0000461" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248" + }, + "catalog_number": "77650126", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-sojd_3", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 22, + "growth_medium": "E8", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2015-01-09T00:00:00Z", + "provenance": { + "document_id": "6953e086-13cc-4467-b059-4d5f91f6f268", + "submission_date": "2018-09-05T09:25:02.407Z", + "update_date": "2018-09-05T09:25:05.636Z" + } + }, + "cell_line_3.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik_1", + "biomaterial_name": "iPS cell line hoik_1", + "biomaterial_description": "iPS cell line hoik_1", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2698315" + }, + "diseases": { + "text": "normal", + "ontology": "PATO:0000461" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248" + }, + "catalog_number": "77650129", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-hoik_1", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 20, + "growth_medium": "E8", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2015-02-02T00:00:00Z", + "provenance": { + "document_id": "8bd345cb-4635-4bf5-9435-bf144013b938", + "submission_date": "2018-09-05T09:25:02.397Z", + "update_date": "2018-09-05T09:25:11.557Z" + } + }, + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI_organoids_pooled_1", + "biomaterial_name": "pooled cells from 4 dissociated organoids", + "biomaterial_description": "pooled cells from 4 dissociated organoids (wibj_2, kucg_2, hoik_1, sojd_3)", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "selected_cell_type": [ + { + "text": "neural cell", + "ontology": "CL:0002319" + } + ], + "total_estimated_cells": 6316, + "provenance": { + "document_id": "8fc8b364-98bb-4082-98af-e3fdffcf82b7", + "submission_date": "2018-09-05T09:25:02.595Z", + "update_date": "2018-09-05T09:25:12.353Z" + } + }, + "differentiation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/1.3.0/differentiation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Org_Lanc_2014", + "protocol_name": "Generation of cerebral organoids from human pluripotent stem cells", + "publication_doi": "10.1038/nprot.2014.158" + }, + "differentiation_method": "embryoid bodies", + "differentiation_target_pathway": "RHO||ROCK", + "differentiation_validation_method": "immunostaining", + "differentiation_reagents": { + "retail_name": "ROCK inhibitor Y27632" + }, + "differentiation_small_molecules": "Vitamin A (retinoic acid)", + "provenance": { + "document_id": "537b3c44-998f-43c2-8146-7e3e2932c30b", + "submission_date": "2018-09-05T09:25:02.643Z", + "update_date": "2018-09-05T09:25:11.867Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Cerebral_organoid_dissociation", + "protocol_name": "cerebral organoid dissociation", + "document": "Dissociation_protocol_130-092-628.pdf" + }, + "dissociation_method": { + "text": "Papain-based enzymatic dissociation", + "ontology": "EFO:0009128" + }, + "protocol_reagents": [ + { + "retail_name": "Neural Tissue Dissociation Kit", + "catalog_number": "130-092-628", + "manufacturer": "Miltenyi Biotec" + } + ], + "provenance": { + "document_id": "58334256-af4f-4754-9455-668fb31bbcff", + "submission_date": "2018-09-05T09:25:02.654Z", + "update_date": "2018-09-05T09:25:09.326Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd", + "biomaterial_name": "donor HPSI0314i-sojd", + "biomaterial_description": "donor HPSI0314i-sojd_3, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2418245" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "sex": "female", + "organism_age": "45-49", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "human_specific": { + "ethnicity": [ + { + "text": "White - other, Ad Mixed American", + "ontology": "hancestro:0463" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "5554b939-a268-4619-9cef-0f09151454fc", + "submission_date": "2018-09-05T09:25:02.273Z", + "update_date": "2018-09-05T09:25:09.818Z" + } + }, + "donor_organism_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj", + "biomaterial_name": "donor HPSI0214i-wibj", + "biomaterial_description": "donor HPSI0214i-wibj_2, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2398911" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "sex": "female", + "organism_age": "55-59", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "hancestro:0462" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "eea3dd19-90e0-45c4-803d-4620d1fab90d", + "submission_date": "2018-09-05T09:25:02.230Z", + "update_date": "2018-09-05T09:25:09.806Z" + } + }, + "donor_organism_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg", + "biomaterial_name": "donor HPSI0214i-kucg", + "biomaterial_description": "donor HPSI0214i-kucg_2, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2397923" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "sex": "male", + "organism_age": "65-69", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "hancestro:0462" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "fbd4c071-58bd-4818-8ddd-2c31ddb60363", + "submission_date": "2018-09-05T09:25:02.247Z", + "update_date": "2018-09-05T09:25:09.903Z" + } + }, + "donor_organism_3.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik", + "biomaterial_name": "donor HPSI0314i-hoik", + "biomaterial_description": "donor HPSI0314i-hoik_1, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2399961" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "sex": "female", + "organism_age": "40-44", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "hancestro:0462" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "62ee5119-4fa1-4508-95f3-59c7b0fddd34", + "submission_date": "2018-09-05T09:25:02.257Z", + "update_date": "2018-09-05T09:25:09.841Z" + } + }, + "ipsc_induction_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.0.1/ipsc_induction_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "ipsc_induction_protocol_1", + "protocol_name": "iPSC induction by Sendai virus", + "protocol_description": "Fibroblasts are thawed, transduced using Cytotune 2.0 Sendai virus (containing the Yamanaka genes encoding transcription factors Oct4, Sox2, cMyc and Klf4) and maintained until iPSC colony formation. Colonies are then picked and cultured to obtain a sizable yield of IPS cells, which are banked to a commercial grade standard. These banks then undergo quality checks to ensure the banks pass resuscitation tests and are free of mycoplasma.", + "document": "hipsci-ipsc-pipeline.pdf" + }, + "ipsc_induction_method": "sendai virus", + "pluripotency_vector_removed": "yes", + "ipsc_induction_kit": { + "retail_name": "Cytotune 1.0", + "manufacturer": "Thermofisher" + }, + "pluripotency_test": "HipSci Pluri test", + "ipsc_induction_produced_in_house": false, + "provenance": { + "document_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62", + "submission_date": "2018-09-05T09:25:02.631Z", + "update_date": "2018-09-05T09:25:09.069Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "10x_3'_library_preparation", + "protocol_name": "10x 3' single cell library preparation", + "protocol_description": "10x Chromium single cell 3' v2 library preparation", + "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" + }, + "nucleic_acid_source": "single cell", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_approach": { + "text": "Chromium 3' Single Cell v2", + "ontology": "EFO:0008995" + }, + "end_bias": "3 prime end bias", + "primer": "poly-dT", + "strand": "unstranded", + "cell_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 15, + "barcode_length": 10 + }, + "library_construction_kit": { + "retail_name": "10X Chromium Single Cell 3' Solution v2 Chemistry", + "manufacturer": "10X Genomics" + }, + "provenance": { + "document_id": "853c2086-1ac4-488e-b3b3-fe7956e74283", + "submission_date": "2018-09-05T09:25:02.667Z", + "update_date": "2018-09-05T09:25:09.008Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "88ef68b1-0c0b-4594-be46-4bb0bcf2025d", + "inputs": [ + "8fc8b364-98bb-4082-98af-e3fdffcf82b7" + ], + "input_type": "biomaterial", + "outputs": [ + "740b2221-41c6-498d-87de-8b2937a5ebed", + "a3f614b3-e6cf-4751-a15d-ff623efea62a", + "56c2a158-e389-40a3-97a7-0f2966a393b8" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "853c2086-1ac4-488e-b3b3-fe7956e74283" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "0b1dfbd4-1fbe-42a4-9213-b66dac4d4ac0" + } + ] + }, + { + "process": "d3c8ba6e-e552-48cc-ab34-38a95712b3f7", + "inputs": [ + "77a87953-5d2d-4e22-9c8b-c012fa8656b9", + "e4307721-7d92-4f92-a6f1-6f1d4ecf1835", + "08936dad-6f12-4f43-8bd2-b6863f166a21", + "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9" + ], + "input_type": "biomaterial", + "outputs": [ + "8fc8b364-98bb-4082-98af-e3fdffcf82b7" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "58334256-af4f-4754-9455-668fb31bbcff" + } + ] + }, + { + "process": "3ef770a1-1f72-47f2-952e-9fd584e74598", + "inputs": [ + "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4" + ], + "input_type": "biomaterial", + "outputs": [ + "77a87953-5d2d-4e22-9c8b-c012fa8656b9" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" + } + ] + }, + { + "process": "1c4b3da5-41c3-40bd-b128-4a4a94fb876e", + "inputs": [ + "440a306a-54c6-4193-9b60-ad4423c8a62b" + ], + "input_type": "biomaterial", + "outputs": [ + "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" + } + ] + }, + { + "process": "359f3d8c-e29c-41f1-b058-1854a7d7e79e", + "inputs": [ + "eea3dd19-90e0-45c4-803d-4620d1fab90d" + ], + "input_type": "biomaterial", + "outputs": [ + "440a306a-54c6-4193-9b60-ad4423c8a62b" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "df40cef2-60ae-400c-bece-947329b40946", + "inputs": [ + "304fadde-e22a-4ff9-9544-f8ec097b6135" + ], + "input_type": "biomaterial", + "outputs": [ + "e4307721-7d92-4f92-a6f1-6f1d4ecf1835" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" + } + ] + }, + { + "process": "0ec71414-3c56-4347-85a2-a2b66a4a147d", + "inputs": [ + "4eb07fdb-dcd8-4805-89ad-6068071c80c9" + ], + "input_type": "biomaterial", + "outputs": [ + "304fadde-e22a-4ff9-9544-f8ec097b6135" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" + } + ] + }, + { + "process": "9c2903a9-d93e-41a4-88bf-61647c6990a6", + "inputs": [ + "fbd4c071-58bd-4818-8ddd-2c31ddb60363" + ], + "input_type": "biomaterial", + "outputs": [ + "4eb07fdb-dcd8-4805-89ad-6068071c80c9" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "1ff79cfa-57e9-4af1-a754-51bdf36c4414", + "inputs": [ + "8bd345cb-4635-4bf5-9435-bf144013b938" + ], + "input_type": "biomaterial", + "outputs": [ + "08936dad-6f12-4f43-8bd2-b6863f166a21" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" + } + ] + }, + { + "process": "94b7d3a9-2a09-40d1-ba0e-80e8410b3d55", + "inputs": [ + "54046c37-b50d-41ae-a95f-2db29b1b706b" + ], + "input_type": "biomaterial", + "outputs": [ + "8bd345cb-4635-4bf5-9435-bf144013b938" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" + } + ] + }, + { + "process": "85e8adfd-f23b-47fb-9617-e51593923405", + "inputs": [ + "62ee5119-4fa1-4508-95f3-59c7b0fddd34" + ], + "input_type": "biomaterial", + "outputs": [ + "54046c37-b50d-41ae-a95f-2db29b1b706b" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "f999e1a4-31fc-4298-b958-8f567511935e", + "inputs": [ + "6953e086-13cc-4467-b059-4d5f91f6f268" + ], + "input_type": "biomaterial", + "outputs": [ + "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" + } + ] + }, + { + "process": "4e60bff4-9ede-42e2-9152-7f8f445938f5", + "inputs": [ + "2b541914-778d-4b24-9680-9d2643cfeff9" + ], + "input_type": "biomaterial", + "outputs": [ + "6953e086-13cc-4467-b059-4d5f91f6f268" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" + } + ] + }, + { + "process": "6ecf593a-c3d6-42a8-bf4e-a47549e7bb1f", + "inputs": [ + "5554b939-a268-4619-9cef-0f09151454fc" + ], + "input_type": "biomaterial", + "outputs": [ + "2b541914-778d-4b24-9680-9d2643cfeff9" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + }, + "organoid_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0214i-kucg_2_1", + "biomaterial_name": "human cerebral organoid kucg_2", + "biomaterial_description": "human cerebral organoid kucg_2, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": false, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "e4307721-7d92-4f92-a6f1-6f1d4ecf1835", + "submission_date": "2018-09-05T09:25:02.484Z", + "update_date": "2018-09-05T09:25:10.346Z" + } + }, + "organoid_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0314i-sojd_3_1", + "biomaterial_name": "human cerebral organoid sojd_3", + "biomaterial_description": "human cerebral organoid sojd_3, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": false, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9", + "submission_date": "2018-09-05T09:25:02.561Z", + "update_date": "2018-09-05T09:25:10.134Z" + } + }, + "organoid_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0314i-hoik_1_1", + "biomaterial_name": "human cerebral organoid hoik_1", + "biomaterial_description": "human cerebral organoid hoik_1, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": false, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "08936dad-6f12-4f43-8bd2-b6863f166a21", + "submission_date": "2018-09-05T09:25:02.525Z", + "update_date": "2018-09-05T09:25:10.146Z" + } + }, + "organoid_3.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0214i-wibj_2_1", + "biomaterial_name": "human cerebral organoid wibj_2", + "biomaterial_description": "human cerebral organoid wibj_2, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": false, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "77a87953-5d2d-4e22-9c8b-c012fa8656b9", + "submission_date": "2018-09-05T09:25:02.422Z", + "update_date": "2018-09-05T09:25:10.427Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "359f3d8c-e29c-41f1-b058-1854a7d7e79e", + "submission_date": "2018-09-05T09:25:02.792Z", + "update_date": "2018-09-05T09:25:09.834Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_18" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "f999e1a4-31fc-4298-b958-8f567511935e", + "submission_date": "2018-09-05T09:25:02.998Z", + "update_date": "2018-09-05T09:25:12.150Z" + } + }, + "process_10.json": { + "process_core": { + "process_id": "process_id_9" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "3ef770a1-1f72-47f2-952e-9fd584e74598", + "submission_date": "2018-09-05T09:25:02.893Z", + "update_date": "2018-09-05T09:25:11.841Z" + } + }, + "process_11.json": { + "process_core": { + "process_id": "process_id_2" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "9c2903a9-d93e-41a4-88bf-61647c6990a6", + "submission_date": "2018-09-05T09:25:02.805Z", + "update_date": "2018-09-05T09:25:11.730Z" + } + }, + "process_12.json": { + "process_core": { + "process_id": "process_id_15" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "1ff79cfa-57e9-4af1-a754-51bdf36c4414", + "submission_date": "2018-09-05T09:25:02.958Z", + "update_date": "2018-09-05T09:25:12.025Z" + } + }, + "process_13.json": { + "process_core": { + "process_id": "tech_rep_1" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "88ef68b1-0c0b-4594-be46-4bb0bcf2025d", + "submission_date": "2018-09-05T09:25:02.691Z", + "update_date": "2018-09-05T09:25:10.851Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_6" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "0ec71414-3c56-4347-85a2-a2b66a4a147d", + "submission_date": "2018-09-05T09:25:02.846Z", + "update_date": "2018-09-05T09:25:11.878Z" + } + }, + "process_3.json": { + "process_core": { + "process_id": "process_id_21" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "d3c8ba6e-e552-48cc-ab34-38a95712b3f7", + "submission_date": "2018-09-05T09:25:03.039Z", + "update_date": "2018-09-05T09:25:12.221Z" + } + }, + "process_4.json": { + "process_core": { + "process_id": "process_id_8" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "4e60bff4-9ede-42e2-9152-7f8f445938f5", + "submission_date": "2018-09-05T09:25:02.882Z", + "update_date": "2018-09-05T09:25:06.559Z" + } + }, + "process_5.json": { + "process_core": { + "process_id": "process_id_4" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "6ecf593a-c3d6-42a8-bf4e-a47549e7bb1f", + "submission_date": "2018-09-05T09:25:02.827Z", + "update_date": "2018-09-05T09:25:11.893Z" + } + }, + "process_6.json": { + "process_core": { + "process_id": "process_id_5" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "1c4b3da5-41c3-40bd-b128-4a4a94fb876e", + "submission_date": "2018-09-05T09:25:02.837Z", + "update_date": "2018-09-05T09:25:11.945Z" + } + }, + "process_7.json": { + "process_core": { + "process_id": "process_id_3" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "85e8adfd-f23b-47fb-9617-e51593923405", + "submission_date": "2018-09-05T09:25:02.817Z", + "update_date": "2018-09-05T09:25:11.959Z" + } + }, + "process_8.json": { + "process_core": { + "process_id": "process_id_12" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "df40cef2-60ae-400c-bece-947329b40946", + "submission_date": "2018-09-05T09:25:02.924Z", + "update_date": "2018-09-05T09:25:12.073Z" + } + }, + "process_9.json": { + "process_core": { + "process_id": "process_id_7" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "94b7d3a9-2a09-40d1-ba0e-80e8410b3d55", + "submission_date": "2018-09-05T09:25:02.859Z", + "update_date": "2018-09-05T09:25:12.053Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "HPSI_human_cerebral_organoids", + "project_title": "Assessing the relevance of organoids to model inter-individual variation", + "project_description": "The purpose of this project is to assess the relevance of pluripotent stem cell-derived cerebral and liver organoids to recapitulate the variation in cell-type specific gene expression programs between individuals. Towards this aim, we will generate reference atlases of the developing cortex and liver from multiple individuals, derive iPSC lines from these same individuals, and determine if inter-individual gene expression variation is recapitulated in cerebral and liver organoids from the same individual from which we have reference maps. In parallel we will assess the genetic contribution to variablity between organoids from different iPSCs of multiple human individuals that are available in existing iPSC resources (e.g. HipSci)." + }, + "contributors": [ + { + "contact_name": "Barbara,,Treutlein", + "email": "barbara_treutlein@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "project_role": "principal investigator", + "orcid_id": "0000-0002-3299-5597", + "corresponding_contributor": true + }, + { + "contact_name": "J,Gray,Camp", + "email": "gray_camp@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Zhisong,,He", + "email": "zhisong_he@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Sabina,,Kanton", + "email": "sabina_kanton@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + } + ], + "provenance": { + "document_id": "88f5dff1-d784-4d9a-9c5d-f309fbe738c8", + "submission_date": "2018-09-05T09:25:01.786Z", + "update_date": "2018-09-05T09:25:05.557Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_1_S5_L007_I1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "c6e1beaa24f6a580bf9632cc37d69d38" + }, + "read_index": "index1", + "lane_index": 7, + "read_length": 8, + "provenance": { + "document_id": "740b2221-41c6-498d-87de-8b2937a5ebed", + "submission_date": "2018-09-05T09:25:01.845Z", + "update_date": "2018-09-05T09:25:03.221Z" + } + }, + "sequence_file_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_1_S5_L007_R1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "0129f8043b3c2bf2bfa4d28acc5e29f2" + }, + "read_index": "read1", + "lane_index": 7, + "read_length": 26, + "provenance": { + "document_id": "a3f614b3-e6cf-4751-a15d-ff623efea62a", + "submission_date": "2018-09-05T09:25:01.867Z", + "update_date": "2018-09-05T09:25:03.230Z" + } + }, + "sequence_file_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_1_S5_L007_R2_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "a7224a02d3a64e45f9264c9594e5a0b3" + }, + "read_index": "read2", + "lane_index": 7, + "read_length": 100, + "provenance": { + "document_id": "56c2a158-e389-40a3-97a7-0f2966a393b8", + "submission_date": "2018-09-05T09:25:01.903Z", + "update_date": "2018-09-05T09:25:03.244Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "10x_scRNASeq", + "protocol_name": "10x single cell RNA Sequencing", + "protocol_description": "10x RNA sequencing", + "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565" + }, + "paired_end": true, + "sequencing_approach": { + "text": "tag based single cell RNA sequencing", + "ontology": "EFO:0008440" + }, + "provenance": { + "document_id": "0b1dfbd4-1fbe-42a4-9213-b66dac4d4ac0", + "submission_date": "2018-09-05T09:25:02.679Z", + "update_date": "2018-09-05T09:25:09.017Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik_skin", + "biomaterial_name": "Skin cells from HPSI0314i-hoik_skin", + "biomaterial_description": "Skin cells from HPSI0314i-hoik_skin", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "provenance": { + "document_id": "54046c37-b50d-41ae-a95f-2db29b1b706b", + "submission_date": "2018-09-05T09:25:02.318Z", + "update_date": "2018-09-05T09:25:10.219Z" + } + }, + "specimen_from_organism_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd_skin", + "biomaterial_name": "Skin cells from HPSI0314i-sojd_skin", + "biomaterial_description": "Skin cells from HPSI0314i-sojd_skin", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "provenance": { + "document_id": "2b541914-778d-4b24-9680-9d2643cfeff9", + "submission_date": "2018-09-05T09:25:02.335Z", + "update_date": "2018-09-05T09:25:05.620Z" + } + }, + "specimen_from_organism_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj_skin", + "biomaterial_name": "Skin cells from HPSI0214i-wibj_skin", + "biomaterial_description": "Skin cells from HPSI0214i-wibj_skin", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "provenance": { + "document_id": "440a306a-54c6-4193-9b60-ad4423c8a62b", + "submission_date": "2018-09-05T09:25:02.283Z", + "update_date": "2018-09-05T09:25:10.273Z" + } + }, + "specimen_from_organism_3.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg_skin", + "biomaterial_name": "Skin cells from HPSI0214i-kucg_skin", + "biomaterial_description": "Skin cells from HPSI0214i-kucg_skin", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "provenance": { + "document_id": "4eb07fdb-dcd8-4805-89ad-6068071c80c9", + "submission_date": "2018-09-05T09:25:02.307Z", + "update_date": "2018-09-05T09:25:09.878Z" + } + }, + "supplementary_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", + "file_format": "pdf" + }, + "file_description": "10x Chromium single cell 3' v2 library preparation", + "provenance": { + "document_id": "a0eb3208-97e4-498c-993b-20757231b233", + "submission_date": "2018-09-05T09:25:01.832Z", + "update_date": "2018-09-05T09:25:02.972Z" + } + }, + "supplementary_file_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "hipsci-ipsc-pipeline.pdf", + "file_format": "pdf" + }, + "file_description": "iPSC induction by Sendai virus protocol.", + "provenance": { + "document_id": "e01ee650-58b3-4f3c-8da8-4483700a1eae", + "submission_date": "2018-09-05T09:25:01.803Z", + "update_date": "2018-09-05T09:25:03.001Z" + } + }, + "supplementary_file_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Dissociation_protocol_130-092-628.pdf", + "file_format": "pdf" + }, + "file_description": "Cerebral organoid dissociation protocol.", + "provenance": { + "document_id": "5ab06a61-c66b-4d3d-9889-ab47371a65b0", + "submission_date": "2018-09-05T09:25:01.815Z", + "update_date": "2018-09-05T09:25:02.980Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index f8f6f0ed8..000000000 --- a/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,602 +0,0 @@ -[ - { - "crc32c": "5FB5C074", - "sha1": "0a0b7ed1c1a82e2349bf7c7f2c55169f687d05c3", - "sha256": "99fb280727cdff1f5ae1e5a5f27f261fe0ac4033b34dd5ff505dbdcb2d3e759b", - "s3_etag": "11c4139932510cbd72a250c08c6cb82c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_line_0.json", - "size": 1550, - "uuid": "cdfc49a1-a600-4033-bbce-64e5ee3a67aa", - "version": "1" - }, - { - "crc32c": "F33FDC5E", - "sha1": "27a55a4dcab02acd4add013730794c4cb5158f6a", - "sha256": "a78f437a98dd2bc97c50f85f11a74756e2efdaa1b46c24c034101d1fc292ad5d", - "s3_etag": "908e7a5a3c3618dd38dcc173958d8a3f", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_line_1.json", - "size": 1550, - "uuid": "e9e1a31a-d4a0-458d-97ae-956ec8779f15", - "version": "1" - }, - { - "crc32c": "762C33CA", - "sha1": "1229f946b792a2927e6773b1269075b6562ee81e", - "sha256": "bd1ee60863c05c86cb0c8959f0aaf2dbb99b053905d53a9a9e5ba2de7864b738", - "s3_etag": "526862c44aa198cfd979ecb17dcc38f3", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_line_2.json", - "size": 1550, - "uuid": "ce6bfc46-a7fe-4727-8469-8e6c4d26509a", - "version": "1" - }, - { - "crc32c": "13AA5D45", - "sha1": "4c91f609fdcfe2850ce2d6573e8820c86801980f", - "sha256": "95915233425da95c2d73c9ec6eabbf82408b1e9b1b1bea9340733fd2c3a078c1", - "s3_etag": "d799a453314d517cd17c16c956ba4b8e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_line_3.json", - "size": 1550, - "uuid": "c56293b4-baeb-4551-890e-3e32c62798d1", - "version": "1" - }, - { - "crc32c": "DDAF2641", - "sha1": "19142e0002a43b494b83a1dd76d7adb92b8ffc28", - "sha256": "1edb9a2932e909e892baf0519cff201118ad508aad507bac54564f49a9561ab6", - "s3_etag": "7473ef8331da4a49a63c07b2e5c840d8", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 949, - "uuid": "618f335a-3852-4901-83d9-82daa4177dbc", - "version": "1" - }, - { - "crc32c": "A397FBC5", - "sha1": "5be27ec15298c67153ee558594c85de413b1e06f", - "sha256": "97dbea2a50149e9220eb3f42445307dd0a3d0ac3ddb79ecdea7f63807a29ca12", - "s3_etag": "f4105454d86a649e5ed2faacdf40267b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "differentiation_protocol_0.json", - "size": 892, - "uuid": "cbabc165-8efa-4ad8-b8e4-b626d303abec", - "version": "1" - }, - { - "crc32c": "26CC9E56", - "sha1": "82c10b7f7e7fde821b843a851bd87dcfd7346b64", - "sha256": "3a9b2afeb6d68786b9e2962fd7a61c2af3e8271fa23777185a2915586eea869d", - "s3_etag": "a6fe3d1a7286703909172eb12663a8a0", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 894, - "uuid": "844dc5d2-f028-4f1a-bad9-c93e1cecd3bc", - "version": "1" - }, - { - "crc32c": "1EC942F7", - "sha1": "91165a3ca2ff2f90b064078354a9dfe934279d8a", - "sha256": "44ef118e6332ec0ab6f805ba5af9d929fe019fec5bfd8a24969dbbfd687538ee", - "s3_etag": "dd544abfc3b3747e131367aba87f6029", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1249, - "uuid": "9338e6ae-0739-4ab0-9f57-d2be865e5dff", - "version": "1" - }, - { - "crc32c": "634E048E", - "sha1": "b4c171efbba79e1273140484962ce580b071c964", - "sha256": "6a74ac1688744b305c0f6cc7b76611cc5749e2ec22b4a929d52200253d9b91ef", - "s3_etag": "f72ecca4363919754848fbf5b31a558c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_1.json", - "size": 1241, - "uuid": "950aaa5d-7fb2-4d3b-9576-cd7b038b8bb6", - "version": "1" - }, - { - "crc32c": "F2A1DA41", - "sha1": "1d94489bc26b7bc9d7bef5bea5c564bc96301d02", - "sha256": "9ae2ae48eaf9e6475dac6fdf0328390aadb178446221dff72b3d77a7a36f2597", - "s3_etag": "5b3aaf115f2fca94fb1731d2a9b5fe1c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_2.json", - "size": 1239, - "uuid": "7459dbd0-618a-4b71-93b9-a65f0eeba281", - "version": "1" - }, - { - "crc32c": "B1ABDBAD", - "sha1": "a339b614e9da58d2b294ab9406834fbcd6b3a819", - "sha256": "32deb4381f53c73e2e1c28d6a2a0af552aa7373201ff67b8a3a54c5cab6d6694", - "s3_etag": "e604c108482e9223bd23ebe794f602dc", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_3.json", - "size": 1241, - "uuid": "e91c797e-56ec-4877-bea3-dd0cd999dbfc", - "version": "1" - }, - { - "crc32c": "C33C083F", - "sha1": "cfff160e96b7276b9feaa69ccfd715d9277c9bc5", - "sha256": "a9ef1c267f90af8db06a282c451c9bf9369752da93ecf33c16ea9d5429051151", - "s3_etag": "92a0bc6c22b1e683f973713071d83893", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "ipsc_induction_protocol_0.json", - "size": 1315, - "uuid": "89710eb4-8a04-46d3-adf3-7d18880b9c6e", - "version": "1" - }, - { - "crc32c": "5E158C8F", - "sha1": "abb5f21951e368e15622637638aaace6c8137895", - "sha256": "a7532291beae09ab1c319b975202e4854f8a7c1ffbf8232e9d9abb02b7c3b42b", - "s3_etag": "d229e0b768a4dc143ddb258fdbd4405f", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1423, - "uuid": "597f5fae-db6a-4ebc-b2f0-b9c527f5b3ed", - "version": "1" - }, - { - "crc32c": "E8D34C5D", - "sha1": "e3336e075787d319a239533d8620a4a60a793bac", - "sha256": "062e56b2f314b8fd81b916985767abaedc4e22923e80607b023a3bf68554d4e0", - "s3_etag": "3ae64d0365c9c2d857c4194f41b471a6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 7860, - "uuid": "19f9d2c2-2d30-4262-8d19-a5de9ca13dd7", - "version": "1" - }, - { - "crc32c": "27917E6E", - "sha1": "6be5be8c979bf95b9be25df1f16c9856bb55bff3", - "sha256": "cb67b750844e71cfd0939023c91fb732e08a9307e48f86c0883b35b13f2c8b97", - "s3_etag": "3f08625623379bced02503c3d1a6803d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "organoid_0.json", - "size": 1063, - "uuid": "0ce77825-d03a-465b-83d1-d91eb1acadd9", - "version": "1" - }, - { - "crc32c": "2D7F18D4", - "sha1": "a12847e2c70066f16d1feb05ba875f360a74bdb6", - "sha256": "fa68b259e82c7a0dd06ca3d423f9d870b06152c4004b66e528ad4031e0f78c81", - "s3_etag": "3c27fbba7767ed36ff27dc0f75e59898", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "organoid_1.json", - "size": 1063, - "uuid": "52f4207b-6b02-4446-bbc5-60b2fa2646ef", - "version": "1" - }, - { - "crc32c": "2D91E7F4", - "sha1": "c8b6050f7fe1394e6d35f47f4181f095972cd76c", - "sha256": "99d51a7f66ed152657d9b99cc377388bd66d92b8c35419eac4480b5bda6d9b2f", - "s3_etag": "9b5a314eccf2febdc2b9d4e63395f7c6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "organoid_2.json", - "size": 1063, - "uuid": "612cf5e2-df08-48fa-996b-9c8f4e7a82f7", - "version": "1" - }, - { - "crc32c": "0A6D1D1B", - "sha1": "8abaaaf66902ad063783c48c23effd980a04ee3a", - "sha256": "ccfca57ccc977d0b4d24e395a10c98016875f77bfa45d4db8daec15bef9013f9", - "s3_etag": "a2c4474384c80e4d18b3ebe13b8b97c7", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "organoid_3.json", - "size": 1063, - "uuid": "902d112a-626d-49fe-84f0-0ee5b9ec22ff", - "version": "1" - }, - { - "crc32c": "E384BC74", - "sha1": "cb344b29df5c357f342a246e5f717c51d362a1b0", - "sha256": "d242e65296790abc2df9819e17fb774c5fa32b5d1a86f92c2bb22aa1034c3253", - "s3_etag": "033822f8a62079f8bf6cdae97dd6e8ff", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 384, - "uuid": "0d15aaa5-b91e-47da-96c4-498817c57d32", - "version": "1" - }, - { - "crc32c": "36FA116A", - "sha1": "1182f2552c970ca11b1318f4408ce56b4dffa117", - "sha256": "855a7f1e05d5d52cbf875c570ce50615d82e815084058a44bd12ee2785651972", - "s3_etag": "a87aa7374af26a0726ffc9912beb1587", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 385, - "uuid": "55f11a72-679d-45f1-8e3f-6fefbf47e286", - "version": "1" - }, - { - "crc32c": "E0EAD6A2", - "sha1": "dcc6c890b6c026d2681fc3747465f7996b5640c0", - "sha256": "5b142b32d7f0daa6d986bba130ec4dfa11cc963d9fe5a4c6546189c89988b106", - "s3_etag": "22578d3c025f75723e425e4bbeb2a744", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_10.json", - "size": 384, - "uuid": "7f282ab8-4c62-4941-8a96-9a7fc1c15908", - "version": "1" - }, - { - "crc32c": "2FC7EEE2", - "sha1": "27f28f309af4f3f886b854aae600a2443cbe7bc8", - "sha256": "54cab28bf8f54f2b31c0b1a36d807fd6207f08846b5a4293dac6bed37b1fe088", - "s3_etag": "634a13163ec93509dc77080adb9f5c0b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_11.json", - "size": 384, - "uuid": "eba9a2b4-93af-4e9b-b947-bfee8368eff5", - "version": "1" - }, - { - "crc32c": "9435E3A2", - "sha1": "7671dd66457ce2922eb9716930ee76b86974fb44", - "sha256": "6561055b182a3d5df0402931bde0e41dbd8db5100f6fe581532fb12de3f95e5c", - "s3_etag": "036621819baba70e1285759dea883b80", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_12.json", - "size": 385, - "uuid": "e68b441f-6a3c-4653-82cf-c9e280e4c8ca", - "version": "1" - }, - { - "crc32c": "25FDA39D", - "sha1": "46239a0e2bae7a7664455a75ca5de279084c0362", - "sha256": "56a2e1c84780655b69f02a93d043415540f94e5f029a80f3dae4893b0272d423", - "s3_etag": "26114bd78631d4f9b244e9b951597540", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_13.json", - "size": 382, - "uuid": "29c367d6-1e6e-42aa-929a-53003fcfd2b0", - "version": "1" - }, - { - "crc32c": "946E27FD", - "sha1": "e1888bc7c9f088156bf06a7984d38775dc9097f8", - "sha256": "8b3ac4af71d275a59f71d0f037a0f237bceea0d5937e794fe9c3b9b265350b5c", - "s3_etag": "daabc9e156fccf576377e3c3db5caf58", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 384, - "uuid": "7883354d-d1a6-4b75-b61e-709b78852607", - "version": "1" - }, - { - "crc32c": "A4265197", - "sha1": "af81a9d70a7cc2539518b628e9778984af29d570", - "sha256": "5913546e5c2be620edc06274f1e0d999c7d5127b0a544f52b94c92410bff5e5a", - "s3_etag": "b1534cd56c7915a3b71cbd0554e90772", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_3.json", - "size": 385, - "uuid": "241c3bc4-4916-4117-afd9-dff0a8217a0a", - "version": "1" - }, - { - "crc32c": "25C42DF7", - "sha1": "2ca77ef5a25523c25010e0c7a58ff875f352398f", - "sha256": "6506fe4a1ee82742a54a8a088d607b2f27ad8238abe7ce4f8b1ba0404ffc38a3", - "s3_etag": "a1eeafb889a0a2764646b3766f212d69", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_4.json", - "size": 384, - "uuid": "13c4db36-5b93-49f6-b58e-7c82a18a2363", - "version": "1" - }, - { - "crc32c": "40BE578D", - "sha1": "80cfc6d8481d1fa2cdf28fa41ad91bdb2e51f63e", - "sha256": "e48af834232033ac5ca6bb99466cfad55776c19dd669fb7ebf8d1b51350cf604", - "s3_etag": "96e136d9dc338a856e9e1ed58cf946c8", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_5.json", - "size": 384, - "uuid": "4edabb8e-9860-4190-af5f-e4d6ba4486d0", - "version": "1" - }, - { - "crc32c": "0E1BEEE5", - "sha1": "483baa9f0edd63d0da137ee6a7e998bb1b1d33bc", - "sha256": "8edee18e16d3548adc6d62366764419a13ef9e2fcce31c1ebe458dc4868d69dd", - "s3_etag": "3e77c9793bcb3e78488e37beadd5558d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_6.json", - "size": 384, - "uuid": "27811f12-cb42-4fb4-a79f-f927731d5a63", - "version": "1" - }, - { - "crc32c": "396B84EE", - "sha1": "89f1d1951e475dd244fccc5941320afd3901028a", - "sha256": "fa12706e52327949780c92cc557fefedca9871844dfc39210a916d35641d7011", - "s3_etag": "db3dc2724789e086190206cd01da2a2d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_7.json", - "size": 384, - "uuid": "27d669f7-bdc5-432a-b079-3fc03c373d67", - "version": "1" - }, - { - "crc32c": "5468F0A5", - "sha1": "e48fb1c8abbf9953191fa98c04a678d62d70c82c", - "sha256": "bc57aac0a18fb39a00016ddeb022237707a284df26c2c654dad715325d2824dd", - "s3_etag": "db5c1a4672f848da888bd21bc6acaf7f", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_8.json", - "size": 385, - "uuid": "42c51858-6d1e-4895-adf2-7f482eb32660", - "version": "1" - }, - { - "crc32c": "C514DAC0", - "sha1": "8271cd1f7222a66a8c1e7568ab5fd7db59f6feca", - "sha256": "d3633026d76329c69d54060b20238fd613c5049982c5dbf988cfa6fee74254ff", - "s3_etag": "c713374f928ef43c4a5b8946ddbcd084", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_9.json", - "size": 384, - "uuid": "d1acc502-e544-40a9-93f5-c8d67511f064", - "version": "1" - }, - { - "crc32c": "DB603F5A", - "sha1": "d2e162e643da4968561ed5d86ca5b99bd0b8c6ea", - "sha256": "13e36741987fc5638765780f971a8b348c0755bf344492a45a11140c747fd1e5", - "s3_etag": "6493d7b50fe8dfb1d00e966ffa4974eb", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 3227, - "uuid": "d0f83203-c37b-4150-bae2-116ae78631e8", - "version": "1" - }, - { - "crc32c": "E9B38AA1", - "sha1": "0cec1204162ddfbd3782a1aedce104b373163a9f", - "sha256": "3f29407965e542a4787b6ab1f32ea3f4162017dc88e294ab3e48ddfe76d476e7", - "s3_etag": "ed217eaabe182e88101a33d82db57842", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 574, - "uuid": "112c95fa-ea50-404b-956c-b9ec4c04c085", - "version": "1" - }, - { - "crc32c": "E9B38AA1", - "sha1": "0cec1204162ddfbd3782a1aedce104b373163a9f", - "sha256": "3f29407965e542a4787b6ab1f32ea3f4162017dc88e294ab3e48ddfe76d476e7", - "s3_etag": "ed217eaabe182e88101a33d82db57842", - "content-type": "application/octet-stream", - "indexed": false, - "name": "GAC027_hOrg_HipSci_1_S5_L007_I1_001.fastq.gz", - "size": 574, - "uuid": "b9f26dd4-dddc-426d-97bb-674e8a0a26a2", - "version": "1" - }, - { - "crc32c": "59378C79", - "sha1": "d982fed4c2cfd402a145637f1bc1d6364745a506", - "sha256": "ff3118605c52fd9cb96cb17b96ecc8ec74b72cb75558305e8630568478c03547", - "s3_etag": "7e5fa30788311a17e73c0f468c1f5111", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_1.json", - "size": 574, - "uuid": "11aca137-0150-4b4e-8f06-cfc4a6ece618", - "version": "1" - }, - { - "crc32c": "59378C79", - "sha1": "d982fed4c2cfd402a145637f1bc1d6364745a506", - "sha256": "ff3118605c52fd9cb96cb17b96ecc8ec74b72cb75558305e8630568478c03547", - "s3_etag": "7e5fa30788311a17e73c0f468c1f5111", - "content-type": "application/octet-stream", - "indexed": false, - "name": "GAC027_hOrg_HipSci_1_S5_L007_R1_001.fastq.gz", - "size": 574, - "uuid": "1af1df49-a772-4645-bc0e-e8a599ab7121", - "version": "1" - }, - { - "crc32c": "8F96945F", - "sha1": "9cc9baf78624edf0e2c39e48ab7f559f32cfd7ca", - "sha256": "5a4bc638c31346d1fc4cde4cc8bfaf2341e486ba377edbeafb42a12d49ab6ddc", - "s3_etag": "fb796be961dfacd6fda6643898524312", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_2.json", - "size": 575, - "uuid": "a896db64-bfbc-4037-8961-bca3db82536b", - "version": "1" - }, - { - "crc32c": "8F96945F", - "sha1": "9cc9baf78624edf0e2c39e48ab7f559f32cfd7ca", - "sha256": "5a4bc638c31346d1fc4cde4cc8bfaf2341e486ba377edbeafb42a12d49ab6ddc", - "s3_etag": "fb796be961dfacd6fda6643898524312", - "content-type": "application/octet-stream", - "indexed": false, - "name": "GAC027_hOrg_HipSci_1_S5_L007_R2_001.fastq.gz", - "size": 575, - "uuid": "53c4d13c-d3d3-4294-affe-fd1fecf9d1ef", - "version": "1" - }, - { - "crc32c": "457923DA", - "sha1": "2301fe9dc733bac49eb5ce931e7559e1099ed82b", - "sha256": "3c8b6c4db6b5044813347f7eb2d6660b33f5bc5030f38add8ae0b99d3e9a8ee5", - "s3_etag": "adf854116f11b0959397f9c14b161331", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 867, - "uuid": "9d06f7fc-24ae-4537-85bf-0f7d0c5ddefc", - "version": "1" - }, - { - "crc32c": "E0D93B0C", - "sha1": "3083880e82885baa434d611356c3aada8ea3d4f8", - "sha256": "5a893d7fe914d5828825cb519e8a451c980f5d298f26bf303c0aa98c543a2194", - "s3_etag": "113c66e08c25067da74962bb494f3d1e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 1048, - "uuid": "f0cd3f8e-5503-47bc-8a39-1a3c3e892989", - "version": "1" - }, - { - "crc32c": "8DE73EBE", - "sha1": "ef74df1dae0c23a952cfaeb4ec4660f6062fce0a", - "sha256": "3883f5c02c0f1c38169e0e3322b44cdaf161898e6b4391d27cfd3e63adb11dcd", - "s3_etag": "b77920fe009c976f2fcaa1776e77bbf6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_1.json", - "size": 1048, - "uuid": "c03b694e-2a8a-4942-b166-b13d941fed78", - "version": "1" - }, - { - "crc32c": "7C7C5FF5", - "sha1": "1529730444f99fe070fe4a657f0dd6220d2ebf00", - "sha256": "acf81264458af58539a644186200d30a7d4329c629388b1f72ff6713455acacb", - "s3_etag": "c056979e064eb295ce379d2082c067c6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_2.json", - "size": 1048, - "uuid": "2c49c003-3c74-41e9-baa3-f89142d5b263", - "version": "1" - }, - { - "crc32c": "B08FE1B0", - "sha1": "37feef1a9fa93f0517ca4d48527db6f87b40e3fe", - "sha256": "e774b7e3fdfb8a3e4f6891aa7dfcdbfa91578ce27679fd4366279896b31420ce", - "s3_etag": "fff268413e7f8a3aad4fa526eb194e04", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_3.json", - "size": 1048, - "uuid": "4d100b9f-8c57-44e4-baa7-849225c23906", - "version": "1" - }, - { - "crc32c": "62D4DB03", - "sha1": "32df780ee719286fccafae4d715607d4f05f3c40", - "sha256": "6daea9af107bd45e2666ca2ccd1a2a3d98c42b892a7a783093b638508eccb158", - "s3_etag": "b16ebe4790175d73a26b993dc1802c45", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_0.json", - "size": 531, - "uuid": "d0e8071e-fcb8-4f3a-a697-51828738d58e", - "version": "1" - }, - { - "crc32c": "62D4DB03", - "sha1": "32df780ee719286fccafae4d715607d4f05f3c40", - "sha256": "6daea9af107bd45e2666ca2ccd1a2a3d98c42b892a7a783093b638508eccb158", - "s3_etag": "b16ebe4790175d73a26b993dc1802c45", - "content-type": "application/octet-stream", - "indexed": false, - "name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", - "size": 531, - "uuid": "c7555cbd-d66c-4f9a-b3f4-23e013da6910", - "version": "1" - }, - { - "crc32c": "B9D38666", - "sha1": "095ce1889337b2d8dd5ba3ce21ad85903ebda004", - "sha256": "a8b3535da8ba62f83c31b238c86a6f4b9848f913c6d35824cef5f955748f1ab9", - "s3_etag": "048ed5e075c2e93f61ada1b555ea0ea3", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_1.json", - "size": 495, - "uuid": "7b51ce31-7b7f-4d62-89d5-da551041c818", - "version": "1" - }, - { - "crc32c": "B9D38666", - "sha1": "095ce1889337b2d8dd5ba3ce21ad85903ebda004", - "sha256": "a8b3535da8ba62f83c31b238c86a6f4b9848f913c6d35824cef5f955748f1ab9", - "s3_etag": "048ed5e075c2e93f61ada1b555ea0ea3", - "content-type": "application/octet-stream", - "indexed": false, - "name": "hipsci-ipsc-pipeline.pdf", - "size": 495, - "uuid": "b5bc3187-6553-4410-b589-ac0f3bb6858f", - "version": "1" - }, - { - "crc32c": "47985515", - "sha1": "b12c361c6d4ebb7c255ddb3e67e3babbd1fe0e25", - "sha256": "492641dd1bc0004c879d9fe8599e03a455612892df4802f5a1e9c860216777f6", - "s3_etag": "d1bfcd931b2213f02df82362e2fdc609", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_2.json", - "size": 508, - "uuid": "2d3ea405-db62-4fb8-919b-0ddc44545d07", - "version": "1" - }, - { - "crc32c": "47985515", - "sha1": "b12c361c6d4ebb7c255ddb3e67e3babbd1fe0e25", - "sha256": "492641dd1bc0004c879d9fe8599e03a455612892df4802f5a1e9c860216777f6", - "s3_etag": "d1bfcd931b2213f02df82362e2fdc609", - "content-type": "application/octet-stream", - "indexed": false, - "name": "Dissociation_protocol_130-092-628.pdf", - "size": 508, - "uuid": "28aa156f-3eee-481b-8849-ab68ddf4b67d", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index ef933bc83..000000000 --- a/test/hca_metadata_api/cans/examples/HPSI_human_cerebral_organoids/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,1378 +0,0 @@ -{ - "cell_line_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg_2", - "biomaterial_name": "iPS cell line kucg_2", - "biomaterial_description": "iPS cell line kucg_2", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2645814" - }, - "diseases": { - "text": "normal", - "ontology": "PATO:0000461" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248" - }, - "catalog_number": "77650065", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-kucg_2", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 25, - "growth_medium": "E8", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2014-11-03T00:00:00Z", - "provenance": { - "document_id": "304fadde-e22a-4ff9-9544-f8ec097b6135", - "submission_date": "2018-09-05T09:25:02.372Z", - "update_date": "2018-09-05T09:25:11.221Z" - } - }, - "cell_line_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj_2", - "biomaterial_name": "iPS cell line wibj_2", - "biomaterial_description": "iPS cell line wibj_2", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2627567" - }, - "diseases": { - "text": "normal", - "ontology": "PATO:0000461" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248" - }, - "catalog_number": "77650057", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-wibj_2", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 24, - "growth_medium": "E8", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2014-10-24T00:00:00Z", - "provenance": { - "document_id": "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4", - "submission_date": "2018-09-05T09:25:02.352Z", - "update_date": "2018-09-05T09:25:10.838Z" - } - }, - "cell_line_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd_3", - "biomaterial_name": "iPS cell line sojd_3", - "biomaterial_description": "iPS cell line sojd_3", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2627569" - }, - "diseases": { - "text": "normal", - "ontology": "PATO:0000461" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248" - }, - "catalog_number": "77650126", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-sojd_3", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 22, - "growth_medium": "E8", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2015-01-09T00:00:00Z", - "provenance": { - "document_id": "6953e086-13cc-4467-b059-4d5f91f6f268", - "submission_date": "2018-09-05T09:25:02.407Z", - "update_date": "2018-09-05T09:25:05.636Z" - } - }, - "cell_line_3.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.2/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik_1", - "biomaterial_name": "iPS cell line hoik_1", - "biomaterial_description": "iPS cell line hoik_1", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2698315" - }, - "diseases": { - "text": "normal", - "ontology": "PATO:0000461" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248" - }, - "catalog_number": "77650129", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-hoik_1", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 20, - "growth_medium": "E8", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2015-02-02T00:00:00Z", - "provenance": { - "document_id": "8bd345cb-4635-4bf5-9435-bf144013b938", - "submission_date": "2018-09-05T09:25:02.397Z", - "update_date": "2018-09-05T09:25:11.557Z" - } - }, - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI_organoids_pooled_1", - "biomaterial_name": "pooled cells from 4 dissociated organoids", - "biomaterial_description": "pooled cells from 4 dissociated organoids (wibj_2, kucg_2, hoik_1, sojd_3)", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "selected_cell_type": [ - { - "text": "neural cell", - "ontology": "CL:0002319" - } - ], - "total_estimated_cells": 6316, - "provenance": { - "document_id": "8fc8b364-98bb-4082-98af-e3fdffcf82b7", - "submission_date": "2018-09-05T09:25:02.595Z", - "update_date": "2018-09-05T09:25:12.353Z" - } - }, - "differentiation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/1.3.0/differentiation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Org_Lanc_2014", - "protocol_name": "Generation of cerebral organoids from human pluripotent stem cells", - "publication_doi": "10.1038/nprot.2014.158" - }, - "differentiation_method": "embryoid bodies", - "differentiation_target_pathway": "RHO||ROCK", - "differentiation_validation_method": "immunostaining", - "differentiation_reagents": { - "retail_name": "ROCK inhibitor Y27632" - }, - "differentiation_small_molecules": "Vitamin A (retinoic acid)", - "provenance": { - "document_id": "537b3c44-998f-43c2-8146-7e3e2932c30b", - "submission_date": "2018-09-05T09:25:02.643Z", - "update_date": "2018-09-05T09:25:11.867Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Cerebral_organoid_dissociation", - "protocol_name": "cerebral organoid dissociation", - "document": "Dissociation_protocol_130-092-628.pdf" - }, - "dissociation_method": { - "text": "Papain-based enzymatic dissociation", - "ontology": "EFO:0009128" - }, - "protocol_reagents": [ - { - "retail_name": "Neural Tissue Dissociation Kit", - "catalog_number": "130-092-628", - "manufacturer": "Miltenyi Biotec" - } - ], - "provenance": { - "document_id": "58334256-af4f-4754-9455-668fb31bbcff", - "submission_date": "2018-09-05T09:25:02.654Z", - "update_date": "2018-09-05T09:25:09.326Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd", - "biomaterial_name": "donor HPSI0314i-sojd", - "biomaterial_description": "donor HPSI0314i-sojd_3, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2418245" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "sex": "female", - "organism_age": "45-49", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "human_specific": { - "ethnicity": [ - { - "text": "White - other, Ad Mixed American", - "ontology": "hancestro:0463" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "5554b939-a268-4619-9cef-0f09151454fc", - "submission_date": "2018-09-05T09:25:02.273Z", - "update_date": "2018-09-05T09:25:09.818Z" - } - }, - "donor_organism_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj", - "biomaterial_name": "donor HPSI0214i-wibj", - "biomaterial_description": "donor HPSI0214i-wibj_2, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2398911" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "sex": "female", - "organism_age": "55-59", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "hancestro:0462" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "eea3dd19-90e0-45c4-803d-4620d1fab90d", - "submission_date": "2018-09-05T09:25:02.230Z", - "update_date": "2018-09-05T09:25:09.806Z" - } - }, - "donor_organism_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg", - "biomaterial_name": "donor HPSI0214i-kucg", - "biomaterial_description": "donor HPSI0214i-kucg_2, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2397923" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "sex": "male", - "organism_age": "65-69", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "hancestro:0462" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "fbd4c071-58bd-4818-8ddd-2c31ddb60363", - "submission_date": "2018-09-05T09:25:02.247Z", - "update_date": "2018-09-05T09:25:09.903Z" - } - }, - "donor_organism_3.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik", - "biomaterial_name": "donor HPSI0314i-hoik", - "biomaterial_description": "donor HPSI0314i-hoik_1, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2399961" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "sex": "female", - "organism_age": "40-44", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "hancestro:0462" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "62ee5119-4fa1-4508-95f3-59c7b0fddd34", - "submission_date": "2018-09-05T09:25:02.257Z", - "update_date": "2018-09-05T09:25:09.841Z" - } - }, - "ipsc_induction_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.0.1/ipsc_induction_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "ipsc_induction_protocol_1", - "protocol_name": "iPSC induction by Sendai virus", - "protocol_description": "Fibroblasts are thawed, transduced using Cytotune 2.0 Sendai virus (containing the Yamanaka genes encoding transcription factors Oct4, Sox2, cMyc and Klf4) and maintained until iPSC colony formation. Colonies are then picked and cultured to obtain a sizable yield of IPS cells, which are banked to a commercial grade standard. These banks then undergo quality checks to ensure the banks pass resuscitation tests and are free of mycoplasma.", - "document": "hipsci-ipsc-pipeline.pdf" - }, - "ipsc_induction_method": "sendai virus", - "pluripotency_vector_removed": "yes", - "ipsc_induction_kit": { - "retail_name": "Cytotune 1.0", - "manufacturer": "Thermofisher" - }, - "pluripotency_test": "HipSci Pluri test", - "ipsc_induction_produced_in_house": false, - "provenance": { - "document_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62", - "submission_date": "2018-09-05T09:25:02.631Z", - "update_date": "2018-09-05T09:25:09.069Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "10x_3'_library_preparation", - "protocol_name": "10x 3' single cell library preparation", - "protocol_description": "10x Chromium single cell 3' v2 library preparation", - "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" - }, - "nucleic_acid_source": "single cell", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_approach": { - "text": "Chromium 3' Single Cell v2", - "ontology": "EFO:0008995" - }, - "end_bias": "3 prime end bias", - "primer": "poly-dT", - "strand": "unstranded", - "cell_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 15, - "barcode_length": 10 - }, - "library_construction_kit": { - "retail_name": "10X Chromium Single Cell 3' Solution v2 Chemistry", - "manufacturer": "10X Genomics" - }, - "provenance": { - "document_id": "853c2086-1ac4-488e-b3b3-fe7956e74283", - "submission_date": "2018-09-05T09:25:02.667Z", - "update_date": "2018-09-05T09:25:09.008Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "88ef68b1-0c0b-4594-be46-4bb0bcf2025d", - "inputs": [ - "8fc8b364-98bb-4082-98af-e3fdffcf82b7" - ], - "input_type": "biomaterial", - "outputs": [ - "740b2221-41c6-498d-87de-8b2937a5ebed", - "a3f614b3-e6cf-4751-a15d-ff623efea62a", - "56c2a158-e389-40a3-97a7-0f2966a393b8" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "853c2086-1ac4-488e-b3b3-fe7956e74283" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "0b1dfbd4-1fbe-42a4-9213-b66dac4d4ac0" - } - ] - }, - { - "process": "d3c8ba6e-e552-48cc-ab34-38a95712b3f7", - "inputs": [ - "77a87953-5d2d-4e22-9c8b-c012fa8656b9", - "e4307721-7d92-4f92-a6f1-6f1d4ecf1835", - "08936dad-6f12-4f43-8bd2-b6863f166a21", - "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9" - ], - "input_type": "biomaterial", - "outputs": [ - "8fc8b364-98bb-4082-98af-e3fdffcf82b7" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "58334256-af4f-4754-9455-668fb31bbcff" - } - ] - }, - { - "process": "3ef770a1-1f72-47f2-952e-9fd584e74598", - "inputs": [ - "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4" - ], - "input_type": "biomaterial", - "outputs": [ - "77a87953-5d2d-4e22-9c8b-c012fa8656b9" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" - } - ] - }, - { - "process": "1c4b3da5-41c3-40bd-b128-4a4a94fb876e", - "inputs": [ - "440a306a-54c6-4193-9b60-ad4423c8a62b" - ], - "input_type": "biomaterial", - "outputs": [ - "cc5c8bd6-3bd6-49d6-87b3-b24ef3a577a4" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" - } - ] - }, - { - "process": "359f3d8c-e29c-41f1-b058-1854a7d7e79e", - "inputs": [ - "eea3dd19-90e0-45c4-803d-4620d1fab90d" - ], - "input_type": "biomaterial", - "outputs": [ - "440a306a-54c6-4193-9b60-ad4423c8a62b" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "df40cef2-60ae-400c-bece-947329b40946", - "inputs": [ - "304fadde-e22a-4ff9-9544-f8ec097b6135" - ], - "input_type": "biomaterial", - "outputs": [ - "e4307721-7d92-4f92-a6f1-6f1d4ecf1835" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" - } - ] - }, - { - "process": "0ec71414-3c56-4347-85a2-a2b66a4a147d", - "inputs": [ - "4eb07fdb-dcd8-4805-89ad-6068071c80c9" - ], - "input_type": "biomaterial", - "outputs": [ - "304fadde-e22a-4ff9-9544-f8ec097b6135" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" - } - ] - }, - { - "process": "9c2903a9-d93e-41a4-88bf-61647c6990a6", - "inputs": [ - "fbd4c071-58bd-4818-8ddd-2c31ddb60363" - ], - "input_type": "biomaterial", - "outputs": [ - "4eb07fdb-dcd8-4805-89ad-6068071c80c9" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "1ff79cfa-57e9-4af1-a754-51bdf36c4414", - "inputs": [ - "8bd345cb-4635-4bf5-9435-bf144013b938" - ], - "input_type": "biomaterial", - "outputs": [ - "08936dad-6f12-4f43-8bd2-b6863f166a21" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" - } - ] - }, - { - "process": "94b7d3a9-2a09-40d1-ba0e-80e8410b3d55", - "inputs": [ - "54046c37-b50d-41ae-a95f-2db29b1b706b" - ], - "input_type": "biomaterial", - "outputs": [ - "8bd345cb-4635-4bf5-9435-bf144013b938" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" - } - ] - }, - { - "process": "85e8adfd-f23b-47fb-9617-e51593923405", - "inputs": [ - "62ee5119-4fa1-4508-95f3-59c7b0fddd34" - ], - "input_type": "biomaterial", - "outputs": [ - "54046c37-b50d-41ae-a95f-2db29b1b706b" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "f999e1a4-31fc-4298-b958-8f567511935e", - "inputs": [ - "6953e086-13cc-4467-b059-4d5f91f6f268" - ], - "input_type": "biomaterial", - "outputs": [ - "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "537b3c44-998f-43c2-8146-7e3e2932c30b" - } - ] - }, - { - "process": "4e60bff4-9ede-42e2-9152-7f8f445938f5", - "inputs": [ - "2b541914-778d-4b24-9680-9d2643cfeff9" - ], - "input_type": "biomaterial", - "outputs": [ - "6953e086-13cc-4467-b059-4d5f91f6f268" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "9e3b5ef9-cbb0-43ef-a194-1ce1969cfd62" - } - ] - }, - { - "process": "6ecf593a-c3d6-42a8-bf4e-a47549e7bb1f", - "inputs": [ - "5554b939-a268-4619-9cef-0f09151454fc" - ], - "input_type": "biomaterial", - "outputs": [ - "2b541914-778d-4b24-9680-9d2643cfeff9" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - }, - "organoid_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0214i-kucg_2_1", - "biomaterial_name": "human cerebral organoid kucg_2", - "biomaterial_description": "human cerebral organoid kucg_2, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": false, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "e4307721-7d92-4f92-a6f1-6f1d4ecf1835", - "submission_date": "2018-09-05T09:25:02.484Z", - "update_date": "2018-09-05T09:25:10.346Z" - } - }, - "organoid_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0314i-sojd_3_1", - "biomaterial_name": "human cerebral organoid sojd_3", - "biomaterial_description": "human cerebral organoid sojd_3, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": false, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "dfd95ce4-c5be-4175-9e9a-249b1b09f5d9", - "submission_date": "2018-09-05T09:25:02.561Z", - "update_date": "2018-09-05T09:25:10.134Z" - } - }, - "organoid_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0314i-hoik_1_1", - "biomaterial_name": "human cerebral organoid hoik_1", - "biomaterial_description": "human cerebral organoid hoik_1, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": false, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "08936dad-6f12-4f43-8bd2-b6863f166a21", - "submission_date": "2018-09-05T09:25:02.525Z", - "update_date": "2018-09-05T09:25:10.146Z" - } - }, - "organoid_3.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.3.6/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0214i-wibj_2_1", - "biomaterial_name": "human cerebral organoid wibj_2", - "biomaterial_description": "human cerebral organoid wibj_2, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": false, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "77a87953-5d2d-4e22-9c8b-c012fa8656b9", - "submission_date": "2018-09-05T09:25:02.422Z", - "update_date": "2018-09-05T09:25:10.427Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "359f3d8c-e29c-41f1-b058-1854a7d7e79e", - "submission_date": "2018-09-05T09:25:02.792Z", - "update_date": "2018-09-05T09:25:09.834Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_18" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "f999e1a4-31fc-4298-b958-8f567511935e", - "submission_date": "2018-09-05T09:25:02.998Z", - "update_date": "2018-09-05T09:25:12.150Z" - } - }, - "process_10.json": { - "process_core": { - "process_id": "process_id_9" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "3ef770a1-1f72-47f2-952e-9fd584e74598", - "submission_date": "2018-09-05T09:25:02.893Z", - "update_date": "2018-09-05T09:25:11.841Z" - } - }, - "process_11.json": { - "process_core": { - "process_id": "process_id_2" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "9c2903a9-d93e-41a4-88bf-61647c6990a6", - "submission_date": "2018-09-05T09:25:02.805Z", - "update_date": "2018-09-05T09:25:11.730Z" - } - }, - "process_12.json": { - "process_core": { - "process_id": "process_id_15" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "1ff79cfa-57e9-4af1-a754-51bdf36c4414", - "submission_date": "2018-09-05T09:25:02.958Z", - "update_date": "2018-09-05T09:25:12.025Z" - } - }, - "process_13.json": { - "process_core": { - "process_id": "tech_rep_1" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "88ef68b1-0c0b-4594-be46-4bb0bcf2025d", - "submission_date": "2018-09-05T09:25:02.691Z", - "update_date": "2018-09-05T09:25:10.851Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_6" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "0ec71414-3c56-4347-85a2-a2b66a4a147d", - "submission_date": "2018-09-05T09:25:02.846Z", - "update_date": "2018-09-05T09:25:11.878Z" - } - }, - "process_3.json": { - "process_core": { - "process_id": "process_id_21" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "d3c8ba6e-e552-48cc-ab34-38a95712b3f7", - "submission_date": "2018-09-05T09:25:03.039Z", - "update_date": "2018-09-05T09:25:12.221Z" - } - }, - "process_4.json": { - "process_core": { - "process_id": "process_id_8" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "4e60bff4-9ede-42e2-9152-7f8f445938f5", - "submission_date": "2018-09-05T09:25:02.882Z", - "update_date": "2018-09-05T09:25:06.559Z" - } - }, - "process_5.json": { - "process_core": { - "process_id": "process_id_4" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "6ecf593a-c3d6-42a8-bf4e-a47549e7bb1f", - "submission_date": "2018-09-05T09:25:02.827Z", - "update_date": "2018-09-05T09:25:11.893Z" - } - }, - "process_6.json": { - "process_core": { - "process_id": "process_id_5" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "1c4b3da5-41c3-40bd-b128-4a4a94fb876e", - "submission_date": "2018-09-05T09:25:02.837Z", - "update_date": "2018-09-05T09:25:11.945Z" - } - }, - "process_7.json": { - "process_core": { - "process_id": "process_id_3" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "85e8adfd-f23b-47fb-9617-e51593923405", - "submission_date": "2018-09-05T09:25:02.817Z", - "update_date": "2018-09-05T09:25:11.959Z" - } - }, - "process_8.json": { - "process_core": { - "process_id": "process_id_12" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "df40cef2-60ae-400c-bece-947329b40946", - "submission_date": "2018-09-05T09:25:02.924Z", - "update_date": "2018-09-05T09:25:12.073Z" - } - }, - "process_9.json": { - "process_core": { - "process_id": "process_id_7" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "94b7d3a9-2a09-40d1-ba0e-80e8410b3d55", - "submission_date": "2018-09-05T09:25:02.859Z", - "update_date": "2018-09-05T09:25:12.053Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "HPSI_human_cerebral_organoids", - "project_title": "Assessing the relevance of organoids to model inter-individual variation", - "project_description": "The purpose of this project is to assess the relevance of pluripotent stem cell-derived cerebral and liver organoids to recapitulate the variation in cell-type specific gene expression programs between individuals. Towards this aim, we will generate reference atlases of the developing cortex and liver from multiple individuals, derive iPSC lines from these same individuals, and determine if inter-individual gene expression variation is recapitulated in cerebral and liver organoids from the same individual from which we have reference maps. In parallel we will assess the genetic contribution to variablity between organoids from different iPSCs of multiple human individuals that are available in existing iPSC resources (e.g. HipSci)." - }, - "contributors": [ - { - "contact_name": "Barbara,,Treutlein", - "email": "barbara_treutlein@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "project_role": "principal investigator", - "orcid_id": "0000-0002-3299-5597", - "corresponding_contributor": true - }, - { - "contact_name": "J,Gray,Camp", - "email": "gray_camp@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Zhisong,,He", - "email": "zhisong_he@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Sabina,,Kanton", - "email": "sabina_kanton@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - } - ], - "provenance": { - "document_id": "88f5dff1-d784-4d9a-9c5d-f309fbe738c8", - "submission_date": "2018-09-05T09:25:01.786Z", - "update_date": "2018-09-05T09:25:05.557Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_1_S5_L007_I1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "c6e1beaa24f6a580bf9632cc37d69d38" - }, - "read_index": "index1", - "lane_index": 7, - "read_length": 8, - "provenance": { - "document_id": "740b2221-41c6-498d-87de-8b2937a5ebed", - "submission_date": "2018-09-05T09:25:01.845Z", - "update_date": "2018-09-05T09:25:03.221Z" - } - }, - "sequence_file_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_1_S5_L007_R1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "0129f8043b3c2bf2bfa4d28acc5e29f2" - }, - "read_index": "read1", - "lane_index": 7, - "read_length": 26, - "provenance": { - "document_id": "a3f614b3-e6cf-4751-a15d-ff623efea62a", - "submission_date": "2018-09-05T09:25:01.867Z", - "update_date": "2018-09-05T09:25:03.230Z" - } - }, - "sequence_file_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_1_S5_L007_R2_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "a7224a02d3a64e45f9264c9594e5a0b3" - }, - "read_index": "read2", - "lane_index": 7, - "read_length": 100, - "provenance": { - "document_id": "56c2a158-e389-40a3-97a7-0f2966a393b8", - "submission_date": "2018-09-05T09:25:01.903Z", - "update_date": "2018-09-05T09:25:03.244Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "10x_scRNASeq", - "protocol_name": "10x single cell RNA Sequencing", - "protocol_description": "10x RNA sequencing", - "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565" - }, - "paired_end": true, - "sequencing_approach": { - "text": "tag based single cell RNA sequencing", - "ontology": "EFO:0008440" - }, - "provenance": { - "document_id": "0b1dfbd4-1fbe-42a4-9213-b66dac4d4ac0", - "submission_date": "2018-09-05T09:25:02.679Z", - "update_date": "2018-09-05T09:25:09.017Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik_skin", - "biomaterial_name": "Skin cells from HPSI0314i-hoik_skin", - "biomaterial_description": "Skin cells from HPSI0314i-hoik_skin", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "provenance": { - "document_id": "54046c37-b50d-41ae-a95f-2db29b1b706b", - "submission_date": "2018-09-05T09:25:02.318Z", - "update_date": "2018-09-05T09:25:10.219Z" - } - }, - "specimen_from_organism_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd_skin", - "biomaterial_name": "Skin cells from HPSI0314i-sojd_skin", - "biomaterial_description": "Skin cells from HPSI0314i-sojd_skin", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "provenance": { - "document_id": "2b541914-778d-4b24-9680-9d2643cfeff9", - "submission_date": "2018-09-05T09:25:02.335Z", - "update_date": "2018-09-05T09:25:05.620Z" - } - }, - "specimen_from_organism_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj_skin", - "biomaterial_name": "Skin cells from HPSI0214i-wibj_skin", - "biomaterial_description": "Skin cells from HPSI0214i-wibj_skin", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "provenance": { - "document_id": "440a306a-54c6-4193-9b60-ad4423c8a62b", - "submission_date": "2018-09-05T09:25:02.283Z", - "update_date": "2018-09-05T09:25:10.273Z" - } - }, - "specimen_from_organism_3.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg_skin", - "biomaterial_name": "Skin cells from HPSI0214i-kucg_skin", - "biomaterial_description": "Skin cells from HPSI0214i-kucg_skin", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "provenance": { - "document_id": "4eb07fdb-dcd8-4805-89ad-6068071c80c9", - "submission_date": "2018-09-05T09:25:02.307Z", - "update_date": "2018-09-05T09:25:09.878Z" - } - }, - "supplementary_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", - "file_format": "pdf" - }, - "file_description": "10x Chromium single cell 3' v2 library preparation", - "provenance": { - "document_id": "a0eb3208-97e4-498c-993b-20757231b233", - "submission_date": "2018-09-05T09:25:01.832Z", - "update_date": "2018-09-05T09:25:02.972Z" - } - }, - "supplementary_file_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "hipsci-ipsc-pipeline.pdf", - "file_format": "pdf" - }, - "file_description": "iPSC induction by Sendai virus protocol.", - "provenance": { - "document_id": "e01ee650-58b3-4f3c-8da8-4483700a1eae", - "submission_date": "2018-09-05T09:25:01.803Z", - "update_date": "2018-09-05T09:25:03.001Z" - } - }, - "supplementary_file_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Dissociation_protocol_130-092-628.pdf", - "file_format": "pdf" - }, - "file_description": "Cerebral organoid dissociation protocol.", - "provenance": { - "document_id": "5ab06a61-c66b-4d3d-9889-ab47371a65b0", - "submission_date": "2018-09-05T09:25:01.815Z", - "update_date": "2018-09-05T09:25:02.980Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..3f9f9b81a --- /dev/null +++ b/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,563 @@ +{ + "manifest": [ + { + "crc32c": "5BD8FC51", + "sha1": "fc41223e6bd3fd884ab40a98a051c7acf41d7243", + "sha256": "1710870a83869afc2ede83706c3911c01f753b5bfff3220ed81c1394553cbc79", + "s3_etag": "e8ec2d0ca57ae4738c49aea2094bb8f6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 913, + "uuid": "732ab422-b36b-4f0e-9f91-f1b0cf984984", + "version": "1" + }, + { + "crc32c": "EBFCF474", + "sha1": "1d6e39c56493feab7b874e3b92dc79b6fe347d0b", + "sha256": "9f8840c0716fce194924ce86613a87fe94ba2e89f9cc8112786fb1f37f99c940", + "s3_etag": "06b8af8307f3a7da5dadcf6e60ef0380", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 857, + "uuid": "13266f29-920b-445c-91fa-fd683831c87a", + "version": "1" + }, + { + "crc32c": "B4634BFF", + "sha1": "3cde5b765f3f5a18e9902572b13883676c2e8721", + "sha256": "db90e6c5140f031c52299c9dd66a7310a194160cde2cb3ef7f0f01de77106d79", + "s3_etag": "ba39caa20ae934bb5703097970591e80", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1177, + "uuid": "a4d6229e-b564-4d51-85ca-ed7353910268", + "version": "1" + }, + { + "crc32c": "D596AA61", + "sha1": "7bb8a706cf1f1300fcf2788cee6fb1216e4099ba", + "sha256": "6b01f8c51ee2a50dc97772b52f3a7b1149af522011c8fa44c721413c8875b353", + "s3_etag": "054953ebfa89ff7e73e7a5e03975670b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1268, + "uuid": "3b8ffd02-7a9e-44ff-bec5-1387b87b0e34", + "version": "1" + }, + { + "crc32c": "5AE674D4", + "sha1": "a2c43b27d4cdcd769ea9aa5fb6dc38d144a19448", + "sha256": "5444d86b7f7dde2c7521dde5821b12d04cd544ecae07464b45ee75ad98c9becc", + "s3_etag": "f2fb4a3a21e54e7b6455fcd9fac1e1b1", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 1856, + "uuid": "d6284ed3-ff4c-4153-90b5-a3f5fb10c799", + "version": "1" + }, + { + "crc32c": "22B1F2B5", + "sha1": "24335fec0fbe49e182b9a25d9953a7ef34f797fa", + "sha256": "8385d1134079775e2d1d857ff66db53261a8c62fbaa7ca77c1310798aa29dcc7", + "s3_etag": "aceae67e53b5d93f880e30d0197164d2", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 461, + "uuid": "79e7bb26-099f-4d9e-8711-514f1383d752", + "version": "1" + }, + { + "crc32c": "EF616C2D", + "sha1": "7985dc3035527ab48dacb101a24fb065c65e13e9", + "sha256": "98693f433c34cf3219e0403a61dad368a6fa51e91354d9486cce241084b024c6", + "s3_etag": "114d1c662aa7ddd4aaeadaab810d4083", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 385, + "uuid": "93da3ebd-5b95-4894-8b01-a6aa5cd06fa9", + "version": "1" + }, + { + "crc32c": "9F23B91E", + "sha1": "51fb89bfa1af7881b8be47e98618d22f3492ce05", + "sha256": "9e3e23702ad9dc24cbd7aeb38e52bbe57fa95b155804e8b884398c4918f88f27", + "s3_etag": "8e494c3a285b0de594b8ab0e5bec9c6c", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 384, + "uuid": "c0323842-4443-4298-8036-adba33c77a30", + "version": "1" + }, + { + "crc32c": "A02C699B", + "sha1": "01074ce8f1d3edbe942659731663c7e12d0128cf", + "sha256": "ff9a4518c41f837b295a3beb44f2ad1bd0bb1a47cb3ddd92bb1edb192320239c", + "s3_etag": "322aeb89c995b0657e33b085b8b1f7aa", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 5090, + "uuid": "372f77fe-9a81-483c-8d13-4e2d059bfda6", + "version": "1" + }, + { + "crc32c": "3D02CDD9", + "sha1": "b2dad8a028624c456ba43f1f97ac20bba430af74", + "sha256": "730386f5383a1c82f114ba6cc9ff381f2c47872d6edc4f1342b0b9df9a282795", + "s3_etag": "5a43cfafe8d19b34b73ec4561653e517", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 514, + "uuid": "e6f7823c-73c2-4484-b3b8-07aad4008dc1", + "version": "1" + }, + { + "crc32c": "3D02CDD9", + "sha1": "b2dad8a028624c456ba43f1f97ac20bba430af74", + "sha256": "730386f5383a1c82f114ba6cc9ff381f2c47872d6edc4f1342b0b9df9a282795", + "s3_etag": "5a43cfafe8d19b34b73ec4561653e517", + "content-type": "application/octet-stream", + "indexed": false, + "name": "AZ_B8.fastq.gz", + "size": 514, + "uuid": "32d60a94-9f0f-44e3-83c6-eb2d1c1177bd", + "version": "1" + }, + { + "crc32c": "D1ED7790", + "sha1": "b6347439cabfd949d62ea9bd4583668e4dae9ae3", + "sha256": "8b07de467f9656adfa2c17403be4969329592833e2582acd6e7b90764bad3c94", + "s3_etag": "71de6f17e7bd1a32cf38026269c9c548", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 928, + "uuid": "06e8f95d-bdfb-4b72-84e9-160eab21e059", + "version": "1" + }, + { + "crc32c": "DAA2F138", + "sha1": "299ee695490d80e71963e51190f95808b79e0042", + "sha256": "6d5703145464fd2a53adcc79c2c3339dfec0e04cf1a463c078678ada7f79f374", + "s3_etag": "9b8fb5f7d54ef2b22a14abdaef88a677", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 1011, + "uuid": "888e84a3-26e0-4f46-983d-91014e7c60a3", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "AZ_B8", + "biomaterial_name": "AZ_B8 cell", + "biomaterial_description": "AZ_B8 cell", + "ncbi_taxon_id": [ + 9606 + ], + "insdc_biomaterial": "ERS1348492", + "biosd_biomaterial": "SAMEA4437043" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "total_estimated_cells": 1, + "plate_based_sequencing": { + "plate_id": "AZ", + "well_id": "B8", + "cell_quality": "OK" + }, + "provenance": { + "document_id": "1200f5bf-7d45-4f26-865e-b560797f1808", + "submission_date": "2018-09-05T12:09:41.946Z", + "update_date": "2018-09-05T12:21:55.818Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "Single cell dissociation", + "protocol_description": "Islets were dissociated into single-cell suspension and viable individual cells were distributed by FACS into 384-well plates containing lysis buffer.", + "publication_doi": "10.1016/j.cmet.2016.08.020" + }, + "dissociation_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "provenance": { + "document_id": "6029a289-861c-4349-9614-4c244103be21", + "submission_date": "2018-09-05T12:11:53.063Z", + "update_date": "2018-09-05T12:17:49.721Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "H1", + "biomaterial_name": "Normal Donor 1", + "biomaterial_description": "Normal Donor 1", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "is_living": "no", + "sex": "male", + "medical_history": { + "test_results": "HbA1c 5.0%" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272" + }, + "organism_age": "43", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "human_specific": { + "body_mass_index": 30.8 + }, + "provenance": { + "document_id": "8bb4258a-90c7-4af6-8a1b-c4ab6c5483e2", + "submission_date": "2018-09-05T12:09:41.702Z", + "update_date": "2018-09-05T12:14:26.204Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Library preparation for sequencing", + "protocol_description": "Single-cell RNA-seq libraries were generated as described in Picelli et al., 2014, Full-length RNA-seq from single cells using Smart-seq2, Nature Protocols.", + "publication_doi": "10.1038/nprot.2014.006" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "nucleic_acid_source": "single cell", + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "spike_in_dilution": 40000, + "spike_in_kit": { + "retail_name": "External RNA Controls Consortium (ERCC)", + "manufacturer": "Ambion, Life Technologies" + }, + "provenance": { + "document_id": "079bc155-71c9-45ab-bd12-cab025890d82", + "submission_date": "2018-09-05T12:11:53.080Z", + "update_date": "2018-09-05T12:17:48.051Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "aa67d2ed-e4ea-4cdf-92ed-7d5e6dc1f6fa", + "inputs": [ + "1200f5bf-7d45-4f26-865e-b560797f1808" + ], + "input_type": "biomaterial", + "outputs": [ + "60471337-a47b-4b9c-95e7-4a19349a5e05" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "079bc155-71c9-45ab-bd12-cab025890d82" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "3aece946-4be6-4a0c-af23-ac884a87bcbb" + } + ] + }, + { + "process": "443b4672-3f14-4f1e-b7be-862ae02493dc", + "inputs": [ + "38002d8f-eac5-4ee4-8290-03d323bf780e" + ], + "input_type": "biomaterial", + "outputs": [ + "1200f5bf-7d45-4f26-865e-b560797f1808" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "6029a289-861c-4349-9614-4c244103be21" + } + ] + }, + { + "process": "738243c5-e336-4c55-a8b6-b192b6f98fe7", + "inputs": [ + "8bb4258a-90c7-4af6-8a1b-c4ab6c5483e2" + ], + "input_type": "biomaterial", + "outputs": [ + "38002d8f-eac5-4ee4-8290-03d323bf780e" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + }, + "process_0.json": { + "insdc_experiment": { + "insdc_experiment": "ERX1700368" + }, + "process_core": { + "process_id": "process_id_3526" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "aa67d2ed-e4ea-4cdf-92ed-7d5e6dc1f6fa", + "submission_date": "2018-09-05T12:13:16.786Z", + "update_date": "2018-09-05T12:26:35.419Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_12" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "443b4672-3f14-4f1e-b7be-862ae02493dc", + "submission_date": "2018-09-05T12:11:53.403Z", + "update_date": "2018-09-05T12:25:01.078Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "738243c5-e336-4c55-a8b6-b192b6f98fe7", + "submission_date": "2018-09-05T12:11:53.128Z", + "update_date": "2018-09-05T12:25:00.908Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Healthy and type 2 diabetes pancreas", + "project_title": "Single-cell RNA-seq analysis of human pancreas from healthy individuals and type 2 diabetes patients", + "project_description": "We used single-cell RNA-sequencing to generate transcriptional profiles of endocrine and exocrine cell types of the human pancreas. Pancreatic tissue and islets were obtained from six healthy and four T2D cadaveric donors. Islets were cultured and dissociated into single-cell suspension. Viable individual cells were distributed via fluorescence-activated cell sorted (FACS) into 384-well plates containing lysis buffer. Single-cell cDNA libraries were generated using the Smart-seq2 protocol. Gene expression was quantified as reads per kilobase transcript and per million mapped reads (RPKM) using rpkmforgenes. Bioinformatics analysis was used to classify cells into cell types without knowledge of cell types or prior purification of cell populations. We revealed subpopulations in endocrine and exocrine cell types, identified genes with interesting correlations to body mass index (BMI) in specific cell types and found transcriptional alterations in T2D. Complementary whole-islet RNA-seq data have also been deposited at ArrayExpress under accession number E-MTAB-5060 (http://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-5060)." + }, + "insdc_project": "ERP017126", + "array_express_investigation": "E-MTAB-5061", + "insdc_study": "PRJEB15401", + "supplementary_links": [ + "https://www.ebi.ac.uk/gxa/sc/experiments/E-MTAB-5061/Results" + ], + "contributors": [ + { + "contact_name": "Athanasia,,Palasantza", + "email": "Athanasia.Palasantza@ki.se", + "institution": "Karolinska Institutet", + "laboratory": "Department of Cell and Molecular Biology (CMB)", + "address": "Nobels vag 3, 171 77, Stockholm", + "country": "Sweden", + "corresponding_contributor": false + }, + { + "contact_name": "Rickard,,Sandberg", + "email": "Rickard.Sandberg@ki.se", + "institution": "Karolinska Institutet", + "laboratory": "Department of Cell and Molecular Biology (CMB)", + "address": "Nobels vag 3, 171 77, Stockholm", + "country": "Sweden", + "orcid_id": "0000-0001-6473-1740", + "corresponding_contributor": true + }, + { + "contact_name": "Asa,,Segerstolpe", + "email": "Asa.Segerstolpe@ki.se", + "institution": "Karolinska Institutet", + "laboratory": "Department of Cell and Molecular Biology (CMB)", + "address": "Nobels vag 3, 171 77, Stockholm", + "country": "Sweden", + "corresponding_contributor": false + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Laura,,Huerta", + "email": "lauhuema@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Molecular Atlas", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8748-599X", + "corresponding_contributor": false + } + ], + "funders": [ + { + "grant_id": "648842", + "funder_name": "European Research Council" + }, + { + "funder_name": "Swedish Research Council" + }, + { + "funder_name": "Swedish Foundation for Strategic Research" + }, + { + "funder_name": "Swedish Cancer Society" + }, + { + "funder_name": "Center for Innovative Medicine" + } + ], + "publications": [ + { + "authors": [ + "Segerstolpe A, Palasantza A, Eliasson P, Andersson EM, Andreasson AC, Sun X, Picelli S, Sabirsh A, Clausen M, Bjursell MK, Smith DM, Kasper M, Ammala C, Sandberg R" + ], + "publication_title": "Single-Cell Transcriptome Profiling of Human Pancreatic Islets in Health and Type 2 Diabetes", + "doi": "10.1016/j.cmet.2016.08.020", + "pmid": 27667667, + "publication_url": "https://europepmc.org/abstract/MED/27667667" + } + ], + "provenance": { + "document_id": "6751cc10-8cc3-452f-929c-4dcb98ee1435", + "submission_date": "2018-09-05T12:09:41.693Z", + "update_date": "2018-09-05T12:14:26.167Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "AZ_B8.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "read_length": 43, + "insdc_run": [ + "ERR1630035" + ], + "provenance": { + "document_id": "60471337-a47b-4b9c-95e7-4a19349a5e05", + "submission_date": "2018-09-05T12:10:45.476Z", + "update_date": "2018-09-05T12:27:42.525Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "SmartSeq2 single cell sequencing", + "protocol_description": "Libraries were sequenced on an Illumina HiSeq 2000, generating 43 bp single-end reads.", + "publication_doi": "10.1038/nprot.2014.006" + }, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2000", + "ontology": "EFO:0004203" + }, + "paired_end": false, + "provenance": { + "document_id": "3aece946-4be6-4a0c-af23-ac884a87bcbb", + "submission_date": "2018-09-05T12:11:53.105Z", + "update_date": "2018-09-05T12:16:50.390Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "H1_pancreas", + "biomaterial_name": "Pancreas from donor H1", + "biomaterial_description": "Pancreas from normal donor H1", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "pancreas", + "ontology": "UBERON:0001264" + }, + "organ_part": { + "text": "islet of Langerhans", + "ontology": "UBERON:0000006" + }, + "purchased_specimen": { + "manufacturer": "Prodo Laboratories Inc (Irvine, CA, USA) " + }, + "provenance": { + "document_id": "38002d8f-eac5-4ee4-8290-03d323bf780e", + "submission_date": "2018-09-05T12:09:41.800Z", + "update_date": "2018-09-05T12:14:29.994Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index 49f7df9e8..000000000 --- a/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,158 +0,0 @@ -[ - { - "crc32c": "5BD8FC51", - "sha1": "fc41223e6bd3fd884ab40a98a051c7acf41d7243", - "sha256": "1710870a83869afc2ede83706c3911c01f753b5bfff3220ed81c1394553cbc79", - "s3_etag": "e8ec2d0ca57ae4738c49aea2094bb8f6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 913, - "uuid": "732ab422-b36b-4f0e-9f91-f1b0cf984984", - "version": "1" - }, - { - "crc32c": "EBFCF474", - "sha1": "1d6e39c56493feab7b874e3b92dc79b6fe347d0b", - "sha256": "9f8840c0716fce194924ce86613a87fe94ba2e89f9cc8112786fb1f37f99c940", - "s3_etag": "06b8af8307f3a7da5dadcf6e60ef0380", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 857, - "uuid": "13266f29-920b-445c-91fa-fd683831c87a", - "version": "1" - }, - { - "crc32c": "B4634BFF", - "sha1": "3cde5b765f3f5a18e9902572b13883676c2e8721", - "sha256": "db90e6c5140f031c52299c9dd66a7310a194160cde2cb3ef7f0f01de77106d79", - "s3_etag": "ba39caa20ae934bb5703097970591e80", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1177, - "uuid": "a4d6229e-b564-4d51-85ca-ed7353910268", - "version": "1" - }, - { - "crc32c": "D596AA61", - "sha1": "7bb8a706cf1f1300fcf2788cee6fb1216e4099ba", - "sha256": "6b01f8c51ee2a50dc97772b52f3a7b1149af522011c8fa44c721413c8875b353", - "s3_etag": "054953ebfa89ff7e73e7a5e03975670b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1268, - "uuid": "3b8ffd02-7a9e-44ff-bec5-1387b87b0e34", - "version": "1" - }, - { - "crc32c": "5AE674D4", - "sha1": "a2c43b27d4cdcd769ea9aa5fb6dc38d144a19448", - "sha256": "5444d86b7f7dde2c7521dde5821b12d04cd544ecae07464b45ee75ad98c9becc", - "s3_etag": "f2fb4a3a21e54e7b6455fcd9fac1e1b1", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 1856, - "uuid": "d6284ed3-ff4c-4153-90b5-a3f5fb10c799", - "version": "1" - }, - { - "crc32c": "22B1F2B5", - "sha1": "24335fec0fbe49e182b9a25d9953a7ef34f797fa", - "sha256": "8385d1134079775e2d1d857ff66db53261a8c62fbaa7ca77c1310798aa29dcc7", - "s3_etag": "aceae67e53b5d93f880e30d0197164d2", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 461, - "uuid": "79e7bb26-099f-4d9e-8711-514f1383d752", - "version": "1" - }, - { - "crc32c": "EF616C2D", - "sha1": "7985dc3035527ab48dacb101a24fb065c65e13e9", - "sha256": "98693f433c34cf3219e0403a61dad368a6fa51e91354d9486cce241084b024c6", - "s3_etag": "114d1c662aa7ddd4aaeadaab810d4083", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 385, - "uuid": "93da3ebd-5b95-4894-8b01-a6aa5cd06fa9", - "version": "1" - }, - { - "crc32c": "9F23B91E", - "sha1": "51fb89bfa1af7881b8be47e98618d22f3492ce05", - "sha256": "9e3e23702ad9dc24cbd7aeb38e52bbe57fa95b155804e8b884398c4918f88f27", - "s3_etag": "8e494c3a285b0de594b8ab0e5bec9c6c", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 384, - "uuid": "c0323842-4443-4298-8036-adba33c77a30", - "version": "1" - }, - { - "crc32c": "A02C699B", - "sha1": "01074ce8f1d3edbe942659731663c7e12d0128cf", - "sha256": "ff9a4518c41f837b295a3beb44f2ad1bd0bb1a47cb3ddd92bb1edb192320239c", - "s3_etag": "322aeb89c995b0657e33b085b8b1f7aa", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 5090, - "uuid": "372f77fe-9a81-483c-8d13-4e2d059bfda6", - "version": "1" - }, - { - "crc32c": "3D02CDD9", - "sha1": "b2dad8a028624c456ba43f1f97ac20bba430af74", - "sha256": "730386f5383a1c82f114ba6cc9ff381f2c47872d6edc4f1342b0b9df9a282795", - "s3_etag": "5a43cfafe8d19b34b73ec4561653e517", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 514, - "uuid": "e6f7823c-73c2-4484-b3b8-07aad4008dc1", - "version": "1" - }, - { - "crc32c": "3D02CDD9", - "sha1": "b2dad8a028624c456ba43f1f97ac20bba430af74", - "sha256": "730386f5383a1c82f114ba6cc9ff381f2c47872d6edc4f1342b0b9df9a282795", - "s3_etag": "5a43cfafe8d19b34b73ec4561653e517", - "content-type": "application/octet-stream", - "indexed": false, - "name": "AZ_B8.fastq.gz", - "size": 514, - "uuid": "32d60a94-9f0f-44e3-83c6-eb2d1c1177bd", - "version": "1" - }, - { - "crc32c": "D1ED7790", - "sha1": "b6347439cabfd949d62ea9bd4583668e4dae9ae3", - "sha256": "8b07de467f9656adfa2c17403be4969329592833e2582acd6e7b90764bad3c94", - "s3_etag": "71de6f17e7bd1a32cf38026269c9c548", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 928, - "uuid": "06e8f95d-bdfb-4b72-84e9-160eab21e059", - "version": "1" - }, - { - "crc32c": "DAA2F138", - "sha1": "299ee695490d80e71963e51190f95808b79e0042", - "sha256": "6d5703145464fd2a53adcc79c2c3339dfec0e04cf1a463c078678ada7f79f374", - "s3_etag": "9b8fb5f7d54ef2b22a14abdaef88a677", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 1011, - "uuid": "888e84a3-26e0-4f46-983d-91014e7c60a3", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index 50470a2e5..000000000 --- a/test/hca_metadata_api/cans/examples/Healthy and type 2 diabetes pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,403 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "AZ_B8", - "biomaterial_name": "AZ_B8 cell", - "biomaterial_description": "AZ_B8 cell", - "ncbi_taxon_id": [ - 9606 - ], - "insdc_biomaterial": "ERS1348492", - "biosd_biomaterial": "SAMEA4437043" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "total_estimated_cells": 1, - "plate_based_sequencing": { - "plate_id": "AZ", - "well_id": "B8", - "cell_quality": "OK" - }, - "provenance": { - "document_id": "1200f5bf-7d45-4f26-865e-b560797f1808", - "submission_date": "2018-09-05T12:09:41.946Z", - "update_date": "2018-09-05T12:21:55.818Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "Single cell dissociation", - "protocol_description": "Islets were dissociated into single-cell suspension and viable individual cells were distributed by FACS into 384-well plates containing lysis buffer.", - "publication_doi": "10.1016/j.cmet.2016.08.020" - }, - "dissociation_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "provenance": { - "document_id": "6029a289-861c-4349-9614-4c244103be21", - "submission_date": "2018-09-05T12:11:53.063Z", - "update_date": "2018-09-05T12:17:49.721Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "H1", - "biomaterial_name": "Normal Donor 1", - "biomaterial_description": "Normal Donor 1", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "is_living": "no", - "sex": "male", - "medical_history": { - "test_results": "HbA1c 5.0%" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272" - }, - "organism_age": "43", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "human_specific": { - "body_mass_index": 30.8 - }, - "provenance": { - "document_id": "8bb4258a-90c7-4af6-8a1b-c4ab6c5483e2", - "submission_date": "2018-09-05T12:09:41.702Z", - "update_date": "2018-09-05T12:14:26.204Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Library preparation for sequencing", - "protocol_description": "Single-cell RNA-seq libraries were generated as described in Picelli et al., 2014, Full-length RNA-seq from single cells using Smart-seq2, Nature Protocols.", - "publication_doi": "10.1038/nprot.2014.006" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "nucleic_acid_source": "single cell", - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "spike_in_dilution": 40000, - "spike_in_kit": { - "retail_name": "External RNA Controls Consortium (ERCC)", - "manufacturer": "Ambion, Life Technologies" - }, - "provenance": { - "document_id": "079bc155-71c9-45ab-bd12-cab025890d82", - "submission_date": "2018-09-05T12:11:53.080Z", - "update_date": "2018-09-05T12:17:48.051Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "aa67d2ed-e4ea-4cdf-92ed-7d5e6dc1f6fa", - "inputs": [ - "1200f5bf-7d45-4f26-865e-b560797f1808" - ], - "input_type": "biomaterial", - "outputs": [ - "60471337-a47b-4b9c-95e7-4a19349a5e05" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "079bc155-71c9-45ab-bd12-cab025890d82" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "3aece946-4be6-4a0c-af23-ac884a87bcbb" - } - ] - }, - { - "process": "443b4672-3f14-4f1e-b7be-862ae02493dc", - "inputs": [ - "38002d8f-eac5-4ee4-8290-03d323bf780e" - ], - "input_type": "biomaterial", - "outputs": [ - "1200f5bf-7d45-4f26-865e-b560797f1808" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "6029a289-861c-4349-9614-4c244103be21" - } - ] - }, - { - "process": "738243c5-e336-4c55-a8b6-b192b6f98fe7", - "inputs": [ - "8bb4258a-90c7-4af6-8a1b-c4ab6c5483e2" - ], - "input_type": "biomaterial", - "outputs": [ - "38002d8f-eac5-4ee4-8290-03d323bf780e" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - }, - "process_0.json": { - "insdc_experiment": { - "insdc_experiment": "ERX1700368" - }, - "process_core": { - "process_id": "process_id_3526" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "aa67d2ed-e4ea-4cdf-92ed-7d5e6dc1f6fa", - "submission_date": "2018-09-05T12:13:16.786Z", - "update_date": "2018-09-05T12:26:35.419Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_12" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "443b4672-3f14-4f1e-b7be-862ae02493dc", - "submission_date": "2018-09-05T12:11:53.403Z", - "update_date": "2018-09-05T12:25:01.078Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "738243c5-e336-4c55-a8b6-b192b6f98fe7", - "submission_date": "2018-09-05T12:11:53.128Z", - "update_date": "2018-09-05T12:25:00.908Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Healthy and type 2 diabetes pancreas", - "project_title": "Single-cell RNA-seq analysis of human pancreas from healthy individuals and type 2 diabetes patients", - "project_description": "We used single-cell RNA-sequencing to generate transcriptional profiles of endocrine and exocrine cell types of the human pancreas. Pancreatic tissue and islets were obtained from six healthy and four T2D cadaveric donors. Islets were cultured and dissociated into single-cell suspension. Viable individual cells were distributed via fluorescence-activated cell sorted (FACS) into 384-well plates containing lysis buffer. Single-cell cDNA libraries were generated using the Smart-seq2 protocol. Gene expression was quantified as reads per kilobase transcript and per million mapped reads (RPKM) using rpkmforgenes. Bioinformatics analysis was used to classify cells into cell types without knowledge of cell types or prior purification of cell populations. We revealed subpopulations in endocrine and exocrine cell types, identified genes with interesting correlations to body mass index (BMI) in specific cell types and found transcriptional alterations in T2D. Complementary whole-islet RNA-seq data have also been deposited at ArrayExpress under accession number E-MTAB-5060 (http://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-5060)." - }, - "insdc_project": "ERP017126", - "array_express_investigation": "E-MTAB-5061", - "insdc_study": "PRJEB15401", - "supplementary_links": [ - "https://www.ebi.ac.uk/gxa/sc/experiments/E-MTAB-5061/Results" - ], - "contributors": [ - { - "contact_name": "Athanasia,,Palasantza", - "email": "Athanasia.Palasantza@ki.se", - "institution": "Karolinska Institutet", - "laboratory": "Department of Cell and Molecular Biology (CMB)", - "address": "Nobels vag 3, 171 77, Stockholm", - "country": "Sweden", - "corresponding_contributor": false - }, - { - "contact_name": "Rickard,,Sandberg", - "email": "Rickard.Sandberg@ki.se", - "institution": "Karolinska Institutet", - "laboratory": "Department of Cell and Molecular Biology (CMB)", - "address": "Nobels vag 3, 171 77, Stockholm", - "country": "Sweden", - "orcid_id": "0000-0001-6473-1740", - "corresponding_contributor": true - }, - { - "contact_name": "Asa,,Segerstolpe", - "email": "Asa.Segerstolpe@ki.se", - "institution": "Karolinska Institutet", - "laboratory": "Department of Cell and Molecular Biology (CMB)", - "address": "Nobels vag 3, 171 77, Stockholm", - "country": "Sweden", - "corresponding_contributor": false - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Laura,,Huerta", - "email": "lauhuema@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Molecular Atlas", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8748-599X", - "corresponding_contributor": false - } - ], - "funders": [ - { - "grant_id": "648842", - "funder_name": "European Research Council" - }, - { - "funder_name": "Swedish Research Council" - }, - { - "funder_name": "Swedish Foundation for Strategic Research" - }, - { - "funder_name": "Swedish Cancer Society" - }, - { - "funder_name": "Center for Innovative Medicine" - } - ], - "publications": [ - { - "authors": [ - "Segerstolpe A, Palasantza A, Eliasson P, Andersson EM, Andreasson AC, Sun X, Picelli S, Sabirsh A, Clausen M, Bjursell MK, Smith DM, Kasper M, Ammala C, Sandberg R" - ], - "publication_title": "Single-Cell Transcriptome Profiling of Human Pancreatic Islets in Health and Type 2 Diabetes", - "doi": "10.1016/j.cmet.2016.08.020", - "pmid": 27667667, - "publication_url": "https://europepmc.org/abstract/MED/27667667" - } - ], - "provenance": { - "document_id": "6751cc10-8cc3-452f-929c-4dcb98ee1435", - "submission_date": "2018-09-05T12:09:41.693Z", - "update_date": "2018-09-05T12:14:26.167Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "AZ_B8.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "read_length": 43, - "insdc_run": [ - "ERR1630035" - ], - "provenance": { - "document_id": "60471337-a47b-4b9c-95e7-4a19349a5e05", - "submission_date": "2018-09-05T12:10:45.476Z", - "update_date": "2018-09-05T12:27:42.525Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "SmartSeq2 single cell sequencing", - "protocol_description": "Libraries were sequenced on an Illumina HiSeq 2000, generating 43 bp single-end reads.", - "publication_doi": "10.1038/nprot.2014.006" - }, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2000", - "ontology": "EFO:0004203" - }, - "paired_end": false, - "provenance": { - "document_id": "3aece946-4be6-4a0c-af23-ac884a87bcbb", - "submission_date": "2018-09-05T12:11:53.105Z", - "update_date": "2018-09-05T12:16:50.390Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "H1_pancreas", - "biomaterial_name": "Pancreas from donor H1", - "biomaterial_description": "Pancreas from normal donor H1", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "pancreas", - "ontology": "UBERON:0001264" - }, - "organ_part": { - "text": "islet of Langerhans", - "ontology": "UBERON:0000006" - }, - "purchased_specimen": { - "manufacturer": "Prodo Laboratories Inc (Irvine, CA, USA) " - }, - "provenance": { - "document_id": "38002d8f-eac5-4ee4-8290-03d323bf780e", - "submission_date": "2018-09-05T12:09:41.800Z", - "update_date": "2018-09-05T12:14:29.994Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..5c0f7246f --- /dev/null +++ b/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,592 @@ +{ + "manifest": [ + { + "crc32c": "EDCBEB27", + "sha1": "ec22573ee712d628ae8c89a857d46c36647d3840", + "sha256": "506ad9058ab7fd6cf9dfacd45f889df49db48c04f83a513c8c15c9ba64c48e94", + "s3_etag": "0476f6b3f19520e728aa2081b03cab12", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 902, + "uuid": "2636529a-872c-4174-a80f-7ecffb4de952", + "version": "1" + }, + { + "crc32c": "ABC55204", + "sha1": "c217b4f309d6b37729a62e7d98d73e33d3077335", + "sha256": "02426b5f54d0e45cb4447d89f4ef165b0f7e460988ce1673a9c837651a1d18ac", + "s3_etag": "4ec906c1695ed9f4eabe1e875d88bfb4", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 670, + "uuid": "750baef6-9002-4527-a02c-526481add5dd", + "version": "1" + }, + { + "crc32c": "49AE85BF", + "sha1": "7ad67e453f587655279f517b97005355bbd66b9d", + "sha256": "a2a0c0c40fe719159bbe601e32a7d42b989ee4e089fa16522eb1a7a11600f942", + "s3_etag": "3eb89d853ba573bb07be5315b473b128", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1091, + "uuid": "b00f7267-df68-436f-9685-22c70bc7b696", + "version": "1" + }, + { + "crc32c": "32DCAEB5", + "sha1": "fb882d8ebe742218cd6518de4d14f01c003ecb5f", + "sha256": "bf7d32a17524fe6b39d3fa0ce20e3dde60d924969584ce34468d91336509fb2a", + "s3_etag": "4f58ab031046dd2ac275be32ea6e3d27", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "enrichment_protocol_0.json", + "size": 648, + "uuid": "a9a602bc-9333-43d5-897b-d41990b71d6c", + "version": "1" + }, + { + "crc32c": "2A2EC061", + "sha1": "2c43e14635561183eb66e78203cb2c8e5c92d677", + "sha256": "43c7b46d601ee72a5bb7fe1209e0f0bb73a148b47a180baa8305a66ae139c0e4", + "s3_etag": "0dd4bf7138b09d6b022d371d120fc832", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1007, + "uuid": "6aa1f675-a3be-4def-8da9-259ae0fcad68", + "version": "1" + }, + { + "crc32c": "837B6FBF", + "sha1": "4534daa77cd865f34273f6c8a8d0fd3a96361bfe", + "sha256": "26c92efa3719bda131663c452d7b385925d927eb5a49f6b2e5ebb1497e871c64", + "s3_etag": "dc518a7c1b8faea79320eb70e7c239e6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 2027, + "uuid": "447bd719-baa7-4f32-b4d6-7f64fabfe0f1", + "version": "1" + }, + { + "crc32c": "93A97712", + "sha1": "4365e3dbeeff6b4c23c9057e5b30aab65807a405", + "sha256": "76a820bd3394b584bcade1e9df17186a70c59209b0a619a961787256df3c1c5a", + "s3_etag": "3dd4706a9ce80f48ebf104dbcb22553b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 385, + "uuid": "7581cfb0-451c-4195-bb36-5ce58ed6223e", + "version": "1" + }, + { + "crc32c": "C8D228A7", + "sha1": "1c77aaa35d5842a646a2ba9ad0e82232307904f9", + "sha256": "ebf4e7548055b87b08f0e9dbf5e13daf9f68a8cd620307b2585a9db5febcd9a5", + "s3_etag": "8a1c4eb986c7a5925707f277749487da", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 385, + "uuid": "727d6781-e2f9-4d25-8d0c-a15ded22fc9f", + "version": "1" + }, + { + "crc32c": "B9B52E6E", + "sha1": "8d3495379c8129cb8b63ac1f0f33ed1dbd3b9350", + "sha256": "e04abc919d273813ee4683a8b2eb2bf38c35a8d8ef94cd769f27ef2b338c289f", + "s3_etag": "101e15f250256383f372e0521f7f8811", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 387, + "uuid": "5f2b2436-79f5-45e5-924c-1dd32913fa7c", + "version": "1" + }, + { + "crc32c": "8AE5B1CE", + "sha1": "428e162c3e91a40969e6f1203b0953fdd35081bd", + "sha256": "32447dcab09028095487dc989382166e01bf317e306d5c564f7df86de9b931ee", + "s3_etag": "6ce3187b8ddfc9c7d4ae285acaa777ef", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 5128, + "uuid": "f4ad3ffa-4fb9-4a5e-9657-d8358234570f", + "version": "1" + }, + { + "crc32c": "4AEB011B", + "sha1": "7d5358d6a69ffc7e92ae1bae5e4ae6b9467bc8c5", + "sha256": "d184ee1517a86acdf92d35e911db3effef0630ab40ef062b094d456d4e6084e1", + "s3_etag": "21f3e54a46262a9b85b10b48040ff303", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 472, + "uuid": "5d5d99b1-ff9a-4c32-a33a-c71bb503ff51", + "version": "1" + }, + { + "crc32c": "4AEB011B", + "sha1": "7d5358d6a69ffc7e92ae1bae5e4ae6b9467bc8c5", + "sha256": "d184ee1517a86acdf92d35e911db3effef0630ab40ef062b094d456d4e6084e1", + "s3_etag": "21f3e54a46262a9b85b10b48040ff303", + "content-type": "application/octet-stream", + "indexed": false, + "name": "21784_6#10_1.fastq.gz", + "size": 472, + "uuid": "b2b4819a-e22d-4ed4-a5c8-c04a1dec79eb", + "version": "1" + }, + { + "crc32c": "15D82AE8", + "sha1": "acd7c08cab2cd683066e43dd021779dccf55add3", + "sha256": "7b0e83bc0ac1a8ce44951295e511db4c32a9d3cd95b7409c128a58e30bdcfd7c", + "s3_etag": "26223cdfe004c576d099c6bd6339cee3", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 726, + "uuid": "1de30fbd-ba45-4ad5-9680-6ae5c155b971", + "version": "1" + }, + { + "crc32c": "600533E8", + "sha1": "54cd7297973e55ff746ba4fa0ef2e891a1b3c23a", + "sha256": "caeb36623613ff7b47de9735d009b2352d2dcda62408313fbfcce66b75122a93", + "s3_etag": "94d2fa6136032ca63a8b1291853da5db", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 734, + "uuid": "2d1d1d4e-4ef7-4c51-aad5-f1f388f706f6", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "21784_6#10", + "ncbi_taxon_id": [ + 10090 + ], + "supplementary_files": [ + "FACS_sorting_markers.pdf" + ] + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "selected_cell_type": [ + { + "text": "CD11b+ Macrophages/monocytes" + } + ], + "total_estimated_cells": 1, + "plate_based_sequencing": { + "plate_id": "607", + "well_id": "A05" + }, + "provenance": { + "document_id": "1446ca36-ba75-45ea-b6ab-a80641a88812", + "submission_date": "2018-09-04T12:44:38.405Z", + "update_date": "2018-09-04T13:12:52.699Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "tissue_dissociation_protocol", + "protocol_name": "Extracting cells from lymph nodes", + "document": "TissueDissociationProtocol.pdf" + }, + "dissociation_method": { + "text": "mechanical dissociation", + "ontology": "EFO:0009129" + }, + "provenance": { + "document_id": "7142ed25-3237-4156-b10d-0aa74b2c37b3", + "submission_date": "2018-09-04T12:53:50.982Z", + "update_date": "2018-09-04T12:58:01.497Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1131", + "biomaterial_name": "Mouse_day8_rep10", + "ncbi_taxon_id": [ + 10090 + ] + }, + "mouse_specific": { + "strain": [ + { + "text": "C57BL/6", + "ontology": "EFO:0004472" + } + ] + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "organism_age": "6-12", + "organism_age_unit": { + "text": "week", + "ontology": "UO:0000034" + }, + "diseases": [ + { + "text": "subcutaneous melanoma", + "ontology": "MONDO:0005105" + } + ], + "is_living": "no", + "sex": "female", + "provenance": { + "document_id": "b56697f5-d350-4e1d-93b2-72eee68c972e", + "submission_date": "2018-09-04T12:44:37.445Z", + "update_date": "2018-09-04T13:08:09.637Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "FACS3", + "protocol_name": "FACS sorting cells by surface markers" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "markers": "CD45+ CD3e- B220- CD11b+", + "provenance": { + "document_id": "4a19c599-e429-4eda-9644-3a46c1202c7f", + "submission_date": "2018-09-04T12:53:51.016Z", + "update_date": "2018-09-04T12:57:51.962Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "SmartSeq2_RTPCR_protocol", + "protocol_name": "Make/amplify cDNA for each cell", + "document": "SmartSeq2_RTPCR_protocol.pdf" + }, + "nucleic_acid_source": "single cell", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "provenance": { + "document_id": "38e07040-6198-4a46-b195-88c0680ef283", + "submission_date": "2018-09-04T12:53:51.109Z", + "update_date": "2018-09-04T12:55:56.069Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "e9c888db-256a-4c78-af5d-2977fa6bc22c", + "inputs": [ + "1446ca36-ba75-45ea-b6ab-a80641a88812" + ], + "input_type": "biomaterial", + "outputs": [ + "b93897c4-0681-407a-bc0c-fb791b919fa4" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "38e07040-6198-4a46-b195-88c0680ef283" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "2c530a47-d87a-4d50-bfb9-74d15fdb1fd9" + } + ] + }, + { + "process": "3c85210e-6554-450c-88fb-c5d5035cf134", + "inputs": [ + "6dc01fb6-6aba-432e-828e-ae3045914f34" + ], + "input_type": "biomaterial", + "outputs": [ + "1446ca36-ba75-45ea-b6ab-a80641a88812" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "7142ed25-3237-4156-b10d-0aa74b2c37b3" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "4a19c599-e429-4eda-9644-3a46c1202c7f" + } + ] + }, + { + "process": "ab9f0b8f-3195-4ccd-8bdf-52d91a2c9029", + "inputs": [ + "b56697f5-d350-4e1d-93b2-72eee68c972e" + ], + "input_type": "biomaterial", + "outputs": [ + "6dc01fb6-6aba-432e-828e-ae3045914f34" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + }, + "process_0.json": { + "process_core": { + "process_id": "process_id_55" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "3c85210e-6554-450c-88fb-c5d5035cf134", + "submission_date": "2018-09-04T12:53:53.002Z", + "update_date": "2018-09-04T13:23:54.508Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_28" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "ab9f0b8f-3195-4ccd-8bdf-52d91a2c9029", + "submission_date": "2018-09-04T12:53:52.144Z", + "update_date": "2018-09-04T13:23:54.228Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_6694" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "e9c888db-256a-4c78-af5d-2977fa6bc22c", + "submission_date": "2018-09-04T12:59:17.940Z", + "update_date": "2018-09-04T13:27:57.677Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Mouse Melanoma", + "project_title": "Melanoma infiltration of stromal and immune cells", + "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications." + }, + "contributors": [ + { + "contact_name": "Sarah,A,Teichmann", + "email": "st9@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Mirjana,,Efremova", + "email": "me5@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Bidesh,,Mahata", + "email": "bm11@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Jacqueline,D,Shields", + "email": "JS970@MRCCU.cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "MRC Cancer Unit", + "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", + "country": "UK" + }, + { + "contact_name": "Sarah,,Davidson", + "email": "SED49@MRCCU.cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "MRC Cancer Unit", + "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", + "country": "UK" + }, + { + "contact_name": "Angela,,Riedel", + "email": "a.riedel@dkfz-heidelberg.de", + "institution": "DKFZ German Cancer Research Center", + "country": "Germany" + }, + { + "contact_name": "Roser,,Vento-Tormo", + "email": "rv4@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Jhuma,,Pramanik", + "email": "jp19@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Gozde,,Kar", + "email": "gkar@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Sarah Teichmann", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK" + }, + { + "contact_name": "Jani,,Huuhtanen", + "email": "jani.huuhtanen@helsinki.fi", + "institution": "University of Helsinki", + "country": "Finland" + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Danielle,,Welter", + "email": "dwelter@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-1058-2668", + "corresponding_contributor": false + } + ], + "provenance": { + "document_id": "092574d1-a391-4c09-a0c4-d06104a503f6", + "submission_date": "2018-09-04T12:44:36.854Z", + "update_date": "2018-09-04T13:08:08.264Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "21784_6#10_1.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "lane_index": 6, + "provenance": { + "document_id": "b93897c4-0681-407a-bc0c-fb791b919fa4", + "submission_date": "2018-09-04T12:47:44.261Z", + "update_date": "2018-09-04T13:20:33.745Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "SmartSeq2_sequencing_protocol", + "protocol_name": "Sequencing SmartSeq2 cells" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008567" + }, + "paired_end": true, + "sequencing_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "provenance": { + "document_id": "2c530a47-d87a-4d50-bfb9-74d15fdb1fd9", + "submission_date": "2018-09-04T12:53:51.118Z", + "update_date": "2018-09-04T12:57:59.862Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1131_LN", + "biomaterial_name": "Mouse_day8_LN_rep10", + "ncbi_taxon_id": [ + 10090 + ] + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "organ": { + "text": "lymph node", + "ontology": "UBERON:0000029" + }, + "provenance": { + "document_id": "6dc01fb6-6aba-432e-828e-ae3045914f34", + "submission_date": "2018-09-04T12:44:38.074Z", + "update_date": "2018-09-04T13:10:12.581Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index b52254881..000000000 --- a/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,170 +0,0 @@ -[ - { - "crc32c": "EDCBEB27", - "sha1": "ec22573ee712d628ae8c89a857d46c36647d3840", - "sha256": "506ad9058ab7fd6cf9dfacd45f889df49db48c04f83a513c8c15c9ba64c48e94", - "s3_etag": "0476f6b3f19520e728aa2081b03cab12", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 902, - "uuid": "2636529a-872c-4174-a80f-7ecffb4de952", - "version": "1" - }, - { - "crc32c": "ABC55204", - "sha1": "c217b4f309d6b37729a62e7d98d73e33d3077335", - "sha256": "02426b5f54d0e45cb4447d89f4ef165b0f7e460988ce1673a9c837651a1d18ac", - "s3_etag": "4ec906c1695ed9f4eabe1e875d88bfb4", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 670, - "uuid": "750baef6-9002-4527-a02c-526481add5dd", - "version": "1" - }, - { - "crc32c": "49AE85BF", - "sha1": "7ad67e453f587655279f517b97005355bbd66b9d", - "sha256": "a2a0c0c40fe719159bbe601e32a7d42b989ee4e089fa16522eb1a7a11600f942", - "s3_etag": "3eb89d853ba573bb07be5315b473b128", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1091, - "uuid": "b00f7267-df68-436f-9685-22c70bc7b696", - "version": "1" - }, - { - "crc32c": "32DCAEB5", - "sha1": "fb882d8ebe742218cd6518de4d14f01c003ecb5f", - "sha256": "bf7d32a17524fe6b39d3fa0ce20e3dde60d924969584ce34468d91336509fb2a", - "s3_etag": "4f58ab031046dd2ac275be32ea6e3d27", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "enrichment_protocol_0.json", - "size": 648, - "uuid": "a9a602bc-9333-43d5-897b-d41990b71d6c", - "version": "1" - }, - { - "crc32c": "2A2EC061", - "sha1": "2c43e14635561183eb66e78203cb2c8e5c92d677", - "sha256": "43c7b46d601ee72a5bb7fe1209e0f0bb73a148b47a180baa8305a66ae139c0e4", - "s3_etag": "0dd4bf7138b09d6b022d371d120fc832", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1007, - "uuid": "6aa1f675-a3be-4def-8da9-259ae0fcad68", - "version": "1" - }, - { - "crc32c": "837B6FBF", - "sha1": "4534daa77cd865f34273f6c8a8d0fd3a96361bfe", - "sha256": "26c92efa3719bda131663c452d7b385925d927eb5a49f6b2e5ebb1497e871c64", - "s3_etag": "dc518a7c1b8faea79320eb70e7c239e6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 2027, - "uuid": "447bd719-baa7-4f32-b4d6-7f64fabfe0f1", - "version": "1" - }, - { - "crc32c": "93A97712", - "sha1": "4365e3dbeeff6b4c23c9057e5b30aab65807a405", - "sha256": "76a820bd3394b584bcade1e9df17186a70c59209b0a619a961787256df3c1c5a", - "s3_etag": "3dd4706a9ce80f48ebf104dbcb22553b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 385, - "uuid": "7581cfb0-451c-4195-bb36-5ce58ed6223e", - "version": "1" - }, - { - "crc32c": "C8D228A7", - "sha1": "1c77aaa35d5842a646a2ba9ad0e82232307904f9", - "sha256": "ebf4e7548055b87b08f0e9dbf5e13daf9f68a8cd620307b2585a9db5febcd9a5", - "s3_etag": "8a1c4eb986c7a5925707f277749487da", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 385, - "uuid": "727d6781-e2f9-4d25-8d0c-a15ded22fc9f", - "version": "1" - }, - { - "crc32c": "B9B52E6E", - "sha1": "8d3495379c8129cb8b63ac1f0f33ed1dbd3b9350", - "sha256": "e04abc919d273813ee4683a8b2eb2bf38c35a8d8ef94cd769f27ef2b338c289f", - "s3_etag": "101e15f250256383f372e0521f7f8811", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 387, - "uuid": "5f2b2436-79f5-45e5-924c-1dd32913fa7c", - "version": "1" - }, - { - "crc32c": "8AE5B1CE", - "sha1": "428e162c3e91a40969e6f1203b0953fdd35081bd", - "sha256": "32447dcab09028095487dc989382166e01bf317e306d5c564f7df86de9b931ee", - "s3_etag": "6ce3187b8ddfc9c7d4ae285acaa777ef", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 5128, - "uuid": "f4ad3ffa-4fb9-4a5e-9657-d8358234570f", - "version": "1" - }, - { - "crc32c": "4AEB011B", - "sha1": "7d5358d6a69ffc7e92ae1bae5e4ae6b9467bc8c5", - "sha256": "d184ee1517a86acdf92d35e911db3effef0630ab40ef062b094d456d4e6084e1", - "s3_etag": "21f3e54a46262a9b85b10b48040ff303", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 472, - "uuid": "5d5d99b1-ff9a-4c32-a33a-c71bb503ff51", - "version": "1" - }, - { - "crc32c": "4AEB011B", - "sha1": "7d5358d6a69ffc7e92ae1bae5e4ae6b9467bc8c5", - "sha256": "d184ee1517a86acdf92d35e911db3effef0630ab40ef062b094d456d4e6084e1", - "s3_etag": "21f3e54a46262a9b85b10b48040ff303", - "content-type": "application/octet-stream", - "indexed": false, - "name": "21784_6#10_1.fastq.gz", - "size": 472, - "uuid": "b2b4819a-e22d-4ed4-a5c8-c04a1dec79eb", - "version": "1" - }, - { - "crc32c": "15D82AE8", - "sha1": "acd7c08cab2cd683066e43dd021779dccf55add3", - "sha256": "7b0e83bc0ac1a8ce44951295e511db4c32a9d3cd95b7409c128a58e30bdcfd7c", - "s3_etag": "26223cdfe004c576d099c6bd6339cee3", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 726, - "uuid": "1de30fbd-ba45-4ad5-9680-6ae5c155b971", - "version": "1" - }, - { - "crc32c": "600533E8", - "sha1": "54cd7297973e55ff746ba4fa0ef2e891a1b3c23a", - "sha256": "caeb36623613ff7b47de9735d009b2352d2dcda62408313fbfcce66b75122a93", - "s3_etag": "94d2fa6136032ca63a8b1291853da5db", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 734, - "uuid": "2d1d1d4e-4ef7-4c51-aad5-f1f388f706f6", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index 2f6cd47a8..000000000 --- a/test/hca_metadata_api/cans/examples/Mouse Melanoma/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,420 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "21784_6#10", - "ncbi_taxon_id": [ - 10090 - ], - "supplementary_files": [ - "FACS_sorting_markers.pdf" - ] - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "selected_cell_type": [ - { - "text": "CD11b+ Macrophages/monocytes" - } - ], - "total_estimated_cells": 1, - "plate_based_sequencing": { - "plate_id": "607", - "well_id": "A05" - }, - "provenance": { - "document_id": "1446ca36-ba75-45ea-b6ab-a80641a88812", - "submission_date": "2018-09-04T12:44:38.405Z", - "update_date": "2018-09-04T13:12:52.699Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "tissue_dissociation_protocol", - "protocol_name": "Extracting cells from lymph nodes", - "document": "TissueDissociationProtocol.pdf" - }, - "dissociation_method": { - "text": "mechanical dissociation", - "ontology": "EFO:0009129" - }, - "provenance": { - "document_id": "7142ed25-3237-4156-b10d-0aa74b2c37b3", - "submission_date": "2018-09-04T12:53:50.982Z", - "update_date": "2018-09-04T12:58:01.497Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1131", - "biomaterial_name": "Mouse_day8_rep10", - "ncbi_taxon_id": [ - 10090 - ] - }, - "mouse_specific": { - "strain": [ - { - "text": "C57BL/6", - "ontology": "EFO:0004472" - } - ] - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "organism_age": "6-12", - "organism_age_unit": { - "text": "week", - "ontology": "UO:0000034" - }, - "diseases": [ - { - "text": "subcutaneous melanoma", - "ontology": "MONDO:0005105" - } - ], - "is_living": "no", - "sex": "female", - "provenance": { - "document_id": "b56697f5-d350-4e1d-93b2-72eee68c972e", - "submission_date": "2018-09-04T12:44:37.445Z", - "update_date": "2018-09-04T13:08:09.637Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "FACS3", - "protocol_name": "FACS sorting cells by surface markers" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "markers": "CD45+ CD3e- B220- CD11b+", - "provenance": { - "document_id": "4a19c599-e429-4eda-9644-3a46c1202c7f", - "submission_date": "2018-09-04T12:53:51.016Z", - "update_date": "2018-09-04T12:57:51.962Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "SmartSeq2_RTPCR_protocol", - "protocol_name": "Make/amplify cDNA for each cell", - "document": "SmartSeq2_RTPCR_protocol.pdf" - }, - "nucleic_acid_source": "single cell", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "provenance": { - "document_id": "38e07040-6198-4a46-b195-88c0680ef283", - "submission_date": "2018-09-04T12:53:51.109Z", - "update_date": "2018-09-04T12:55:56.069Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "e9c888db-256a-4c78-af5d-2977fa6bc22c", - "inputs": [ - "1446ca36-ba75-45ea-b6ab-a80641a88812" - ], - "input_type": "biomaterial", - "outputs": [ - "b93897c4-0681-407a-bc0c-fb791b919fa4" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "38e07040-6198-4a46-b195-88c0680ef283" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "2c530a47-d87a-4d50-bfb9-74d15fdb1fd9" - } - ] - }, - { - "process": "3c85210e-6554-450c-88fb-c5d5035cf134", - "inputs": [ - "6dc01fb6-6aba-432e-828e-ae3045914f34" - ], - "input_type": "biomaterial", - "outputs": [ - "1446ca36-ba75-45ea-b6ab-a80641a88812" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "7142ed25-3237-4156-b10d-0aa74b2c37b3" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "4a19c599-e429-4eda-9644-3a46c1202c7f" - } - ] - }, - { - "process": "ab9f0b8f-3195-4ccd-8bdf-52d91a2c9029", - "inputs": [ - "b56697f5-d350-4e1d-93b2-72eee68c972e" - ], - "input_type": "biomaterial", - "outputs": [ - "6dc01fb6-6aba-432e-828e-ae3045914f34" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - }, - "process_0.json": { - "process_core": { - "process_id": "process_id_55" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "3c85210e-6554-450c-88fb-c5d5035cf134", - "submission_date": "2018-09-04T12:53:53.002Z", - "update_date": "2018-09-04T13:23:54.508Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_28" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "ab9f0b8f-3195-4ccd-8bdf-52d91a2c9029", - "submission_date": "2018-09-04T12:53:52.144Z", - "update_date": "2018-09-04T13:23:54.228Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_6694" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "e9c888db-256a-4c78-af5d-2977fa6bc22c", - "submission_date": "2018-09-04T12:59:17.940Z", - "update_date": "2018-09-04T13:27:57.677Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Mouse Melanoma", - "project_title": "Melanoma infiltration of stromal and immune cells", - "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications." - }, - "contributors": [ - { - "contact_name": "Sarah,A,Teichmann", - "email": "st9@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Mirjana,,Efremova", - "email": "me5@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Bidesh,,Mahata", - "email": "bm11@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Jacqueline,D,Shields", - "email": "JS970@MRCCU.cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "MRC Cancer Unit", - "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", - "country": "UK" - }, - { - "contact_name": "Sarah,,Davidson", - "email": "SED49@MRCCU.cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "MRC Cancer Unit", - "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", - "country": "UK" - }, - { - "contact_name": "Angela,,Riedel", - "email": "a.riedel@dkfz-heidelberg.de", - "institution": "DKFZ German Cancer Research Center", - "country": "Germany" - }, - { - "contact_name": "Roser,,Vento-Tormo", - "email": "rv4@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Jhuma,,Pramanik", - "email": "jp19@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Gozde,,Kar", - "email": "gkar@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Sarah Teichmann", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK" - }, - { - "contact_name": "Jani,,Huuhtanen", - "email": "jani.huuhtanen@helsinki.fi", - "institution": "University of Helsinki", - "country": "Finland" - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Danielle,,Welter", - "email": "dwelter@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-1058-2668", - "corresponding_contributor": false - } - ], - "provenance": { - "document_id": "092574d1-a391-4c09-a0c4-d06104a503f6", - "submission_date": "2018-09-04T12:44:36.854Z", - "update_date": "2018-09-04T13:08:08.264Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "21784_6#10_1.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "lane_index": 6, - "provenance": { - "document_id": "b93897c4-0681-407a-bc0c-fb791b919fa4", - "submission_date": "2018-09-04T12:47:44.261Z", - "update_date": "2018-09-04T13:20:33.745Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "SmartSeq2_sequencing_protocol", - "protocol_name": "Sequencing SmartSeq2 cells" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008567" - }, - "paired_end": true, - "sequencing_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "provenance": { - "document_id": "2c530a47-d87a-4d50-bfb9-74d15fdb1fd9", - "submission_date": "2018-09-04T12:53:51.118Z", - "update_date": "2018-09-04T12:57:59.862Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1131_LN", - "biomaterial_name": "Mouse_day8_LN_rep10", - "ncbi_taxon_id": [ - 10090 - ] - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "organ": { - "text": "lymph node", - "ontology": "UBERON:0000029" - }, - "provenance": { - "document_id": "6dc01fb6-6aba-432e-828e-ae3045914f34", - "submission_date": "2018-09-04T12:44:38.074Z", - "update_date": "2018-09-04T13:10:12.581Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..2acf73c7f --- /dev/null +++ b/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,498 @@ +{ + "manifest": [ + { + "crc32c": "FBFCE65D", + "sha1": "0a726ef364b0595199d219e9dc9b77d940ae68ff", + "sha256": "950508d241421cdce811fc096912d201360feb6d4b637353ba67dc59dba2c80f", + "s3_etag": "daf2a6aff515a073cef304ac139e9a2a", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 741, + "uuid": "180933f4-1469-48c6-b3bc-54e69f9ff7e9", + "version": "1" + }, + { + "crc32c": "6086FDD9", + "sha1": "0f8ddb153f45e6522f11e4debcc8c2fb948922d7", + "sha256": "c3c40a66492110a1d1d25c99f8873dd65da7e84030f3ee82b31f31dc8cd7c918", + "s3_etag": "af3170a0d73482f9e47bda31b5dc4d1e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1125, + "uuid": "46b0bf22-b0ce-4469-9d8b-bd5288e4e7d2", + "version": "1" + }, + { + "crc32c": "E72E5F20", + "sha1": "cf92164b4a3b8d402cb4d3b13c71ccc34bf69b5e", + "sha256": "6970445870ff8fba5196e25310c0fe79a927d1e3b758254dc123371be1c28064", + "s3_etag": "d631e2ba3bc1ed41e647e6260d282466", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 898, + "uuid": "6ce66ac8-1e0f-49b4-a278-468f7b677ffe", + "version": "1" + }, + { + "crc32c": "C0EF71FC", + "sha1": "79e8137293c18fc1ef1a4b2a532e59f6223fbec3", + "sha256": "d333cfe228457aaa476b4ccf39bdd4c620bfcf0f2c11ccfff83c9aacb7a17c13", + "s3_etag": "cbacd6ba075487820bcd49e2667581b6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 1727, + "uuid": "169acedb-1e56-4b6d-a3d7-0d3e56d74098", + "version": "1" + }, + { + "crc32c": "8D88697D", + "sha1": "cfbab7537d593e0b1765b65b755e88244bd88ebc", + "sha256": "ec56a160551570d476b3923472e19f2cb916f65b85c72e825784653ddee27f77", + "s3_etag": "2b1df288d6f0602ff6a8654d4aa07ce8", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 384, + "uuid": "3a8348ca-1937-4fa5-88a5-af4e6f9f06d1", + "version": "1" + }, + { + "crc32c": "2C851E75", + "sha1": "d77a07d55a8222e61127f5d6ed610f3b60a7df84", + "sha256": "0988ad6ef8e60868bfdff7e8f19775e9d42bdbc175e080d31ae47145bbad91b6", + "s3_etag": "e868dfb7a2feccf973ddbf1bb3423d22", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 382, + "uuid": "71cd814d-27c4-4fe4-993b-787de16ae29e", + "version": "1" + }, + { + "crc32c": "801E0395", + "sha1": "58e6c25c1ce9e80569171fd30bb957065cd84faa", + "sha256": "874cf6fd5d6287aebf64e5cfc832bd8b6396e0e4ded0304cc10a3c1e9e6112e8", + "s3_etag": "6e984edab1badcaac1c3ba42a663e30a", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_2.json", + "size": 384, + "uuid": "d6492dd2-9723-478b-aa16-8b27dd376c82", + "version": "1" + }, + { + "crc32c": "2FBF0575", + "sha1": "c9b78f377805269785b0cb98d99db2e6d5d1bf96", + "sha256": "855e343a7ea22f6fda8d0460cdc64f58ca43123f4dd2690493f249bb36032c9b", + "s3_etag": "81ece07c9fd7e034812401048cf6b1d7", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 3625, + "uuid": "109e26a2-816a-4a75-b2cf-b427f479383b", + "version": "1" + }, + { + "crc32c": "30F94925", + "sha1": "472dd1bf4a1e942cbfc6ad79687e2a2ca8f72c74", + "sha256": "b474913c2db1d26a3d8ab9f37c59ac7e1768b2c628b4e250d0dae0c942adc677", + "s3_etag": "4d938ebdb3772c0b6cf2f8bd2600d375", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 521, + "uuid": "599767ba-3d7e-4c11-9340-873a1fa00f37", + "version": "1" + }, + { + "crc32c": "30F94925", + "sha1": "472dd1bf4a1e942cbfc6ad79687e2a2ca8f72c74", + "sha256": "b474913c2db1d26a3d8ab9f37c59ac7e1768b2c628b4e250d0dae0c942adc677", + "s3_etag": "4d938ebdb3772c0b6cf2f8bd2600d375", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SRR3562210_1.fastq.gz", + "size": 521, + "uuid": "a4f16d4f-cdd7-46f4-8ead-42155d059f23", + "version": "1" + }, + { + "crc32c": "3727801A", + "sha1": "98b1bcf334aae2a06b973565497b16b092b5fc7e", + "sha256": "a58cc9dff7f585b8ddc40c56c60219b9c61f76fe210e357d2761ca6cea0693f9", + "s3_etag": "751b8f95e34765687a99ab87e3b60cb8", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_1.json", + "size": 521, + "uuid": "12e0f9a6-ead7-4f1f-8abb-ba0614a1cf8d", + "version": "1" + }, + { + "crc32c": "3727801A", + "sha1": "98b1bcf334aae2a06b973565497b16b092b5fc7e", + "sha256": "a58cc9dff7f585b8ddc40c56c60219b9c61f76fe210e357d2761ca6cea0693f9", + "s3_etag": "751b8f95e34765687a99ab87e3b60cb8", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SRR3562210_2.fastq.gz", + "size": 521, + "uuid": "26f05d68-8700-40a4-8c5f-173cad377f22", + "version": "1" + }, + { + "crc32c": "C5362A78", + "sha1": "7b50eb483a6086fa056e2bfc543eedbeb9fd13d2", + "sha256": "364a631862cd35c27aa9509106ffe270d4e930af68d3e06a8d4db07084c38539", + "s3_etag": "7ea70109d845b4a60ad2b8531f9a9d17", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 626, + "uuid": "63d68ab7-8026-4a53-a932-9af6923fe172", + "version": "1" + }, + { + "crc32c": "61EA5262", + "sha1": "621ba503402c0847b6a7ef804ffcc8bbeb565d40", + "sha256": "542bdc14a081f938f37fcd2b98dddebe65a426088244d444447ec26dcbd0286d", + "s3_etag": "0173e0a4d4a775ff6c564862fa738504", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "specimen_from_organism_0.json", + "size": 909, + "uuid": "58898104-7553-4978-83c6-fca0121cac01", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "GSM2171880 1", + "biomaterial_description": "Single cell from human pancreas", + "ncbi_taxon_id": [ + 9606 + ], + "insdc_biomaterial": "SRS1458605" + }, + "selected_cell_type": [ + { + "text": "pancreatic A cell", + "ontology": "CL:0000171" + } + ], + "total_estimated_cells": 1, + "provenance": { + "document_id": "c61125ab-d5e0-4d93-b0a7-2deac1729f65", + "submission_date": "2018-09-06T14:14:55.036Z", + "update_date": "2018-09-06T14:25:54.342Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "DID_scRSq04", + "ncbi_taxon_id": [ + 9696 + ] + }, + "human_specific": { + "body_mass_index": 28.4, + "ethnicity": [ + { + "text": "European", + "ontology": "hancestro:0005" + } + ] + }, + "death": { + "cause_of_death": "anoxia" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organism_age": "21", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "is_living": "no", + "sex": "male", + "provenance": { + "document_id": "cd379b0c-7b23-4093-b0b0-65d592ab2839", + "submission_date": "2018-09-06T14:14:54.645Z", + "update_date": "2018-09-06T14:23:05.946Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1" + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_approach": { + "text": "smart-seq2", + "ontology": "EFO:0008931" + }, + "library_construction_kit": { + "retail_name": "Nextera XT kit", + "manufacturer": "Illumina" + }, + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "nucleic_acid_source": "single cell", + "provenance": { + "document_id": "34c6db60-ef27-4502-9191-102d1a235adc", + "submission_date": "2018-09-06T14:18:31.859Z", + "update_date": "2018-09-06T14:18:35.854Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "5f868fc6-dc13-4f06-a82e-ff83497d03ee", + "inputs": [ + "c61125ab-d5e0-4d93-b0a7-2deac1729f65" + ], + "input_type": "biomaterial", + "outputs": [ + "0494ee09-b1e2-437a-986f-06d5df4a6858", + "baf745cd-9052-4a6c-8c1a-919390062c09" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "34c6db60-ef27-4502-9191-102d1a235adc" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "319dd8c8-e9d6-40df-bf72-e0423f4f5418" + } + ] + }, + { + "process": "6c357ba8-bd9a-41cb-9d74-b9442efb7217", + "inputs": [ + "07282a68-dca4-449e-81b6-7b0da34230df" + ], + "input_type": "biomaterial", + "outputs": [ + "c61125ab-d5e0-4d93-b0a7-2deac1729f65" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "0aede7bd-0a5d-4dc5-a8e8-2d4ad6d01bfb", + "inputs": [ + "cd379b0c-7b23-4093-b0b0-65d592ab2839" + ], + "input_type": "biomaterial", + "outputs": [ + "07282a68-dca4-449e-81b6-7b0da34230df" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + }, + "process_0.json": { + "process_core": { + "process_id": "process_id_9" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "6c357ba8-bd9a-41cb-9d74-b9442efb7217", + "submission_date": "2018-09-06T14:18:32.012Z", + "update_date": "2018-09-06T14:31:09.024Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "SRR3562210" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "5f868fc6-dc13-4f06-a82e-ff83497d03ee", + "submission_date": "2018-09-06T14:20:46.372Z", + "update_date": "2018-09-06T14:31:54.751Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_4" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "0aede7bd-0a5d-4dc5-a8e8-2d4ad6d01bfb", + "submission_date": "2018-09-06T14:18:31.926Z", + "update_date": "2018-09-06T14:31:08.929Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Single cell transcriptome analysis of human pancreas", + "project_title": "Single cell transcriptome analysis of human pancreas reveals transcriptional signatures of aging and somatic mutation patterns.", + "project_description": "As organisms age, cells accumulate genetic and epigenetic changes that eventually lead to impaired organ function or catastrophic failure such as cancer. Here we describe a single-cell transcriptome analysis of 2544 human pancreas cells from donors, spanning six decades of life. We find that islet cells from older donors have increased levels of disorder as measured both by noise in the transcriptome and by the number of cells which display inappropriate hormone expression, revealing a transcriptional instability associated with aging. By analyzing the spectrum of somatic mutations in single cells from previously-healthy donors, we find a specific age-dependent mutational signature characterized by C to A and C to G transversions, indicators of oxidative stress, which is absent in single cells from human brain tissue or in a tumor cell line. Cells carrying a high load of such mutations also express higher levels of stress and senescence markers, including FOS, JUN, and the cytoplasmic superoxide dismutase SOD1, markers previously linked to pancreatic diseases with substantial age-dependent risk, such as type 2 diabetes mellitus and adenocarcinoma. Thus, our single-cell approach unveils gene expression changes and somatic mutations acquired in aging human tissue, and identifies molecular pathways induced by these genetic changes that could influence human disease. Also, our results demonstrate the feasibility of using single-cell RNA-seq data from primary cells to derive meaningful insights into the genetic processes that operate on aging human tissue and to determine which molecular mechanisms are coordinated with these processes. Examination of single cells from primary human pancreas tissue" + }, + "supplementary_links": [ + "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-81547/Results" + ], + "contributors": [ + { + "contact_name": "Martin, Enge", + "email": "martin.enge@gmail.com", + "institution": "Stanford University", + "address": "Bioengineering, Stanford University, James H. Clark Center, 318 Campus Drive,, Stanford, CA, USA", + "country": "USA" + }, + { + "contact_name": "Laura,,Huerta", + "email": "lauhuema@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Molecular Atlas", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8748-599X", + "corresponding_contributor": false + }, + { + "contact_name": "Matthew,,Green", + "email": "hewgreen@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "HCA Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2771-9894" + } + ], + "provenance": { + "document_id": "05f74601-064c-4a8a-a9c1-a0b57c6c71a7", + "submission_date": "2018-09-06T14:14:54.609Z", + "update_date": "2018-09-06T14:23:05.636Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR3562210_1.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "read_length": 75, + "insdc_run": [ + "SRR3562210" + ], + "provenance": { + "document_id": "baf745cd-9052-4a6c-8c1a-919390062c09", + "submission_date": "2018-09-06T14:16:32.925Z", + "update_date": "2018-09-06T14:29:33.854Z" + } + }, + "sequence_file_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR3562210_2.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read2", + "read_length": 75, + "insdc_run": [ + "SRR3562210" + ], + "provenance": { + "document_id": "0494ee09-b1e2-437a-986f-06d5df4a6858", + "submission_date": "2018-09-06T14:16:32.894Z", + "update_date": "2018-09-06T14:29:33.843Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1" + }, + "instrument_manufacturer_model": { + "text": "Illumina NextSeq 500", + "ontology": "EFO:0008566" + }, + "paired_end": true, + "sequencing_approach": { + "text": "RNA-Seq" + }, + "provenance": { + "document_id": "319dd8c8-e9d6-40df-bf72-e0423f4f5418", + "submission_date": "2018-09-06T14:18:31.870Z", + "update_date": "2018-09-06T14:18:35.890Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "DID_scRSq04_pancreas", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "pancreas", + "ontology": "UBERON:0001264" + }, + "organ_part": { + "text": "islet of Langerhans", + "ontology": "UBERON:0000006" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "provenance": { + "document_id": "07282a68-dca4-449e-81b6-7b0da34230df", + "submission_date": "2018-09-06T14:14:54.969Z", + "update_date": "2018-09-06T14:24:20.677Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index 3017ccd2d..000000000 --- a/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,170 +0,0 @@ -[ - { - "crc32c": "FBFCE65D", - "sha1": "0a726ef364b0595199d219e9dc9b77d940ae68ff", - "sha256": "950508d241421cdce811fc096912d201360feb6d4b637353ba67dc59dba2c80f", - "s3_etag": "daf2a6aff515a073cef304ac139e9a2a", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 741, - "uuid": "180933f4-1469-48c6-b3bc-54e69f9ff7e9", - "version": "1" - }, - { - "crc32c": "6086FDD9", - "sha1": "0f8ddb153f45e6522f11e4debcc8c2fb948922d7", - "sha256": "c3c40a66492110a1d1d25c99f8873dd65da7e84030f3ee82b31f31dc8cd7c918", - "s3_etag": "af3170a0d73482f9e47bda31b5dc4d1e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1125, - "uuid": "46b0bf22-b0ce-4469-9d8b-bd5288e4e7d2", - "version": "1" - }, - { - "crc32c": "E72E5F20", - "sha1": "cf92164b4a3b8d402cb4d3b13c71ccc34bf69b5e", - "sha256": "6970445870ff8fba5196e25310c0fe79a927d1e3b758254dc123371be1c28064", - "s3_etag": "d631e2ba3bc1ed41e647e6260d282466", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 898, - "uuid": "6ce66ac8-1e0f-49b4-a278-468f7b677ffe", - "version": "1" - }, - { - "crc32c": "C0EF71FC", - "sha1": "79e8137293c18fc1ef1a4b2a532e59f6223fbec3", - "sha256": "d333cfe228457aaa476b4ccf39bdd4c620bfcf0f2c11ccfff83c9aacb7a17c13", - "s3_etag": "cbacd6ba075487820bcd49e2667581b6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 1727, - "uuid": "169acedb-1e56-4b6d-a3d7-0d3e56d74098", - "version": "1" - }, - { - "crc32c": "8D88697D", - "sha1": "cfbab7537d593e0b1765b65b755e88244bd88ebc", - "sha256": "ec56a160551570d476b3923472e19f2cb916f65b85c72e825784653ddee27f77", - "s3_etag": "2b1df288d6f0602ff6a8654d4aa07ce8", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 384, - "uuid": "3a8348ca-1937-4fa5-88a5-af4e6f9f06d1", - "version": "1" - }, - { - "crc32c": "2C851E75", - "sha1": "d77a07d55a8222e61127f5d6ed610f3b60a7df84", - "sha256": "0988ad6ef8e60868bfdff7e8f19775e9d42bdbc175e080d31ae47145bbad91b6", - "s3_etag": "e868dfb7a2feccf973ddbf1bb3423d22", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 382, - "uuid": "71cd814d-27c4-4fe4-993b-787de16ae29e", - "version": "1" - }, - { - "crc32c": "801E0395", - "sha1": "58e6c25c1ce9e80569171fd30bb957065cd84faa", - "sha256": "874cf6fd5d6287aebf64e5cfc832bd8b6396e0e4ded0304cc10a3c1e9e6112e8", - "s3_etag": "6e984edab1badcaac1c3ba42a663e30a", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_2.json", - "size": 384, - "uuid": "d6492dd2-9723-478b-aa16-8b27dd376c82", - "version": "1" - }, - { - "crc32c": "2FBF0575", - "sha1": "c9b78f377805269785b0cb98d99db2e6d5d1bf96", - "sha256": "855e343a7ea22f6fda8d0460cdc64f58ca43123f4dd2690493f249bb36032c9b", - "s3_etag": "81ece07c9fd7e034812401048cf6b1d7", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 3625, - "uuid": "109e26a2-816a-4a75-b2cf-b427f479383b", - "version": "1" - }, - { - "crc32c": "30F94925", - "sha1": "472dd1bf4a1e942cbfc6ad79687e2a2ca8f72c74", - "sha256": "b474913c2db1d26a3d8ab9f37c59ac7e1768b2c628b4e250d0dae0c942adc677", - "s3_etag": "4d938ebdb3772c0b6cf2f8bd2600d375", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 521, - "uuid": "599767ba-3d7e-4c11-9340-873a1fa00f37", - "version": "1" - }, - { - "crc32c": "30F94925", - "sha1": "472dd1bf4a1e942cbfc6ad79687e2a2ca8f72c74", - "sha256": "b474913c2db1d26a3d8ab9f37c59ac7e1768b2c628b4e250d0dae0c942adc677", - "s3_etag": "4d938ebdb3772c0b6cf2f8bd2600d375", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SRR3562210_1.fastq.gz", - "size": 521, - "uuid": "a4f16d4f-cdd7-46f4-8ead-42155d059f23", - "version": "1" - }, - { - "crc32c": "3727801A", - "sha1": "98b1bcf334aae2a06b973565497b16b092b5fc7e", - "sha256": "a58cc9dff7f585b8ddc40c56c60219b9c61f76fe210e357d2761ca6cea0693f9", - "s3_etag": "751b8f95e34765687a99ab87e3b60cb8", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_1.json", - "size": 521, - "uuid": "12e0f9a6-ead7-4f1f-8abb-ba0614a1cf8d", - "version": "1" - }, - { - "crc32c": "3727801A", - "sha1": "98b1bcf334aae2a06b973565497b16b092b5fc7e", - "sha256": "a58cc9dff7f585b8ddc40c56c60219b9c61f76fe210e357d2761ca6cea0693f9", - "s3_etag": "751b8f95e34765687a99ab87e3b60cb8", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SRR3562210_2.fastq.gz", - "size": 521, - "uuid": "26f05d68-8700-40a4-8c5f-173cad377f22", - "version": "1" - }, - { - "crc32c": "C5362A78", - "sha1": "7b50eb483a6086fa056e2bfc543eedbeb9fd13d2", - "sha256": "364a631862cd35c27aa9509106ffe270d4e930af68d3e06a8d4db07084c38539", - "s3_etag": "7ea70109d845b4a60ad2b8531f9a9d17", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 626, - "uuid": "63d68ab7-8026-4a53-a932-9af6923fe172", - "version": "1" - }, - { - "crc32c": "61EA5262", - "sha1": "621ba503402c0847b6a7ef804ffcc8bbeb565d40", - "sha256": "542bdc14a081f938f37fcd2b98dddebe65a426088244d444447ec26dcbd0286d", - "s3_etag": "0173e0a4d4a775ff6c564862fa738504", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "specimen_from_organism_0.json", - "size": 909, - "uuid": "58898104-7553-4978-83c6-fca0121cac01", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index d7df95026..000000000 --- a/test/hca_metadata_api/cans/examples/Single cell transcriptome analysis of human pancreas/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,326 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "GSM2171880 1", - "biomaterial_description": "Single cell from human pancreas", - "ncbi_taxon_id": [ - 9606 - ], - "insdc_biomaterial": "SRS1458605" - }, - "selected_cell_type": [ - { - "text": "pancreatic A cell", - "ontology": "CL:0000171" - } - ], - "total_estimated_cells": 1, - "provenance": { - "document_id": "c61125ab-d5e0-4d93-b0a7-2deac1729f65", - "submission_date": "2018-09-06T14:14:55.036Z", - "update_date": "2018-09-06T14:25:54.342Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "DID_scRSq04", - "ncbi_taxon_id": [ - 9696 - ] - }, - "human_specific": { - "body_mass_index": 28.4, - "ethnicity": [ - { - "text": "European", - "ontology": "hancestro:0005" - } - ] - }, - "death": { - "cause_of_death": "anoxia" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organism_age": "21", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "is_living": "no", - "sex": "male", - "provenance": { - "document_id": "cd379b0c-7b23-4093-b0b0-65d592ab2839", - "submission_date": "2018-09-06T14:14:54.645Z", - "update_date": "2018-09-06T14:23:05.946Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1" - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_approach": { - "text": "smart-seq2", - "ontology": "EFO:0008931" - }, - "library_construction_kit": { - "retail_name": "Nextera XT kit", - "manufacturer": "Illumina" - }, - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "nucleic_acid_source": "single cell", - "provenance": { - "document_id": "34c6db60-ef27-4502-9191-102d1a235adc", - "submission_date": "2018-09-06T14:18:31.859Z", - "update_date": "2018-09-06T14:18:35.854Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "5f868fc6-dc13-4f06-a82e-ff83497d03ee", - "inputs": [ - "c61125ab-d5e0-4d93-b0a7-2deac1729f65" - ], - "input_type": "biomaterial", - "outputs": [ - "0494ee09-b1e2-437a-986f-06d5df4a6858", - "baf745cd-9052-4a6c-8c1a-919390062c09" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "34c6db60-ef27-4502-9191-102d1a235adc" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "319dd8c8-e9d6-40df-bf72-e0423f4f5418" - } - ] - }, - { - "process": "6c357ba8-bd9a-41cb-9d74-b9442efb7217", - "inputs": [ - "07282a68-dca4-449e-81b6-7b0da34230df" - ], - "input_type": "biomaterial", - "outputs": [ - "c61125ab-d5e0-4d93-b0a7-2deac1729f65" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "0aede7bd-0a5d-4dc5-a8e8-2d4ad6d01bfb", - "inputs": [ - "cd379b0c-7b23-4093-b0b0-65d592ab2839" - ], - "input_type": "biomaterial", - "outputs": [ - "07282a68-dca4-449e-81b6-7b0da34230df" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - }, - "process_0.json": { - "process_core": { - "process_id": "process_id_9" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "6c357ba8-bd9a-41cb-9d74-b9442efb7217", - "submission_date": "2018-09-06T14:18:32.012Z", - "update_date": "2018-09-06T14:31:09.024Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "SRR3562210" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "5f868fc6-dc13-4f06-a82e-ff83497d03ee", - "submission_date": "2018-09-06T14:20:46.372Z", - "update_date": "2018-09-06T14:31:54.751Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_4" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "0aede7bd-0a5d-4dc5-a8e8-2d4ad6d01bfb", - "submission_date": "2018-09-06T14:18:31.926Z", - "update_date": "2018-09-06T14:31:08.929Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Single cell transcriptome analysis of human pancreas", - "project_title": "Single cell transcriptome analysis of human pancreas reveals transcriptional signatures of aging and somatic mutation patterns.", - "project_description": "As organisms age, cells accumulate genetic and epigenetic changes that eventually lead to impaired organ function or catastrophic failure such as cancer. Here we describe a single-cell transcriptome analysis of 2544 human pancreas cells from donors, spanning six decades of life. We find that islet cells from older donors have increased levels of disorder as measured both by noise in the transcriptome and by the number of cells which display inappropriate hormone expression, revealing a transcriptional instability associated with aging. By analyzing the spectrum of somatic mutations in single cells from previously-healthy donors, we find a specific age-dependent mutational signature characterized by C to A and C to G transversions, indicators of oxidative stress, which is absent in single cells from human brain tissue or in a tumor cell line. Cells carrying a high load of such mutations also express higher levels of stress and senescence markers, including FOS, JUN, and the cytoplasmic superoxide dismutase SOD1, markers previously linked to pancreatic diseases with substantial age-dependent risk, such as type 2 diabetes mellitus and adenocarcinoma. Thus, our single-cell approach unveils gene expression changes and somatic mutations acquired in aging human tissue, and identifies molecular pathways induced by these genetic changes that could influence human disease. Also, our results demonstrate the feasibility of using single-cell RNA-seq data from primary cells to derive meaningful insights into the genetic processes that operate on aging human tissue and to determine which molecular mechanisms are coordinated with these processes. Examination of single cells from primary human pancreas tissue" - }, - "supplementary_links": [ - "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-81547/Results" - ], - "contributors": [ - { - "contact_name": "Martin, Enge", - "email": "martin.enge@gmail.com", - "institution": "Stanford University", - "address": "Bioengineering, Stanford University, James H. Clark Center, 318 Campus Drive,, Stanford, CA, USA", - "country": "USA" - }, - { - "contact_name": "Laura,,Huerta", - "email": "lauhuema@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Molecular Atlas", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8748-599X", - "corresponding_contributor": false - }, - { - "contact_name": "Matthew,,Green", - "email": "hewgreen@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "HCA Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2771-9894" - } - ], - "provenance": { - "document_id": "05f74601-064c-4a8a-a9c1-a0b57c6c71a7", - "submission_date": "2018-09-06T14:14:54.609Z", - "update_date": "2018-09-06T14:23:05.636Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR3562210_1.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "read_length": 75, - "insdc_run": [ - "SRR3562210" - ], - "provenance": { - "document_id": "baf745cd-9052-4a6c-8c1a-919390062c09", - "submission_date": "2018-09-06T14:16:32.925Z", - "update_date": "2018-09-06T14:29:33.854Z" - } - }, - "sequence_file_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR3562210_2.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read2", - "read_length": 75, - "insdc_run": [ - "SRR3562210" - ], - "provenance": { - "document_id": "0494ee09-b1e2-437a-986f-06d5df4a6858", - "submission_date": "2018-09-06T14:16:32.894Z", - "update_date": "2018-09-06T14:29:33.843Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1" - }, - "instrument_manufacturer_model": { - "text": "Illumina NextSeq 500", - "ontology": "EFO:0008566" - }, - "paired_end": true, - "sequencing_approach": { - "text": "RNA-Seq" - }, - "provenance": { - "document_id": "319dd8c8-e9d6-40df-bf72-e0423f4f5418", - "submission_date": "2018-09-06T14:18:31.870Z", - "update_date": "2018-09-06T14:18:35.890Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/6.3.1/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "DID_scRSq04_pancreas", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "pancreas", - "ontology": "UBERON:0001264" - }, - "organ_part": { - "text": "islet of Langerhans", - "ontology": "UBERON:0000006" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "provenance": { - "document_id": "07282a68-dca4-449e-81b6-7b0da34230df", - "submission_date": "2018-09-06T14:14:54.969Z", - "update_date": "2018-09-06T14:24:20.677Z" - } - } -} diff --git a/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json b/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json new file mode 100644 index 000000000..6eea5c58b --- /dev/null +++ b/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-08-03T082009.272868Z.json @@ -0,0 +1,878 @@ +{ + "manifest": [ + { + "crc32c": "FD971A18", + "sha1": "1792e28d776e30795ae12ded550a90507afd4d3a", + "sha256": "b7e4ab204e7808382ea766362a03b7574740661c9f0de9ad9d6a57902b5db3ed", + "s3_etag": "0106da2e5d49b7db21e8fddf0db50e02", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "cell_suspension_0.json", + "size": 774, + "uuid": "51215dbc-2dfd-4969-a54e-c39191a0a257", + "version": "1" + }, + { + "crc32c": "94D6B49F", + "sha1": "df275d2538f4a4d268b5bb73a1f13a9694ffeac9", + "sha256": "d894880e4255dde12d025dbcf970e4463ef33d373823f96a6ff6f8d86319b928", + "s3_etag": "a7ae9463b86a2e892bb0f004b5178127", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "dissociation_protocol_0.json", + "size": 684, + "uuid": "75c81e22-2775-4c59-9c3a-7744f1e5fb85", + "version": "1" + }, + { + "crc32c": "A1D20ADB", + "sha1": "8a7bb7964b04a893322b0661e24acf8f57286ad1", + "sha256": "0c96bd6b8ec27b590794cb75cd412171f50c97ca7f54f5a37034af68124dd1a5", + "s3_etag": "149fb07a5176a4e1cb059453b2e4c410", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "donor_organism_0.json", + "size": 1640, + "uuid": "9ce282f9-92fa-410f-a900-1b60520e3ae6", + "version": "1" + }, + { + "crc32c": "C0295A94", + "sha1": "9451c7750b4fc01710a01fd7e6ee134db4c9aee3", + "sha256": "f35e073ca46f7c1aa632786cb8c1a448c06d89c1886b07d6a657b9eea966c052", + "s3_etag": "84e0dcc1737b33b2416b28d2d72e34dc", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "enrichment_protocol_0.json", + "size": 694, + "uuid": "598ed21e-d90f-49af-8c97-5b140f91c079", + "version": "1" + }, + { + "crc32c": "AF32195B", + "sha1": "8ecdb54e2ed451cfc22c52ca1d8ebefdf6c72e58", + "sha256": "d57e8aba16e12fedbef5b8b6857d63054fc4968f82cce2398d45a3d8c0105f2c", + "s3_etag": "4d85ae4c4d84894373f7af664d92c9fa", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "size": 1206, + "uuid": "1d64e884-84c1-438e-8f1b-7d42698942ad", + "version": "1" + }, + { + "crc32c": "C1574314", + "sha1": "086e0e40e88c2ed0b4a1c68a3f2fd88e66454e6e", + "sha256": "88fa107073946ff3a01455ebeca62cb7a8c8253a10f90c68f8c37078f00be627", + "s3_etag": "151fe404519e0934fa5e24772d8002d6", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "links.json", + "size": 1643, + "uuid": "62f4b747-7bf2-4af5-b710-723a060f0d35", + "version": "1" + }, + { + "crc32c": "D044B620", + "sha1": "15c4e8085308b8f297b9b682c8aa892514e476de", + "sha256": "743e4240381a969032e2e305a7a63e839d979cd1072fe67c816278a9f97820cb", + "s3_etag": "3992069444c9940b70bc8e6e8c062b59", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_0.json", + "size": 384, + "uuid": "d7c8d181-105d-416c-a5a5-e7f353be7684", + "version": "1" + }, + { + "crc32c": "0A2A3547", + "sha1": "23b48a154f75c0fa5c898f6e6f5031a7b321f35e", + "sha256": "d120b433ae3926595c6704b7d0b2680cd8a72ba525c5cf1b796badd1473fe610", + "s3_etag": "469107dc5f22cfe005fd47e0c2d0c36b", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "process_1.json", + "size": 385, + "uuid": "d4528d9e-291d-4506-96fc-6e9304524aca", + "version": "1" + }, + { + "crc32c": "171D9018", + "sha1": "93d5db855b02ccc905738b3f09b4e9f837340631", + "sha256": "e9423d52f8c7dc689ba6da72c5a41571731d766f6116c2faab2b185bceebde1e", + "s3_etag": "e4b9286fc2cb939eb4938198ade2400d", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "project_0.json", + "size": 6850, + "uuid": "270801af-47a4-48eb-a7c0-684f2573e99a", + "version": "1" + }, + { + "crc32c": "5E314552", + "sha1": "0caf6b4d52c6095fe9b78eae9f12f4b2e7bdee3b", + "sha256": "e7f7e93c198d758a084d0ef4065b0314ba7365a72eeccc77f3b6368e4b951308", + "s3_etag": "86e0aff5a1b15c1a9c4f396f4ebcd2ed", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequence_file_0.json", + "size": 545, + "uuid": "20c3551f-28a5-4a80-9524-04e32d534cb9", + "version": "1" + }, + { + "crc32c": "5E314552", + "sha1": "0caf6b4d52c6095fe9b78eae9f12f4b2e7bdee3b", + "sha256": "e7f7e93c198d758a084d0ef4065b0314ba7365a72eeccc77f3b6368e4b951308", + "s3_etag": "86e0aff5a1b15c1a9c4f396f4ebcd2ed", + "content-type": "application/octet-stream", + "indexed": false, + "name": "HCATisStabAug177078016_S1_L001_I1_001.fastq.gz", + "size": 545, + "uuid": "72b3bd3f-1874-4636-bffe-0ab382cf6d72", + "version": "1" + }, + { + "crc32c": "37EAF626", + "sha1": "360c9664a9d4a329095bfc91ce6986f456d1e9b8", + "sha256": "f54208dc2d31664b06e4bae1052a137e98b6e78756e432f016474f72e7888823", + "s3_etag": "161390a17a35f0c1b0a7b7ab4d0e4724", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "sequencing_protocol_0.json", + "size": 873, + "uuid": "aa0b00f1-794e-410c-a2c4-ff8e52871cc8", + "version": "1" + }, + { + "crc32c": "5BA5B282", + "sha1": "6c65e7c34a953a96a9991e302a367999f0612fab", + "sha256": "fced35e7be4a017707f154e25a16f4b8f5287f636909d7d4c1ef4802cc090c78", + "s3_etag": "098f7bdf35bb0508201e3b13e894cee0", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_0.json", + "size": 520, + "uuid": "22f718f3-5e93-48eb-acdd-b076ecf70ae8", + "version": "1" + }, + { + "crc32c": "5BA5B282", + "sha1": "6c65e7c34a953a96a9991e302a367999f0612fab", + "sha256": "fced35e7be4a017707f154e25a16f4b8f5287f636909d7d4c1ef4802cc090c78", + "s3_etag": "098f7bdf35bb0508201e3b13e894cee0", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SOP_MACS Live Dead Separation V3.pdf", + "size": 520, + "uuid": "e0e51494-0793-4145-b10e-32d0c48f7905", + "version": "1" + }, + { + "crc32c": "CAD4F2CE", + "sha1": "595994145200f0ad7917bb019f86164e6bcc58e8", + "sha256": "a01dcb62b1948ea2b998b2e763a9aa5d888072c0e71c6c324c9aa1c2b9ed13d4", + "s3_etag": "06d38e739da0ab85b142bc5d48036a2e", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_1.json", + "size": 527, + "uuid": "7d6e3740-5656-42ed-ae6d-01956eb3bd27", + "version": "1" + }, + { + "crc32c": "CAD4F2CE", + "sha1": "595994145200f0ad7917bb019f86164e6bcc58e8", + "sha256": "a01dcb62b1948ea2b998b2e763a9aa5d888072c0e71c6c324c9aa1c2b9ed13d4", + "s3_etag": "06d38e739da0ab85b142bc5d48036a2e", + "content-type": "application/octet-stream", + "indexed": false, + "name": "Human_spleen_dissociation_protocol.pdf", + "size": 527, + "uuid": "81f61d0b-514d-47c5-814d-e238996ecab2", + "version": "1" + }, + { + "crc32c": "92435DE6", + "sha1": "e6928d497f33a976aa49ee799358f3b2f048196b", + "sha256": "4b05be3a55ad520d3d3afd0b0e1c9f82b5ed7e0b1feb9b57c0283b7e430f0f38", + "s3_etag": "4c8a685c90633f44fe4af0cddcec3c07", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_2.json", + "size": 578, + "uuid": "7ab744b1-aae4-4585-afa6-e36a77181a23", + "version": "1" + }, + { + "crc32c": "92435DE6", + "sha1": "e6928d497f33a976aa49ee799358f3b2f048196b", + "sha256": "4b05be3a55ad520d3d3afd0b0e1c9f82b5ed7e0b1feb9b57c0283b7e430f0f38", + "s3_etag": "4c8a685c90633f44fe4af0cddcec3c07", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SOP - Human Oesophagus Dissociation 19.02.18.pdf", + "size": 578, + "uuid": "0b251162-aeb6-418b-b313-49602512745e", + "version": "1" + }, + { + "crc32c": "03D66B96", + "sha1": "225ec6c9f8675206e628611b2bf2dbb4a24b5765", + "sha256": "be3904db8cdb8deba1619eed9ec227071d842c874c61676eaa9a6bf8afd73156", + "s3_etag": "bb7bd150105d8047e0c823f825dd0051", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_3.json", + "size": 513, + "uuid": "60007975-aaf8-419c-99e6-30cead3972d3", + "version": "1" + }, + { + "crc32c": "03D66B96", + "sha1": "225ec6c9f8675206e628611b2bf2dbb4a24b5765", + "sha256": "be3904db8cdb8deba1619eed9ec227071d842c874c61676eaa9a6bf8afd73156", + "s3_etag": "bb7bd150105d8047e0c823f825dd0051", + "content-type": "application/octet-stream", + "indexed": false, + "name": "Clinical_metadata.xlsx", + "size": 513, + "uuid": "7b8da1fb-e6c2-4fc1-b370-11fa9698939f", + "version": "1" + }, + { + "crc32c": "455326F9", + "sha1": "f1cc033ec095cf812f0d2ad0689d277b271523e5", + "sha256": "023f39b768280f66d91cf9cc7771d14c1a0f893ecd96d4727ec6206d99041922", + "s3_etag": "1366c0d41b7ed73229d5f1177146448a", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_4.json", + "size": 502, + "uuid": "81fae654-25f7-430e-9829-9e8ccd2f3098", + "version": "1" + }, + { + "crc32c": "455326F9", + "sha1": "f1cc033ec095cf812f0d2ad0689d277b271523e5", + "sha256": "023f39b768280f66d91cf9cc7771d14c1a0f893ecd96d4727ec6206d99041922", + "s3_etag": "1366c0d41b7ed73229d5f1177146448a", + "content-type": "application/octet-stream", + "indexed": false, + "name": "10x_sequencing_protocol.pdf", + "size": 502, + "uuid": "a0e29103-23b1-4570-a335-29ab7e4de062", + "version": "1" + }, + { + "crc32c": "76070BE8", + "sha1": "8c6fd1a6af8c050415b42795e40975ce0e685d1b", + "sha256": "ade3a42aa52b0159f8cafdf112119632ec06fc9eefe3a8846e7431e02b1dca87", + "s3_etag": "807c710c0d280481e634f68ab1926046", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_5.json", + "size": 426, + "uuid": "a59afc52-7104-4bcc-9c48-8d29ec26f142", + "version": "1" + }, + { + "crc32c": "76070BE8", + "sha1": "8c6fd1a6af8c050415b42795e40975ce0e685d1b", + "sha256": "ade3a42aa52b0159f8cafdf112119632ec06fc9eefe3a8846e7431e02b1dca87", + "s3_etag": "807c710c0d280481e634f68ab1926046", + "content-type": "application/octet-stream", + "indexed": false, + "name": "Experimental_report.pdf", + "size": 426, + "uuid": "06403366-b0af-455b-b5e7-ec7cfbacb791", + "version": "1" + }, + { + "crc32c": "FCA6B2B2", + "sha1": "05e3276d65e86b46b080243380ca92954fa8e46d", + "sha256": "32f7948b17e53588ba1c7ebe2c0ea11560eeb232b1d626e3d24a82d46a035140", + "s3_etag": "92bfdbbfaed67053422af7be835392a4", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_6.json", + "size": 569, + "uuid": "3c6e7cca-4b71-4440-9bfe-7fbb6e8d64f7", + "version": "1" + }, + { + "crc32c": "FCA6B2B2", + "sha1": "05e3276d65e86b46b080243380ca92954fa8e46d", + "sha256": "32f7948b17e53588ba1c7ebe2c0ea11560eeb232b1d626e3d24a82d46a035140", + "s3_etag": "92bfdbbfaed67053422af7be835392a4", + "content-type": "application/octet-stream", + "indexed": false, + "name": "SOP-Mechanical Human Spleen Dissociation 19.02.17.pdf", + "size": 569, + "uuid": "aa155ec7-5ef5-4a22-9907-23019097fba0", + "version": "1" + }, + { + "crc32c": "A5FA937C", + "sha1": "8b8325fffab6dff50944126ad95ff44776128440", + "sha256": "ab30dc7402b9d849adf90f1433b952f005a56a6989c6a0306901d7dbeac203d8", + "s3_etag": "c0c8a11d34500469afd134a264ff94cd", + "content-type": "application/json; dcp-type=\"metadata/json\"", + "indexed": true, + "name": "supplementary_file_7.json", + "size": 507, + "uuid": "56e64272-c762-47d8-b49b-cd15436edabf", + "version": "1" + }, + { + "crc32c": "A5FA937C", + "sha1": "8b8325fffab6dff50944126ad95ff44776128440", + "sha256": "ab30dc7402b9d849adf90f1433b952f005a56a6989c6a0306901d7dbeac203d8", + "s3_etag": "c0c8a11d34500469afd134a264ff94cd", + "content-type": "application/octet-stream", + "indexed": false, + "name": "284C_IMAGE_spleen_annotated.jpeg", + "size": 507, + "uuid": "769901d5-ef88-4c45-b83c-5bf9a97d59d2", + "version": "1" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "A1-Spl-0-TL5_cells", + "biomaterial_name": "cells from fresh spleen", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA1098924", + "insdc_biomaterial": "ERS2392443" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "total_estimated_cells": 1970, + "provenance": { + "document_id": "932dae75-ba79-42a6-915a-c6a67b39835c", + "submission_date": "2018-09-05T09:14:54.798Z", + "update_date": "2018-09-05T09:15:05.597Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "Dissociation of spleen tissue sample into cell suspension", + "document": "Human_spleen_dissociation_protocol.pdf" + }, + "dissociation_method": { + "text": "mechanical", + "ontology": "EFO:0009129" + }, + "provenance": { + "document_id": "f1f2f791-f5f0-4eaa-8a4d-d6de9cf6807b", + "submission_date": "2018-09-05T09:14:54.916Z", + "update_date": "2018-09-05T09:15:02.163Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "284C-A1", + "biomaterial_name": "284C-spleen", + "biomaterial_description": "Spleen", + "ncbi_taxon_id": [ + 9606 + ] + }, + "death": { + "cause_of_death": "Hypoxic brain damage", + "cold_perfused": true, + "organ_donation_death_type": "Donation after circulatory death (DCD)" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "is_living": "no", + "sex": "male", + "organism_age": "55-60", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "height": "1.75-1.8", + "height_unit": { + "text": "meter", + "ontology": "UO:0000008" + }, + "weight": "80-85", + "weight_unit": { + "text": "kilogram", + "ontology": "UO:0000009" + }, + "medical_history": { + "alcohol_history": "3-6 units/day", + "smoking_history": "Smoker, 20/day for 25 years, stopped 2000" + }, + "normothermic_regional_perfusion": "yes", + "provenance": { + "document_id": "8909e260-7472-4c95-a96e-05d53d3c9221", + "submission_date": "2018-09-05T09:14:54.658Z", + "update_date": "2018-09-05T09:15:03.935Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_1", + "protocol_name": "Enrichment for live cells", + "document": "Human_spleen_dissociation_protocol.pdf" + }, + "enrichment_method": { + "text": "magnetic affinity cell sorting", + "ontology": "EFO:0009109" + }, + "markers": "LiveCells", + "provenance": { + "document_id": "e8c1f3fe-d694-467c-a823-01426f44ed71", + "submission_date": "2018-09-05T09:14:54.896Z", + "update_date": "2018-09-05T09:15:02.160Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Library preparation for 10x_v2 sequencing", + "protocol_description": "ChromiumTM Single Cell 3' Library & Gel Bead Kit v2", + "document": "10x_sequencing_protocol.pdf" + }, + "cell_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_approach": { + "text": "10X sequencing", + "ontology": "EFO:0008995" + }, + "nucleic_acid_source": "single cell", + "end_bias": "3 prime tag", + "strand": "second", + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 16, + "barcode_length": 10 + }, + "provenance": { + "document_id": "cc50851b-4c12-463b-b527-60d1c8d5ef60", + "submission_date": "2018-09-05T09:14:54.945Z", + "update_date": "2018-09-05T09:15:02.223Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "8b006d76-80c0-4e2c-866a-01fa5e900ab5", + "inputs": [ + "932dae75-ba79-42a6-915a-c6a67b39835c" + ], + "input_type": "biomaterial", + "outputs": [ + "4d3839bf-e39f-4136-92a4-6f7009e88567" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "cc50851b-4c12-463b-b527-60d1c8d5ef60" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "29150a65-718c-46bc-8a7f-11ac585bf959" + } + ] + }, + { + "process": "a85a679d-38f0-4eb2-bfce-ed0e621769c8", + "inputs": [ + "8909e260-7472-4c95-a96e-05d53d3c9221" + ], + "input_type": "biomaterial", + "outputs": [ + "932dae75-ba79-42a6-915a-c6a67b39835c" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "f1f2f791-f5f0-4eaa-8a4d-d6de9cf6807b" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "e8c1f3fe-d694-467c-a823-01426f44ed71" + } + ] + } + ] + }, + "process_0.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "8b006d76-80c0-4e2c-866a-01fa5e900ab5", + "submission_date": "2018-09-05T09:14:54.996Z", + "update_date": "2018-09-05T09:15:03.169Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_29" + }, + "schema_type": "process", + "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "a85a679d-38f0-4eb2-bfce-ed0e621769c8", + "submission_date": "2018-09-05T09:14:55.295Z", + "update_date": "2018-09-05T09:15:05.629Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Tissue stability", + "project_title": "Ischaemic sensitivity of human tissue by single cell RNA seq", + "project_description": "Assessment of ischaemic sensitivity of human tissues using 10x 3' single cell RNA sequencing. Currently, this project contains data for spleen and oesophagus. Ultimately we aim to collect data from three tissues expected to have different sensitivity to ischaemia: spleen (expected least sensitive), oesophagus (in the middle), and lung. Samples will be collected fresh (i.e. as soon as possible) and at 12h, 24h, and 72h post onset of ischaemia in the donor. Single cell RNA sequencing data will be generated at each time point using the 10x genomics single cell 3' method." + }, + "insdc_project": "ERP107913", + "insdc_study": "PRJEB25946", + "contributors": [ + { + "contact_name": "Mike,,Stubbington", + "email": "ms31@sanger.ac.uk", + "phone": "44 (0)1223 834244", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Human Cell Atlas (Mike Stubbington)", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK", + "orcid_id": "0000-0001-5924-3566" + }, + { + "contact_name": "Phillipa,,Harding", + "email": "ph11@sanger.ac.uk", + "phone": "44 (0)1223 834244", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Human Cell Atlas (Mike Stubbington)", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK" + }, + { + "contact_name": "Anna,,Wilbrey-Clark", + "email": "aw24@sanger.ac.uk", + "phone": "44 (0)1223 834244", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Human Cell Atlas (Mike Stubbington)", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK" + }, + { + "contact_name": "Krzysztof,,Polanski", + "email": "kp9@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Human Cell Atlas (Mike Stubbington)", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK" + }, + { + "contact_name": "Kevin,,Loudon", + "email": "kevinloudon@doctors.org.uk", + "institution": "University of Cambridge", + "laboratory": "Molecular Immunity Unit, Department of Medicine", + "address": "Cambridge CB2 0QQ", + "country": "UK" + }, + { + "contact_name": "John,R,Ferdinand", + "email": "jrf58@cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "Molecular Immunity Unit, Department of Medicine", + "address": "Cambridge CB2 0QQ", + "country": "UK", + "orcid_id": "0000-0003-0936-0128" + }, + { + "contact_name": "Krishnaa,,Mahbubani", + "email": "ktam2@cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "Cambridge Biorepository for Translational Medicine", + "address": "Cambridge CB2 0QQ", + "country": "UK" + }, + { + "contact_name": "Nikitas,,Georgakopoulos", + "email": "ng395@cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "Cambridge Biorepository for Translational Medicine", + "address": "Cambridge CB2 0QQ", + "country": "UK" + }, + { + "contact_name": "Kerstin,B,Meyer", + "email": "km16@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Kourosh,,Saeb-Parsy", + "email": "ks10014@cam.ac.uk", + "institution": "University of Cambridge", + "address": "Cambridge CB2 0QQ", + "country": "UK" + }, + { + "contact_name": "Karol,,Nowicki-Osuch", + "email": "kpn25@mrc-cu.cam.ac.uk", + "institution": "MRC Cancer Unit", + "laboratory": "Rebecca Fitzgerald", + "address": "MRC Cancer Unit, Hutchison-MRC Research Centre, University of Cambridge, Cambridge CB2 0XZ.", + "country": "UK" + }, + { + "contact_name": "Rebecca,,Fitzgerald", + "email": "rcf29@mrc-cu.cam.ac.uk", + "institution": "MRC Cancer Unit", + "laboratory": "Rebecca Fitzgerald", + "address": "MRC Cancer Unit, Hutchison-MRC Research Centre, University of Cambridge, Cambridge CB2 0XZ.", + "country": "UK" + }, + { + "contact_name": "Ricardo,J,Miragaia", + "email": "rm13@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "laboratory": "Human Cell Atlas (Sarah Teichmann)", + "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", + "country": "UK" + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Danielle,,Welter", + "email": "dwelter@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-1058-2668", + "corresponding_contributor": false + } + ], + "provenance": { + "document_id": "e7043342-977a-4f43-b382-d2a4f0932b56", + "submission_date": "2018-09-05T09:14:54.288Z", + "update_date": "2018-09-05T09:15:01.681Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "HCATisStabAug177078016_S1_L001_I1_001.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "index1", + "lane_index": 1, + "insdc_run": [ + "ERR2508319" + ], + "provenance": { + "document_id": "4d3839bf-e39f-4136-92a4-6f7009e88567", + "submission_date": "2018-09-05T09:14:54.400Z", + "update_date": "2018-09-05T09:14:56.841Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "10x_v2 sequencing", + "protocol_description": "ChromiumTM Single Cell 3' Library & Gel Bead Kit v2", + "document": "10x_sequencing_protocol.pdf" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 4000", + "ontology": "EFO:0008563" + }, + "paired_end": true, + "sequencing_approach": { + "text": "tag based single cell RNA sequencing", + "ontology": "EFO:0008440" + }, + "provenance": { + "document_id": "29150a65-718c-46bc-8a7f-11ac585bf959", + "submission_date": "2018-09-05T09:14:54.986Z", + "update_date": "2018-09-05T09:15:02.167Z" + } + }, + "supplementary_file_0.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "SOP_MACS Live Dead Separation V3.pdf", + "file_format": "pdf", + "checksum": "NEED" + }, + "file_description": "Enrichment for live cells", + "provenance": { + "document_id": "c3ce4634-ba98-45a7-a546-a2e3f4873d4c", + "submission_date": "2018-09-05T09:14:54.357Z", + "update_date": "2018-09-05T09:14:56.869Z" + } + }, + "supplementary_file_1.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Human_spleen_dissociation_protocol.pdf", + "file_format": "pdf" + }, + "file_description": "Dissociation of spleen tissue sample into cell suspension.", + "provenance": { + "document_id": "f973157b-0dfa-48aa-b790-faef283a513d", + "submission_date": "2018-09-05T09:14:54.313Z", + "update_date": "2018-09-05T09:14:56.831Z" + } + }, + "supplementary_file_2.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "SOP - Human Oesophagus Dissociation 19.02.18.pdf", + "file_format": "pdf", + "checksum": "NEED" + }, + "file_description": "Dissociation of human oesophagus epithelium into single cell suspension", + "provenance": { + "document_id": "339458c4-c7ab-4ee1-9071-999af6d16d47", + "submission_date": "2018-09-05T09:14:54.382Z", + "update_date": "2018-09-05T09:14:56.806Z" + } + }, + "supplementary_file_3.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Clinical_metadata.xlsx", + "file_format": "xlsx", + "checksum": "NEED" + }, + "file_description": "Clinical metadata about donors.", + "provenance": { + "document_id": "903bc97d-addf-45fa-ae35-cf7e31d0c20b", + "submission_date": "2018-09-05T09:14:54.333Z", + "update_date": "2018-09-05T09:14:56.827Z" + } + }, + "supplementary_file_4.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "10x_sequencing_protocol.pdf", + "file_format": "pdf" + }, + "file_description": "Sequencing and library preparation protocol.", + "provenance": { + "document_id": "e9000e63-4ead-468d-826a-9bea0a1c68ab", + "submission_date": "2018-09-05T09:14:54.301Z", + "update_date": "2018-09-05T09:14:56.827Z" + } + }, + "supplementary_file_5.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Experimental_report.pdf", + "file_format": "pdf" + }, + "provenance": { + "document_id": "529fd903-f4b9-44a9-b32f-047d359ad541", + "submission_date": "2018-09-05T09:14:54.323Z", + "update_date": "2018-09-05T09:14:56.872Z" + } + }, + "supplementary_file_6.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "SOP-Mechanical Human Spleen Dissociation 19.02.17.pdf", + "file_format": "pdf", + "checksum": "NEED" + }, + "file_description": "Dissociation of spleen tissue sample into cell suspension", + "provenance": { + "document_id": "9904d58a-4a23-4099-b885-3bdefac39b20", + "submission_date": "2018-09-05T09:14:54.367Z", + "update_date": "2018-09-05T09:14:56.865Z" + } + }, + "supplementary_file_7.json": { + "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "284C_IMAGE_spleen_annotated.jpeg", + "file_format": "jpeg" + }, + "file_description": "Gross image of specimen location in spleen.", + "provenance": { + "document_id": "f863f044-f904-4bf2-8535-fa45f123f237", + "submission_date": "2018-09-05T09:14:54.346Z", + "update_date": "2018-09-05T09:14:55.825Z" + } + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json b/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json deleted file mode 100644 index 876ed60c1..000000000 --- a/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/manifest.json +++ /dev/null @@ -1,338 +0,0 @@ -[ - { - "crc32c": "FD971A18", - "sha1": "1792e28d776e30795ae12ded550a90507afd4d3a", - "sha256": "b7e4ab204e7808382ea766362a03b7574740661c9f0de9ad9d6a57902b5db3ed", - "s3_etag": "0106da2e5d49b7db21e8fddf0db50e02", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "cell_suspension_0.json", - "size": 774, - "uuid": "51215dbc-2dfd-4969-a54e-c39191a0a257", - "version": "1" - }, - { - "crc32c": "94D6B49F", - "sha1": "df275d2538f4a4d268b5bb73a1f13a9694ffeac9", - "sha256": "d894880e4255dde12d025dbcf970e4463ef33d373823f96a6ff6f8d86319b928", - "s3_etag": "a7ae9463b86a2e892bb0f004b5178127", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "dissociation_protocol_0.json", - "size": 684, - "uuid": "75c81e22-2775-4c59-9c3a-7744f1e5fb85", - "version": "1" - }, - { - "crc32c": "A1D20ADB", - "sha1": "8a7bb7964b04a893322b0661e24acf8f57286ad1", - "sha256": "0c96bd6b8ec27b590794cb75cd412171f50c97ca7f54f5a37034af68124dd1a5", - "s3_etag": "149fb07a5176a4e1cb059453b2e4c410", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "donor_organism_0.json", - "size": 1640, - "uuid": "9ce282f9-92fa-410f-a900-1b60520e3ae6", - "version": "1" - }, - { - "crc32c": "C0295A94", - "sha1": "9451c7750b4fc01710a01fd7e6ee134db4c9aee3", - "sha256": "f35e073ca46f7c1aa632786cb8c1a448c06d89c1886b07d6a657b9eea966c052", - "s3_etag": "84e0dcc1737b33b2416b28d2d72e34dc", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "enrichment_protocol_0.json", - "size": 694, - "uuid": "598ed21e-d90f-49af-8c97-5b140f91c079", - "version": "1" - }, - { - "crc32c": "AF32195B", - "sha1": "8ecdb54e2ed451cfc22c52ca1d8ebefdf6c72e58", - "sha256": "d57e8aba16e12fedbef5b8b6857d63054fc4968f82cce2398d45a3d8c0105f2c", - "s3_etag": "4d85ae4c4d84894373f7af664d92c9fa", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "size": 1206, - "uuid": "1d64e884-84c1-438e-8f1b-7d42698942ad", - "version": "1" - }, - { - "crc32c": "C1574314", - "sha1": "086e0e40e88c2ed0b4a1c68a3f2fd88e66454e6e", - "sha256": "88fa107073946ff3a01455ebeca62cb7a8c8253a10f90c68f8c37078f00be627", - "s3_etag": "151fe404519e0934fa5e24772d8002d6", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "links.json", - "size": 1643, - "uuid": "62f4b747-7bf2-4af5-b710-723a060f0d35", - "version": "1" - }, - { - "crc32c": "D044B620", - "sha1": "15c4e8085308b8f297b9b682c8aa892514e476de", - "sha256": "743e4240381a969032e2e305a7a63e839d979cd1072fe67c816278a9f97820cb", - "s3_etag": "3992069444c9940b70bc8e6e8c062b59", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_0.json", - "size": 384, - "uuid": "d7c8d181-105d-416c-a5a5-e7f353be7684", - "version": "1" - }, - { - "crc32c": "0A2A3547", - "sha1": "23b48a154f75c0fa5c898f6e6f5031a7b321f35e", - "sha256": "d120b433ae3926595c6704b7d0b2680cd8a72ba525c5cf1b796badd1473fe610", - "s3_etag": "469107dc5f22cfe005fd47e0c2d0c36b", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "process_1.json", - "size": 385, - "uuid": "d4528d9e-291d-4506-96fc-6e9304524aca", - "version": "1" - }, - { - "crc32c": "171D9018", - "sha1": "93d5db855b02ccc905738b3f09b4e9f837340631", - "sha256": "e9423d52f8c7dc689ba6da72c5a41571731d766f6116c2faab2b185bceebde1e", - "s3_etag": "e4b9286fc2cb939eb4938198ade2400d", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "project_0.json", - "size": 6850, - "uuid": "270801af-47a4-48eb-a7c0-684f2573e99a", - "version": "1" - }, - { - "crc32c": "5E314552", - "sha1": "0caf6b4d52c6095fe9b78eae9f12f4b2e7bdee3b", - "sha256": "e7f7e93c198d758a084d0ef4065b0314ba7365a72eeccc77f3b6368e4b951308", - "s3_etag": "86e0aff5a1b15c1a9c4f396f4ebcd2ed", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequence_file_0.json", - "size": 545, - "uuid": "20c3551f-28a5-4a80-9524-04e32d534cb9", - "version": "1" - }, - { - "crc32c": "5E314552", - "sha1": "0caf6b4d52c6095fe9b78eae9f12f4b2e7bdee3b", - "sha256": "e7f7e93c198d758a084d0ef4065b0314ba7365a72eeccc77f3b6368e4b951308", - "s3_etag": "86e0aff5a1b15c1a9c4f396f4ebcd2ed", - "content-type": "application/octet-stream", - "indexed": false, - "name": "HCATisStabAug177078016_S1_L001_I1_001.fastq.gz", - "size": 545, - "uuid": "72b3bd3f-1874-4636-bffe-0ab382cf6d72", - "version": "1" - }, - { - "crc32c": "37EAF626", - "sha1": "360c9664a9d4a329095bfc91ce6986f456d1e9b8", - "sha256": "f54208dc2d31664b06e4bae1052a137e98b6e78756e432f016474f72e7888823", - "s3_etag": "161390a17a35f0c1b0a7b7ab4d0e4724", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "sequencing_protocol_0.json", - "size": 873, - "uuid": "aa0b00f1-794e-410c-a2c4-ff8e52871cc8", - "version": "1" - }, - { - "crc32c": "5BA5B282", - "sha1": "6c65e7c34a953a96a9991e302a367999f0612fab", - "sha256": "fced35e7be4a017707f154e25a16f4b8f5287f636909d7d4c1ef4802cc090c78", - "s3_etag": "098f7bdf35bb0508201e3b13e894cee0", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_0.json", - "size": 520, - "uuid": "22f718f3-5e93-48eb-acdd-b076ecf70ae8", - "version": "1" - }, - { - "crc32c": "5BA5B282", - "sha1": "6c65e7c34a953a96a9991e302a367999f0612fab", - "sha256": "fced35e7be4a017707f154e25a16f4b8f5287f636909d7d4c1ef4802cc090c78", - "s3_etag": "098f7bdf35bb0508201e3b13e894cee0", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SOP_MACS Live Dead Separation V3.pdf", - "size": 520, - "uuid": "e0e51494-0793-4145-b10e-32d0c48f7905", - "version": "1" - }, - { - "crc32c": "CAD4F2CE", - "sha1": "595994145200f0ad7917bb019f86164e6bcc58e8", - "sha256": "a01dcb62b1948ea2b998b2e763a9aa5d888072c0e71c6c324c9aa1c2b9ed13d4", - "s3_etag": "06d38e739da0ab85b142bc5d48036a2e", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_1.json", - "size": 527, - "uuid": "7d6e3740-5656-42ed-ae6d-01956eb3bd27", - "version": "1" - }, - { - "crc32c": "CAD4F2CE", - "sha1": "595994145200f0ad7917bb019f86164e6bcc58e8", - "sha256": "a01dcb62b1948ea2b998b2e763a9aa5d888072c0e71c6c324c9aa1c2b9ed13d4", - "s3_etag": "06d38e739da0ab85b142bc5d48036a2e", - "content-type": "application/octet-stream", - "indexed": false, - "name": "Human_spleen_dissociation_protocol.pdf", - "size": 527, - "uuid": "81f61d0b-514d-47c5-814d-e238996ecab2", - "version": "1" - }, - { - "crc32c": "92435DE6", - "sha1": "e6928d497f33a976aa49ee799358f3b2f048196b", - "sha256": "4b05be3a55ad520d3d3afd0b0e1c9f82b5ed7e0b1feb9b57c0283b7e430f0f38", - "s3_etag": "4c8a685c90633f44fe4af0cddcec3c07", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_2.json", - "size": 578, - "uuid": "7ab744b1-aae4-4585-afa6-e36a77181a23", - "version": "1" - }, - { - "crc32c": "92435DE6", - "sha1": "e6928d497f33a976aa49ee799358f3b2f048196b", - "sha256": "4b05be3a55ad520d3d3afd0b0e1c9f82b5ed7e0b1feb9b57c0283b7e430f0f38", - "s3_etag": "4c8a685c90633f44fe4af0cddcec3c07", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SOP - Human Oesophagus Dissociation 19.02.18.pdf", - "size": 578, - "uuid": "0b251162-aeb6-418b-b313-49602512745e", - "version": "1" - }, - { - "crc32c": "03D66B96", - "sha1": "225ec6c9f8675206e628611b2bf2dbb4a24b5765", - "sha256": "be3904db8cdb8deba1619eed9ec227071d842c874c61676eaa9a6bf8afd73156", - "s3_etag": "bb7bd150105d8047e0c823f825dd0051", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_3.json", - "size": 513, - "uuid": "60007975-aaf8-419c-99e6-30cead3972d3", - "version": "1" - }, - { - "crc32c": "03D66B96", - "sha1": "225ec6c9f8675206e628611b2bf2dbb4a24b5765", - "sha256": "be3904db8cdb8deba1619eed9ec227071d842c874c61676eaa9a6bf8afd73156", - "s3_etag": "bb7bd150105d8047e0c823f825dd0051", - "content-type": "application/octet-stream", - "indexed": false, - "name": "Clinical_metadata.xlsx", - "size": 513, - "uuid": "7b8da1fb-e6c2-4fc1-b370-11fa9698939f", - "version": "1" - }, - { - "crc32c": "455326F9", - "sha1": "f1cc033ec095cf812f0d2ad0689d277b271523e5", - "sha256": "023f39b768280f66d91cf9cc7771d14c1a0f893ecd96d4727ec6206d99041922", - "s3_etag": "1366c0d41b7ed73229d5f1177146448a", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_4.json", - "size": 502, - "uuid": "81fae654-25f7-430e-9829-9e8ccd2f3098", - "version": "1" - }, - { - "crc32c": "455326F9", - "sha1": "f1cc033ec095cf812f0d2ad0689d277b271523e5", - "sha256": "023f39b768280f66d91cf9cc7771d14c1a0f893ecd96d4727ec6206d99041922", - "s3_etag": "1366c0d41b7ed73229d5f1177146448a", - "content-type": "application/octet-stream", - "indexed": false, - "name": "10x_sequencing_protocol.pdf", - "size": 502, - "uuid": "a0e29103-23b1-4570-a335-29ab7e4de062", - "version": "1" - }, - { - "crc32c": "76070BE8", - "sha1": "8c6fd1a6af8c050415b42795e40975ce0e685d1b", - "sha256": "ade3a42aa52b0159f8cafdf112119632ec06fc9eefe3a8846e7431e02b1dca87", - "s3_etag": "807c710c0d280481e634f68ab1926046", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_5.json", - "size": 426, - "uuid": "a59afc52-7104-4bcc-9c48-8d29ec26f142", - "version": "1" - }, - { - "crc32c": "76070BE8", - "sha1": "8c6fd1a6af8c050415b42795e40975ce0e685d1b", - "sha256": "ade3a42aa52b0159f8cafdf112119632ec06fc9eefe3a8846e7431e02b1dca87", - "s3_etag": "807c710c0d280481e634f68ab1926046", - "content-type": "application/octet-stream", - "indexed": false, - "name": "Experimental_report.pdf", - "size": 426, - "uuid": "06403366-b0af-455b-b5e7-ec7cfbacb791", - "version": "1" - }, - { - "crc32c": "FCA6B2B2", - "sha1": "05e3276d65e86b46b080243380ca92954fa8e46d", - "sha256": "32f7948b17e53588ba1c7ebe2c0ea11560eeb232b1d626e3d24a82d46a035140", - "s3_etag": "92bfdbbfaed67053422af7be835392a4", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_6.json", - "size": 569, - "uuid": "3c6e7cca-4b71-4440-9bfe-7fbb6e8d64f7", - "version": "1" - }, - { - "crc32c": "FCA6B2B2", - "sha1": "05e3276d65e86b46b080243380ca92954fa8e46d", - "sha256": "32f7948b17e53588ba1c7ebe2c0ea11560eeb232b1d626e3d24a82d46a035140", - "s3_etag": "92bfdbbfaed67053422af7be835392a4", - "content-type": "application/octet-stream", - "indexed": false, - "name": "SOP-Mechanical Human Spleen Dissociation 19.02.17.pdf", - "size": 569, - "uuid": "aa155ec7-5ef5-4a22-9907-23019097fba0", - "version": "1" - }, - { - "crc32c": "A5FA937C", - "sha1": "8b8325fffab6dff50944126ad95ff44776128440", - "sha256": "ab30dc7402b9d849adf90f1433b952f005a56a6989c6a0306901d7dbeac203d8", - "s3_etag": "c0c8a11d34500469afd134a264ff94cd", - "content-type": "application/json; dcp-type=\"metadata/json\"", - "indexed": true, - "name": "supplementary_file_7.json", - "size": 507, - "uuid": "56e64272-c762-47d8-b49b-cd15436edabf", - "version": "1" - }, - { - "crc32c": "A5FA937C", - "sha1": "8b8325fffab6dff50944126ad95ff44776128440", - "sha256": "ab30dc7402b9d849adf90f1433b952f005a56a6989c6a0306901d7dbeac203d8", - "s3_etag": "c0c8a11d34500469afd134a264ff94cd", - "content-type": "application/octet-stream", - "indexed": false, - "name": "284C_IMAGE_spleen_annotated.jpeg", - "size": 507, - "uuid": "769901d5-ef88-4c45-b83c-5bf9a97d59d2", - "version": "1" - } -] diff --git a/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json b/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json deleted file mode 100644 index c0e73bdfc..000000000 --- a/test/hca_metadata_api/cans/examples/Tissue stability/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-08-03T082009.272868Z/metadata.json +++ /dev/null @@ -1,538 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "A1-Spl-0-TL5_cells", - "biomaterial_name": "cells from fresh spleen", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA1098924", - "insdc_biomaterial": "ERS2392443" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "total_estimated_cells": 1970, - "provenance": { - "document_id": "932dae75-ba79-42a6-915a-c6a67b39835c", - "submission_date": "2018-09-05T09:14:54.798Z", - "update_date": "2018-09-05T09:15:05.597Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "Dissociation of spleen tissue sample into cell suspension", - "document": "Human_spleen_dissociation_protocol.pdf" - }, - "dissociation_method": { - "text": "mechanical", - "ontology": "EFO:0009129" - }, - "provenance": { - "document_id": "f1f2f791-f5f0-4eaa-8a4d-d6de9cf6807b", - "submission_date": "2018-09-05T09:14:54.916Z", - "update_date": "2018-09-05T09:15:02.163Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/biomaterial/10.1.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "284C-A1", - "biomaterial_name": "284C-spleen", - "biomaterial_description": "Spleen", - "ncbi_taxon_id": [ - 9606 - ] - }, - "death": { - "cause_of_death": "Hypoxic brain damage", - "cold_perfused": true, - "organ_donation_death_type": "Donation after circulatory death (DCD)" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "is_living": "no", - "sex": "male", - "organism_age": "55-60", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "height": "1.75-1.8", - "height_unit": { - "text": "meter", - "ontology": "UO:0000008" - }, - "weight": "80-85", - "weight_unit": { - "text": "kilogram", - "ontology": "UO:0000009" - }, - "medical_history": { - "alcohol_history": "3-6 units/day", - "smoking_history": "Smoker, 20/day for 25 years, stopped 2000" - }, - "normothermic_regional_perfusion": "yes", - "provenance": { - "document_id": "8909e260-7472-4c95-a96e-05d53d3c9221", - "submission_date": "2018-09-05T09:14:54.658Z", - "update_date": "2018-09-05T09:15:03.935Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_1", - "protocol_name": "Enrichment for live cells", - "document": "Human_spleen_dissociation_protocol.pdf" - }, - "enrichment_method": { - "text": "magnetic affinity cell sorting", - "ontology": "EFO:0009109" - }, - "markers": "LiveCells", - "provenance": { - "document_id": "e8c1f3fe-d694-467c-a823-01426f44ed71", - "submission_date": "2018-09-05T09:14:54.896Z", - "update_date": "2018-09-05T09:15:02.160Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/4.3.2/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Library preparation for 10x_v2 sequencing", - "protocol_description": "ChromiumTM Single Cell 3' Library & Gel Bead Kit v2", - "document": "10x_sequencing_protocol.pdf" - }, - "cell_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_approach": { - "text": "10X sequencing", - "ontology": "EFO:0008995" - }, - "nucleic_acid_source": "single cell", - "end_bias": "3 prime tag", - "strand": "second", - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 16, - "barcode_length": 10 - }, - "provenance": { - "document_id": "cc50851b-4c12-463b-b527-60d1c8d5ef60", - "submission_date": "2018-09-05T09:14:54.945Z", - "update_date": "2018-09-05T09:15:02.223Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "8b006d76-80c0-4e2c-866a-01fa5e900ab5", - "inputs": [ - "932dae75-ba79-42a6-915a-c6a67b39835c" - ], - "input_type": "biomaterial", - "outputs": [ - "4d3839bf-e39f-4136-92a4-6f7009e88567" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "cc50851b-4c12-463b-b527-60d1c8d5ef60" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "29150a65-718c-46bc-8a7f-11ac585bf959" - } - ] - }, - { - "process": "a85a679d-38f0-4eb2-bfce-ed0e621769c8", - "inputs": [ - "8909e260-7472-4c95-a96e-05d53d3c9221" - ], - "input_type": "biomaterial", - "outputs": [ - "932dae75-ba79-42a6-915a-c6a67b39835c" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "f1f2f791-f5f0-4eaa-8a4d-d6de9cf6807b" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "e8c1f3fe-d694-467c-a823-01426f44ed71" - } - ] - } - ] - }, - "process_0.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "8b006d76-80c0-4e2c-866a-01fa5e900ab5", - "submission_date": "2018-09-05T09:14:54.996Z", - "update_date": "2018-09-05T09:15:03.169Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_29" - }, - "schema_type": "process", - "describedBy": "http://schema.dev.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "a85a679d-38f0-4eb2-bfce-ed0e621769c8", - "submission_date": "2018-09-05T09:14:55.295Z", - "update_date": "2018-09-05T09:15:05.629Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/project/9.0.2/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Tissue stability", - "project_title": "Ischaemic sensitivity of human tissue by single cell RNA seq", - "project_description": "Assessment of ischaemic sensitivity of human tissues using 10x 3' single cell RNA sequencing. Currently, this project contains data for spleen and oesophagus. Ultimately we aim to collect data from three tissues expected to have different sensitivity to ischaemia: spleen (expected least sensitive), oesophagus (in the middle), and lung. Samples will be collected fresh (i.e. as soon as possible) and at 12h, 24h, and 72h post onset of ischaemia in the donor. Single cell RNA sequencing data will be generated at each time point using the 10x genomics single cell 3' method." - }, - "insdc_project": "ERP107913", - "insdc_study": "PRJEB25946", - "contributors": [ - { - "contact_name": "Mike,,Stubbington", - "email": "ms31@sanger.ac.uk", - "phone": "44 (0)1223 834244", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Human Cell Atlas (Mike Stubbington)", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK", - "orcid_id": "0000-0001-5924-3566" - }, - { - "contact_name": "Phillipa,,Harding", - "email": "ph11@sanger.ac.uk", - "phone": "44 (0)1223 834244", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Human Cell Atlas (Mike Stubbington)", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK" - }, - { - "contact_name": "Anna,,Wilbrey-Clark", - "email": "aw24@sanger.ac.uk", - "phone": "44 (0)1223 834244", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Human Cell Atlas (Mike Stubbington)", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK" - }, - { - "contact_name": "Krzysztof,,Polanski", - "email": "kp9@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Human Cell Atlas (Mike Stubbington)", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK" - }, - { - "contact_name": "Kevin,,Loudon", - "email": "kevinloudon@doctors.org.uk", - "institution": "University of Cambridge", - "laboratory": "Molecular Immunity Unit, Department of Medicine", - "address": "Cambridge CB2 0QQ", - "country": "UK" - }, - { - "contact_name": "John,R,Ferdinand", - "email": "jrf58@cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "Molecular Immunity Unit, Department of Medicine", - "address": "Cambridge CB2 0QQ", - "country": "UK", - "orcid_id": "0000-0003-0936-0128" - }, - { - "contact_name": "Krishnaa,,Mahbubani", - "email": "ktam2@cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "Cambridge Biorepository for Translational Medicine", - "address": "Cambridge CB2 0QQ", - "country": "UK" - }, - { - "contact_name": "Nikitas,,Georgakopoulos", - "email": "ng395@cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "Cambridge Biorepository for Translational Medicine", - "address": "Cambridge CB2 0QQ", - "country": "UK" - }, - { - "contact_name": "Kerstin,B,Meyer", - "email": "km16@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Kourosh,,Saeb-Parsy", - "email": "ks10014@cam.ac.uk", - "institution": "University of Cambridge", - "address": "Cambridge CB2 0QQ", - "country": "UK" - }, - { - "contact_name": "Karol,,Nowicki-Osuch", - "email": "kpn25@mrc-cu.cam.ac.uk", - "institution": "MRC Cancer Unit", - "laboratory": "Rebecca Fitzgerald", - "address": "MRC Cancer Unit, Hutchison-MRC Research Centre, University of Cambridge, Cambridge CB2 0XZ.", - "country": "UK" - }, - { - "contact_name": "Rebecca,,Fitzgerald", - "email": "rcf29@mrc-cu.cam.ac.uk", - "institution": "MRC Cancer Unit", - "laboratory": "Rebecca Fitzgerald", - "address": "MRC Cancer Unit, Hutchison-MRC Research Centre, University of Cambridge, Cambridge CB2 0XZ.", - "country": "UK" - }, - { - "contact_name": "Ricardo,J,Miragaia", - "email": "rm13@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "laboratory": "Human Cell Atlas (Sarah Teichmann)", - "address": "Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge. CB10 1SA.", - "country": "UK" - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Danielle,,Welter", - "email": "dwelter@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-1058-2668", - "corresponding_contributor": false - } - ], - "provenance": { - "document_id": "e7043342-977a-4f43-b382-d2a4f0932b56", - "submission_date": "2018-09-05T09:14:54.288Z", - "update_date": "2018-09-05T09:15:01.681Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "HCATisStabAug177078016_S1_L001_I1_001.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "index1", - "lane_index": 1, - "insdc_run": [ - "ERR2508319" - ], - "provenance": { - "document_id": "4d3839bf-e39f-4136-92a4-6f7009e88567", - "submission_date": "2018-09-05T09:14:54.400Z", - "update_date": "2018-09-05T09:14:56.841Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "10x_v2 sequencing", - "protocol_description": "ChromiumTM Single Cell 3' Library & Gel Bead Kit v2", - "document": "10x_sequencing_protocol.pdf" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 4000", - "ontology": "EFO:0008563" - }, - "paired_end": true, - "sequencing_approach": { - "text": "tag based single cell RNA sequencing", - "ontology": "EFO:0008440" - }, - "provenance": { - "document_id": "29150a65-718c-46bc-8a7f-11ac585bf959", - "submission_date": "2018-09-05T09:14:54.986Z", - "update_date": "2018-09-05T09:15:02.167Z" - } - }, - "supplementary_file_0.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "SOP_MACS Live Dead Separation V3.pdf", - "file_format": "pdf", - "checksum": "NEED" - }, - "file_description": "Enrichment for live cells", - "provenance": { - "document_id": "c3ce4634-ba98-45a7-a546-a2e3f4873d4c", - "submission_date": "2018-09-05T09:14:54.357Z", - "update_date": "2018-09-05T09:14:56.869Z" - } - }, - "supplementary_file_1.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Human_spleen_dissociation_protocol.pdf", - "file_format": "pdf" - }, - "file_description": "Dissociation of spleen tissue sample into cell suspension.", - "provenance": { - "document_id": "f973157b-0dfa-48aa-b790-faef283a513d", - "submission_date": "2018-09-05T09:14:54.313Z", - "update_date": "2018-09-05T09:14:56.831Z" - } - }, - "supplementary_file_2.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "SOP - Human Oesophagus Dissociation 19.02.18.pdf", - "file_format": "pdf", - "checksum": "NEED" - }, - "file_description": "Dissociation of human oesophagus epithelium into single cell suspension", - "provenance": { - "document_id": "339458c4-c7ab-4ee1-9071-999af6d16d47", - "submission_date": "2018-09-05T09:14:54.382Z", - "update_date": "2018-09-05T09:14:56.806Z" - } - }, - "supplementary_file_3.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Clinical_metadata.xlsx", - "file_format": "xlsx", - "checksum": "NEED" - }, - "file_description": "Clinical metadata about donors.", - "provenance": { - "document_id": "903bc97d-addf-45fa-ae35-cf7e31d0c20b", - "submission_date": "2018-09-05T09:14:54.333Z", - "update_date": "2018-09-05T09:14:56.827Z" - } - }, - "supplementary_file_4.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "10x_sequencing_protocol.pdf", - "file_format": "pdf" - }, - "file_description": "Sequencing and library preparation protocol.", - "provenance": { - "document_id": "e9000e63-4ead-468d-826a-9bea0a1c68ab", - "submission_date": "2018-09-05T09:14:54.301Z", - "update_date": "2018-09-05T09:14:56.827Z" - } - }, - "supplementary_file_5.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Experimental_report.pdf", - "file_format": "pdf" - }, - "provenance": { - "document_id": "529fd903-f4b9-44a9-b32f-047d359ad541", - "submission_date": "2018-09-05T09:14:54.323Z", - "update_date": "2018-09-05T09:14:56.872Z" - } - }, - "supplementary_file_6.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "SOP-Mechanical Human Spleen Dissociation 19.02.17.pdf", - "file_format": "pdf", - "checksum": "NEED" - }, - "file_description": "Dissociation of spleen tissue sample into cell suspension", - "provenance": { - "document_id": "9904d58a-4a23-4099-b885-3bdefac39b20", - "submission_date": "2018-09-05T09:14:54.367Z", - "update_date": "2018-09-05T09:14:56.865Z" - } - }, - "supplementary_file_7.json": { - "describedBy": "http://schema.dev.data.humancellatlas.org/type/file/1.1.3/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "284C_IMAGE_spleen_annotated.jpeg", - "file_format": "jpeg" - }, - "file_description": "Gross image of specimen location in spleen.", - "provenance": { - "document_id": "f863f044-f904-4bf2-8535-fa45f123f237", - "submission_date": "2018-09-05T09:14:54.346Z", - "update_date": "2018-09-05T09:14:55.825Z" - } - } -} diff --git a/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000.2019-01-03T163633.780215Z.json b/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000.2019-01-03T163633.780215Z.json new file mode 100644 index 000000000..bb2a50bf8 --- /dev/null +++ b/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000.2019-01-03T163633.780215Z.json @@ -0,0 +1,2049 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "afa286ee", + "indexed": true, + "name": "cell_suspension_0.json", + "sha1": "9300432ea2bf3550791904b26f824dbc547178dc", + "sha256": "1ae2592f34e00d6c322a660f5cde9a943304bc4f59fc824c0fb2789e0dd4886f", + "size": 1032, + "uuid": "c2396f83-22e4-4a2d-8cce-a30feb533603", + "version": "2019-01-03T120803.256000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "4235974a", + "indexed": true, + "name": "organoid_0.json", + "s3_etag": "5195c84d0f7054aea3323fd948f5e511", + "sha256": "21a2f091afc05363f42cf1a7c08a121c934487873c34d8fc56bb47d20aa1b7cb", + "size": 1168, + "uuid": "a690df06-cc52-4346-a926-fe5e5b3a7547", + "version": "2019-01-03T120802.342000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "85ccc604", + "indexed": true, + "name": "organoid_1.json", + "sha256": "7ddccdaaf573866f4209286dd3c33e537ec2ef721ff8f9c0d09b1d7bcc696d9a", + "size": 1168, + "uuid": "f0b636ce-505c-4339-a69c-2305352b6796", + "version": "2019-01-03T120802.944000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "63a7a393", + "indexed": true, + "name": "organoid_2.json", + "s3_etag": "f7a0d0a3e693e85ea08052dfc44c2bce", + "sha1": "9b0ac909a7da9b5880a44012e56b2e117c785b0a", + "sha256": "9eef75155bbaa5c79cfc77827665b2f8067918b65ad0482303cd33db61b94f2f", + "size": 1168, + "uuid": "46e7ed04-5916-4c10-8a05-fe510eda819a", + "version": "2019-01-03T120802.497000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "d8c2c98c", + "indexed": true, + "name": "organoid_3.json", + "s3_etag": "4c3cd57575bff9d04fe4573e25efcac6", + "sha1": "d4e0a390817ac5716d61c653165cc137a9011895", + "sha256": "bae81b043f76bd48176a6c5ccf2bc8a5e1d03e80a46a23d7c5021eaa042b2c4c", + "size": 1168, + "uuid": "d49998ff-c873-41fd-bb44-f221f89b8f15", + "version": "2019-01-03T120802.781000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "3cd2322f", + "indexed": true, + "name": "cell_line_0.json", + "s3_etag": "85961d8cbc047f0862d28f09221cd3e6", + "sha1": "efa33bef8ddba25abf573296a4df15b51054bfba", + "sha256": "b970cff1e46ad1acfe13f1fafee59e1d70a26790caf8fb4b913b9f586ffa1157", + "size": 1678, + "uuid": "a689172e-cae2-4e2c-b1d2-5aeff0a90171", + "version": "2019-01-03T120803.319000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ca683efb", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "4e9b5e737dae780305fd5989dc780dd1", + "sha1": "22ffc7d31d3cf1288dd622220cdfc714b4881e78", + "sha256": "676809680438caa238f96ec5bd57c2583119da75c4dc9f1302d1e8167a6fc870", + "size": 1257, + "uuid": "597b4050-0778-4a81-b882-e1704ab0b6ad", + "version": "2019-01-03T120803.189000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "598ba993", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "f06cf20ad6626e64bcfb40cc58c338eb", + "sha1": "0de454cd94d8b688172ad9eae61745b1798df118", + "sha256": "39166e66f23bd463433e7fac29eff5f2b49e79e4b86e435296aa878201ea9a8b", + "size": 1398, + "uuid": "4934d9c3-753b-47bc-b2d5-468ce255a139", + "version": "2019-01-03T120802.040000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "d01fdbf8", + "indexed": true, + "name": "cell_line_1.json", + "s3_etag": "2a687e214f7d1038c8a27737f16b6320", + "sha1": "29c1bb162dafaaee8bf540723c0e8c2dd2db97bf", + "sha256": "f057ec45975208ea545811718dc8d18a6bd3014590394bdad58fe0122b51670a", + "size": 1678, + "uuid": "37833da3-505d-4bb2-916e-26aa8985d183", + "version": "2019-01-03T120803.268000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "8e41e730", + "indexed": true, + "name": "specimen_from_organism_1.json", + "s3_etag": "e196f22360bd55a15bca6c0a502c7d80", + "sha1": "24d2cfcd3960bc8c2acb5505cd723260fcc1e3c7", + "sha256": "ca006d67545e3559b1d6f2678f5cdb281cc6f9c1f95bcacdaa76388e1fce13f9", + "size": 1257, + "uuid": "1fc181fe-60c6-4b94-85c1-1f227be60658", + "version": "2019-01-03T120803.087000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "03ac9a76", + "indexed": true, + "name": "donor_organism_1.json", + "s3_etag": "0571d5a3915257d7d9006fcc0419015e", + "sha1": "25d111b18c4be8dc54d79d86b19ff4b5e59a5ad0", + "sha256": "26f7b846c1113b715299c6bf18ee35061cfe5f83b201e81ef5742c8100b577e8", + "size": 1396, + "uuid": "7c3a6d87-9f43-4de5-b47d-6fa78a897624", + "version": "2019-01-03T120801.492000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "6c7d1fa2", + "indexed": true, + "name": "cell_line_2.json", + "s3_etag": "6efb331d562b34df5a37e97e8fc6fb5a", + "sha1": "66e983196ebc0ade70eae096568dfe3bb8915d9a", + "sha256": "2af9c3bbdfc3ed703e65d5d50025f6324cb3f88de58ae26292f9fa5c8465d989", + "size": 1678, + "uuid": "d954547d-94bc-401d-bdff-ccd727251c74", + "version": "2019-01-03T120803.322000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "83d1a919", + "indexed": true, + "name": "specimen_from_organism_2.json", + "s3_etag": "ef04ff3f06c4c8df62c9bfa293694941", + "sha1": "61d3cc9c8634cec08982bbc8752575bcb420b7aa", + "sha256": "b829951cb42c9874c322d9814a435a58eb13085b166dec0110d3c3003c789c1f", + "size": 1257, + "uuid": "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b", + "version": "2019-01-03T120802.789000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ead1dfb1", + "indexed": true, + "name": "donor_organism_2.json", + "s3_etag": "d0b0f8a0ab16faff1a998f387c5efc4e", + "sha1": "c5cf07458adaabc2e73b20d313f84eed28fae953", + "sha256": "045855bbf12635ecf201f0deaae20545f326232febbaca18b82dc6aeb44d4872", + "size": 1398, + "uuid": "3322ea3a-30ea-4e6e-b187-18525de4ee3e", + "version": "2019-01-03T120802.270000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "cb757d6c", + "indexed": true, + "name": "cell_line_3.json", + "s3_etag": "3ae0bcec51465a494e66f9a642cb0938", + "sha1": "2926de34f6defbb183d6ec5394b1108fe824f22e", + "sha256": "53ae852982d333683afd20777ba8339d2f16701578409f10c48930fac13db2b2", + "size": 1678, + "uuid": "95deef55-86e9-42be-9f82-3102b0d89dbe", + "version": "2019-01-03T120803.373000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "3b8708bc", + "indexed": true, + "name": "specimen_from_organism_3.json", + "s3_etag": "aa46f028b0aa97a2bf5edc8e6621bb27", + "sha1": "386967d4c00d3c441115e9835b46b3fff2546436", + "sha256": "eef045cc397d6307ea961ae808eedab597838af2bce70978efafacbcd631d648", + "size": 1257, + "uuid": "2e32e319-53d4-4e69-af0f-c43e2b15a94f", + "version": "2019-01-03T120803.124000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "41f8f72d", + "indexed": true, + "name": "donor_organism_3.json", + "s3_etag": "8cb98b3bfd8b0b1339e854be6f17f23a", + "sha1": "51abc11e8dbf046c5164e8bc1a4c858ebfc39648", + "sha256": "3a27a63a2d66dbae5a48c4496145ee0e575c0ebc06bd31c417bd7d39a0dded2f", + "size": 1407, + "uuid": "872169f4-8479-4476-9646-20b3997e1f01", + "version": "2019-01-03T120802.262000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1be9ccbe", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "7bd8ff5e1c9dd5dd36365efbc98e8210", + "sha1": "4d4c8549f4ca7511217cb10c3623d6aa6524ecfb", + "sha256": "99a503dc8a77636d8021105bd13a193830bac52d88196bbfcb72e9fafe0cb5f3", + "size": 566, + "uuid": "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", + "version": "2019-01-03T121654.090000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "92ef8e38", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "320a849048a4116ea6194908da26c479", + "sha1": "0056c763c8533709d03edfb6ce85101c529a4559", + "sha256": "01cddae2b2c6f7c75b0b31ecc4a08370345c6c02c39ed9554611bc8622637406", + "size": 566, + "uuid": "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", + "version": "2019-01-03T122006.160000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c82b84f2", + "indexed": true, + "name": "sequence_file_2.json", + "s3_etag": "b13eb24bf7db24564b1368e679a4f4fa", + "sha1": "eff2165c5d136daa1cbc81b404e103d6cf0797a3", + "sha256": "d134597f4ca9a48ba93262cb3694c41380f76aee79f7b6e31051f98712fe3d09", + "size": 567, + "uuid": "5989ca50-45b5-4834-bfde-d290a8dfa97e", + "version": "2019-01-03T122859.095000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3ddc4d7e", + "indexed": true, + "name": "supplementary_file_0.json", + "s3_etag": "e8833dc3fb340484d17608d352d37f33", + "sha1": "ff398382541406dcdcfa43b62e69ee45c69b106f", + "sha256": "d5a1ce702e46cbc02d7b6858c44f4782d769ce3c92f1f5930232f175d0f6d89b", + "size": 487, + "uuid": "434fa581-90e3-43cc-8ff5-2596e6e8d366", + "version": "2019-01-03T121223.302000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9ee02c8f", + "indexed": true, + "name": "supplementary_file_1.json", + "s3_etag": "18eb29ac307128e9d1820e6caa8686fd", + "sha1": "f087317f3f0b2bf5efbd0f4c284f79306451e973", + "sha256": "f81fb4158ec4ecab30571203aba5250fba5e0b4d1102d10af3c1efed184fef21", + "size": 500, + "uuid": "f126dd41-0041-46b7-8c63-7da264be6b81", + "version": "2019-01-03T121114.380000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "01a56f5a", + "indexed": true, + "name": "supplementary_file_2.json", + "s3_etag": "25fb47a4e51efd3465e7f4c3a98274c6", + "sha1": "3d474eab3fef8b7b561d1bd5ecd4bb363e03f03d", + "sha256": "004b6c7703d8523d72634a16def554894fb419d0161a32b4b4587ffbe4f0624a", + "size": 524, + "uuid": "f48ebd9a-f3ac-4e02-b698-7146cd396946", + "version": "2019-01-03T121114.378000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "f15ac967", + "indexed": true, + "name": "project_0.json", + "s3_etag": "63bcb8c74527ccae08ec84c61383da41", + "sha1": "e6d19bef0f73a64448a68007d83955d122cb49f7", + "sha256": "452c8ffdea142f80eb33688dfcc422391ba145777f7e9d1d110d1aafe36cc399", + "size": 3219, + "uuid": "d96c2451-6e22-441f-a3e6-70fd0878bb1b", + "version": "2019-01-03T120759.988000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "3515de18", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "7b13cbaa59ae18e27ab05cb60a9e3d83", + "sha1": "debb00d797f61c62488a565839d51fd221ffffaa", + "sha256": "95fc2be7fe2927195f2abc53be16c8565ebd37336c7f7c3cb02b74173bfeadeb", + "size": 1496, + "uuid": "65ce5281-b07e-4b21-be8d-66ac5dea4d69", + "version": "2019-01-03T120758.774000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "a867568a", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "c8106026cb90ed80ee87e3ac312d2f18", + "sha1": "1e46ea0d3235678e6b4bc9b48eb68be3f78252a2", + "sha256": "68b22661d8b278c41885507dc60ec36ecd0ce251eb6dccd232f07374b72bd52f", + "size": 974, + "uuid": "1547584e-d9e4-4519-a72a-91db0d0fec3c", + "version": "2019-01-03T120758.338000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "94e11474", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "5c534467f93b7c332b7cd77767c6adba", + "sha1": "a988e153f0f5062bccb1a9da3fcd2b10323840c4", + "sha256": "f5f74aaee1cc1532ea46b97e1c70c0d2c279f07439c1cd5193186a374754d055", + "size": 1004, + "uuid": "c23de226-536c-403d-a757-f4200cb1777b", + "version": "2019-01-03T120758.689000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "9f4c2096", + "indexed": true, + "name": "differentiation_protocol_0.json", + "s3_etag": "b76b565518fdca7544d5626058e5be24", + "sha1": "16e7a52063b0309003d51d4c2ccfb5914395bfa1", + "sha256": "102fd289b29dd3966a98bbbc411ab0b777dcde492f9514f9dd2c2e46b3e86adf", + "size": 917, + "uuid": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47", + "version": "2019-01-03T120758.180000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "a307f381", + "indexed": true, + "name": "ipsc_induction_protocol_0.json", + "s3_etag": "320ebeeebba24fc28f00a72e8505db05", + "sha1": "6e8ead81e1e9446e788303805b731751fdc76947", + "sha256": "337d1da6924e12850f4c84621c66fd7499ea45abb2f58d4d37f4b1b2ea256988", + "size": 1307, + "uuid": "97a30135-246f-4c0d-aef8-4e33183d1ff7", + "version": "2019-01-03T120758.380000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "6dcc6044", + "indexed": true, + "name": "process_0.json", + "s3_etag": "f5f227b3782c918113fde3c62ec984f7", + "sha1": "39cdc568f243008212bf5b23ee72b337d053d9de", + "sha256": "b06ea546c7bc9361638b0ae23fd4a8249ba948763663100ec482077cf223912a", + "size": 374, + "uuid": "54438211-29fb-4e57-87f4-95412e5d8b15", + "version": "2019-01-03T120759.105000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "71ebe85d", + "indexed": true, + "name": "process_1.json", + "s3_etag": "9f793ba347928422e8cf04bc50851661", + "sha1": "b653df6c511b15c3955993074a04761778711e33", + "sha256": "6434db203a9d221d1a490d53e4eabe03ebe347bf21c62e3321241677af8f5371", + "size": 377, + "uuid": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", + "version": "2019-01-03T120759.380000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "6331c92d", + "indexed": true, + "name": "process_2.json", + "s3_etag": "0ecad67daf2ef144f2a41bd47f5d1733", + "sha1": "5618962e8e4290dda82cb439a42d0750e43e4da5", + "sha256": "6deb4b2cadf627a05951deffa7433fc4c3ddbe7e0ffa77871a7d4b37d217383b", + "size": 377, + "uuid": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", + "version": "2019-01-03T120800.039000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "9df664b5", + "indexed": true, + "name": "process_3.json", + "s3_etag": "7aa2fb47abb5daa854097aa75cf58bfb", + "sha1": "351e1bbc94effffa7f0402f16bc43f5bf8d3f8ec", + "sha256": "3ede35448a4bf65f2692cd78569cdbe49a2c0e0b19c93f389e2f45a11f5dc575", + "size": 376, + "uuid": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", + "version": "2019-01-03T120758.898000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "125e9818", + "indexed": true, + "name": "process_4.json", + "s3_etag": "394f4b0f89c7e6c4030cd2df6a7131eb", + "sha1": "af6097d04175fe6df41b643300fc98e9170ef024", + "sha256": "a2fc1d4431fc6ffdff5d62ce29913e07250f964cc8dedf91cd12cfc0a250a3ea", + "size": 376, + "uuid": "01e52705-77de-4715-b35f-442aff9312be", + "version": "2019-01-03T120759.330000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "861ecaaf", + "indexed": true, + "name": "process_5.json", + "s3_etag": "399d4bcd6a651a2cd3d6ba80bcc19104", + "sha1": "5daa2979d968c91cc7805387f70e0064783dc9df", + "sha256": "cd846e9f1349360bdbca428e3f9c3d710ef9a37ea7e2733c85e2e5b9bf3c7788", + "size": 377, + "uuid": "58a58315-2f03-4a36-9cea-dd306b609ba9", + "version": "2019-01-03T120759.265000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "6ce6daf2", + "indexed": true, + "name": "process_6.json", + "s3_etag": "6f0225a503dc91dcb2678329fe680eb1", + "sha1": "e71608bea7275f3af7d9879401e7cb267d1b9687", + "sha256": "611f3c4ab888c282cb5d88acb8a3c594a72793a98261512983c52f55ef944035", + "size": 376, + "uuid": "56c911d5-6b99-486c-9ce7-141ee41528eb", + "version": "2019-01-03T120759.791000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "f299a8f3", + "indexed": true, + "name": "process_7.json", + "s3_etag": "f67d3d210a6f32b08aa4da5af9056456", + "sha1": "da4e705a7a0f119c61bd43a980ebbc8089ce598d", + "sha256": "582f904907ac833f0f6d572af21c9d962a354e17a9faa4da5884612d663d2dba", + "size": 376, + "uuid": "23fe1739-6bbe-4a86-be96-bd75f19f8375", + "version": "2019-01-03T120758.637000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "65fa577c", + "indexed": true, + "name": "process_8.json", + "s3_etag": "112515a7d340075710a58b90173418c7", + "sha1": "baeb3497a9b0d1c828c07fc17026cda319c26b5b", + "sha256": "f30226107b2790036343a32ad647cac07bddf6bf2cbe9f93f71a93f8678380c2", + "size": 377, + "uuid": "831dc734-9813-4c34-a163-16dd5b75d9a0", + "version": "2019-01-03T120759.485000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "598152c1", + "indexed": true, + "name": "process_9.json", + "s3_etag": "14f00ef483b6f95310a54a09ecde5f77", + "sha1": "b2a8b92a7213e1ad6ec8c9b8f14c3df63886f61f", + "sha256": "1e4ef25ce76830e22baa8b58f020d24d4c5bb3ee25c203e2c2719096b21d3200", + "size": 376, + "uuid": "d8f1d436-6bc3-4638-9801-8a9241996d28", + "version": "2019-01-03T120759.548000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "f7aba80f", + "indexed": true, + "name": "process_10.json", + "s3_etag": "ddbbe694af830525e53c62d210c2dffe", + "sha1": "750cd4dc3682d04d4e215b247a27b5a58fceed8c", + "sha256": "39b6e58fd21152ebfa02ebb100e5a2dbec94556dba907e5d0ebb0ad8e1fa7c04", + "size": 376, + "uuid": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", + "version": "2019-01-03T120758.435000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "3a68767c", + "indexed": true, + "name": "process_11.json", + "s3_etag": "c3bf4d77dd2aab587f40a42e54dcde59", + "sha1": "5b59e80e17220fad995b629502f85f69316e84e9", + "sha256": "f09320ea773b07952c1cd356ddfa144c63448b2ad0837096a480eb51e015207f", + "size": 377, + "uuid": "024c9f05-1743-4d66-83b7-134a31cd1c27", + "version": "2019-01-03T120759.150000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "5bbd64bc", + "indexed": true, + "name": "process_12.json", + "s3_etag": "2e32941e1137fad0ca6b99add0bd43cc", + "sha1": "fc48af8d0889781fc16c87db5da63a9f9b8ac919", + "sha256": "3327b5cec92de3655b8fad150f2a06ada081016ee74003ed8774f3176c1b84f6", + "size": 376, + "uuid": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", + "version": "2019-01-03T120759.502000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "90e1ca34", + "indexed": true, + "name": "process_13.json", + "s3_etag": "acd6d4af269a0d32a45fff2a709e4dc5", + "sha1": "292d57e39218d0a74b1c8dde501b5a2a0805ba85", + "sha256": "d46cde10f8f51b5542f00e12d0f708a575ce8c890c5c0d02a457be4dfe936d8a", + "size": 376, + "uuid": "baa3a061-534c-4b6e-8c51-a11a8307f537", + "version": "2019-01-03T120758.911000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "8296c70e", + "indexed": true, + "name": "links.json", + "s3_etag": "dcda06d2eb79d368ac84a47a06689773", + "sha1": "3d4d918d7deae23cade8abb3269ca957c315ad0d", + "sha256": "a0c53628a804b864567b1c6a87879a040dba1d24b539418710dc3979599301e1", + "size": 7860, + "uuid": "5b71a545-1f04-477b-98b5-f15664311970", + "version": "2019-01-03T163557.511721Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "dec968a1", + "indexed": false, + "name": "GAC027_hOrg_HipSci_2_S6_L007_I1_001.fastq.gz", + "s3_etag": "786fc96923a5679756310bdfd04fc556-11", + "sha1": "c9e9bc9a41f08542ef10f0b1703ca4fa929597cb", + "sha256": "db46327da5d22af03508e0e277631003872d2b8eb5557eaec6b68b57c55a24f8", + "size": 682675184, + "uuid": "44b4cb90-1ae1-48a8-aaf9-2a0b8023f3d1", + "version": "2019-01-03T163557.783237Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "d5532b5f", + "indexed": false, + "name": "GAC027_hOrg_HipSci_2_S6_L007_R1_001.fastq.gz", + "s3_etag": "d598e1a0973c6897c2a12eb2e9406172-29", + "sha1": "f8baf75d483900aadb3998008b39e7df9b6babb8", + "sha256": "329fa460251c519fd13c2006b93ac4aca4fe83f224aeb3f120327062f8f66751", + "size": 1935574142, + "uuid": "9df72772-4e7f-443d-ba15-4c1000f60003", + "version": "2019-01-03T163558.131144Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "802b0183", + "indexed": false, + "name": "GAC027_hOrg_HipSci_2_S6_L007_R2_001.fastq.gz", + "s3_etag": "d7501ecd11fa347731cdce263da225ec-93", + "sha1": "24940d3ce2b37303c2ae2364380e611c95f9eff1", + "sha256": "f8b9ce92fb34b95c4c930c7df607e5adcda097bffa803b0f0f473a1ea607c90d", + "size": 6230565577, + "uuid": "4de318e4-8292-4b51-8f06-25bf2f6697bf", + "version": "2019-01-03T163558.311125Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "1e67ff31", + "indexed": false, + "name": "hipsci-ipsc-pipeline.pdf", + "s3_etag": "d276fabcc867f6100a053ee354b0fc9a", + "sha1": "09855c6bf665c999ebfb1a5ffe66bcee5a606762", + "sha256": "d5928f0c9fc0c67352df51f4747c76efebe5749a59b4b6c7effc722c01ddf4c6", + "size": 10012457, + "uuid": "83361a8e-5029-45fd-9705-68e5a9bb4074", + "version": "2019-01-03T163558.501100Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "201fded1", + "indexed": false, + "name": "Dissociation_protocol_130-092-628.pdf", + "s3_etag": "6ecf47fe7a612eec681b313225744035", + "sha1": "5180c3713cd1a0a01a8bb3991cb1ab872d1a8813", + "sha256": "745844f42a0bef18e57eca252c2d52ef6042a1b55a7df8c74232cdc36f5a34e6", + "size": 104805, + "uuid": "f633ef07-9c42-4771-9057-16f4adfb2350", + "version": "2019-01-03T163558.748211Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "47441108", + "indexed": false, + "name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", + "s3_etag": "67e93ad84439bc3515066da4362d2439", + "sha1": "194a0f2b6b8db8272f33f3c1f6a2cf2dca26160d", + "sha256": "b6b98dc6b82be35951bf0a8f47cd6e1c2262c18ea75532ca0800223d1f846910", + "size": 5645416, + "uuid": "d2eedcf0-e06b-4975-99f8-f3c810ca1e39", + "version": "2019-01-03T163559.110502Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.6.2/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI_organoids_pooled_2", + "biomaterial_name": "pooled cells from 4 dissociated organoids", + "biomaterial_description": "pooled cells from 4 dissociated organoids (wibj_2, kucg_2, hoik_1, sojd_3)", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "selected_cell_type": [ + { + "text": "neural cell", + "ontology": "CL:0002319", + "ontology_label": "neural cell" + } + ], + "total_estimated_cells": 6210, + "provenance": { + "document_id": "c2396f83-22e4-4a2d-8cce-a30feb533603", + "submission_date": "2019-01-03T12:07:51.214Z", + "update_date": "2019-01-03T12:08:03.256Z" + } + }, + "organoid_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0214i-wibj_2_2", + "biomaterial_name": "human cerebral organoid wibj_2", + "biomaterial_description": "human cerebral organoid wibj_2, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033", + "ontology_label": "day" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": true, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "a690df06-cc52-4346-a926-fe5e5b3a7547", + "submission_date": "2019-01-03T12:07:51.090Z", + "update_date": "2019-01-03T12:08:02.342Z" + } + }, + "organoid_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0214i-kucg_2_2", + "biomaterial_name": "human cerebral organoid kucg_2", + "biomaterial_description": "human cerebral organoid kucg_2, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033", + "ontology_label": "day" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": true, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "f0b636ce-505c-4339-a69c-2305352b6796", + "submission_date": "2019-01-03T12:07:51.122Z", + "update_date": "2019-01-03T12:08:02.944Z" + } + }, + "organoid_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0314i-hoik_1_2", + "biomaterial_name": "human cerebral organoid hoik_1", + "biomaterial_description": "human cerebral organoid hoik_1, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033", + "ontology_label": "day" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": true, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "46e7ed04-5916-4c10-8a05-fe510eda819a", + "submission_date": "2019-01-03T12:07:51.151Z", + "update_date": "2019-01-03T12:08:02.497Z" + } + }, + "organoid_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Org_HPSI0314i-sojd_3_2", + "biomaterial_name": "human cerebral organoid sojd_3", + "biomaterial_description": "human cerebral organoid sojd_3, 62d", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "model_for_organ": { + "text": "Brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "organoid_age": 62, + "organoid_age_unit": { + "text": "day", + "ontology": "UO:0000033", + "ontology_label": "day" + }, + "organoid_type": "stem cell-derived", + "embedded_in_matrigel": true, + "organoid_growth_environment": "suspension", + "provenance": { + "document_id": "d49998ff-c873-41fd-bb44-f221f89b8f15", + "submission_date": "2019-01-03T12:07:51.178Z", + "update_date": "2019-01-03T12:08:02.781Z" + } + }, + "cell_line_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj_2", + "biomaterial_name": "iPS cell line wibj_2", + "biomaterial_description": "iPS cell line wibj_2", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2627567" + }, + "disease": { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248", + "ontology_label": "pluripotent stem cell" + }, + "catalog_number": "77650057", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-wibj_2", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 32, + "growth_medium": "mTeSR1", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2014-10-24T00:00:00Z", + "provenance": { + "document_id": "a689172e-cae2-4e2c-b1d2-5aeff0a90171", + "submission_date": "2019-01-03T12:07:51.043Z", + "update_date": "2019-01-03T12:08:03.319Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj_skin", + "biomaterial_name": "Skin cells from HPSI0214i-wibj_skin", + "biomaterial_description": "Skin cells from HPSI0214i-wibj_skin", + "biosd_biomaterial": "SAMEA2397844", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097", + "ontology_label": "skin of body" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003", + "ontology_label": "skin epidermis" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "provenance": { + "document_id": "597b4050-0778-4a81-b882-e1704ab0b6ad", + "submission_date": "2019-01-03T12:07:50.973Z", + "update_date": "2019-01-03T12:08:03.189Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-wibj", + "biomaterial_name": "donor HPSI0214i-wibj", + "biomaterial_description": "donor HPSI0214i-wibj_2, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2398911" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "sex": "female", + "organism_age": "55-59", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "HANCESTRO:0462", + "ontology_label": "British" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "4934d9c3-753b-47bc-b2d5-468ce255a139", + "submission_date": "2019-01-03T12:07:50.939Z", + "update_date": "2019-01-03T12:08:02.040Z" + } + }, + "cell_line_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg_2", + "biomaterial_name": "iPS cell line kucg_2", + "biomaterial_description": "iPS cell line kucg_2", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2645814" + }, + "disease": { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248", + "ontology_label": "pluripotent stem cell" + }, + "catalog_number": "77650065", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-kucg_2", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 36, + "growth_medium": "mTeSR1", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2014-11-03T00:00:00Z", + "provenance": { + "document_id": "37833da3-505d-4bb2-916e-26aa8985d183", + "submission_date": "2019-01-03T12:07:51.052Z", + "update_date": "2019-01-03T12:08:03.268Z" + } + }, + "specimen_from_organism_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg_skin", + "biomaterial_name": "Skin cells from HPSI0214i-kucg_skin", + "biomaterial_description": "Skin cells from HPSI0214i-kucg_skin", + "biosd_biomaterial": "SAMEA2398627", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097", + "ontology_label": "skin of body" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003", + "ontology_label": "skin epidermis" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "provenance": { + "document_id": "1fc181fe-60c6-4b94-85c1-1f227be60658", + "submission_date": "2019-01-03T12:07:50.987Z", + "update_date": "2019-01-03T12:08:03.087Z" + } + }, + "donor_organism_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0214i-kucg", + "biomaterial_name": "donor HPSI0214i-kucg", + "biomaterial_description": "donor HPSI0214i-kucg_2, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2397923" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "sex": "male", + "organism_age": "65-69", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "HANCESTRO:0462", + "ontology_label": "British" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "7c3a6d87-9f43-4de5-b47d-6fa78a897624", + "submission_date": "2019-01-03T12:07:50.949Z", + "update_date": "2019-01-03T12:08:01.492Z" + } + }, + "cell_line_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik_1", + "biomaterial_name": "iPS cell line hoik_1", + "biomaterial_description": "iPS cell line hoik_1", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2698315" + }, + "disease": { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248", + "ontology_label": "pluripotent stem cell" + }, + "catalog_number": "77650129", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-hoik_1", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 28, + "growth_medium": "mTeSR1", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2015-02-02T00:00:00Z", + "provenance": { + "document_id": "d954547d-94bc-401d-bdff-ccd727251c74", + "submission_date": "2019-01-03T12:07:51.061Z", + "update_date": "2019-01-03T12:08:03.322Z" + } + }, + "specimen_from_organism_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik_skin", + "biomaterial_name": "Skin cells from HPSI0314i-hoik_skin", + "biomaterial_description": "Skin cells from HPSI0314i-hoik_skin", + "biosd_biomaterial": "SAMEA2399963", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097", + "ontology_label": "skin of body" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003", + "ontology_label": "skin epidermis" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "provenance": { + "document_id": "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b", + "submission_date": "2019-01-03T12:07:50.997Z", + "update_date": "2019-01-03T12:08:02.789Z" + } + }, + "donor_organism_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-hoik", + "biomaterial_name": "donor HPSI0314i-hoik", + "biomaterial_description": "donor HPSI0314i-hoik_1, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2399961" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "sex": "female", + "organism_age": "40-44", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "human_specific": { + "ethnicity": [ + { + "text": "European, White, British", + "ontology": "HANCESTRO:0462", + "ontology_label": "British" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "3322ea3a-30ea-4e6e-b187-18525de4ee3e", + "submission_date": "2019-01-03T12:07:50.957Z", + "update_date": "2019-01-03T12:08:02.270Z" + } + }, + "cell_line_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd_3", + "biomaterial_name": "iPS cell line sojd_3", + "biomaterial_description": "iPS cell line sojd_3", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2627569" + }, + "disease": { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "cell_type": { + "text": "pluripotent stem cell", + "ontology": "CL:0002248", + "ontology_label": "pluripotent stem cell" + }, + "catalog_number": "77650126", + "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-sojd_3", + "cell_line_type": "induced pluripotent", + "cell_morphology": { + "cell_viability_method": "Growth to confluence post-thaw" + }, + "growth_conditions": { + "passage_number": 29, + "growth_medium": "mTeSR1", + "feeder_layer_type": "feeder-free", + "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", + "mycoplasma_testing_method": "PCR", + "mycoplasma_testing_results": "pass" + }, + "date_established": "2015-01-09T00:00:00Z", + "provenance": { + "document_id": "95deef55-86e9-42be-9f82-3102b0d89dbe", + "submission_date": "2019-01-03T12:07:51.071Z", + "update_date": "2019-01-03T12:08:03.373Z" + } + }, + "specimen_from_organism_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd_skin", + "biomaterial_name": "Skin cells from HPSI0314i-sojd_skin", + "biomaterial_description": "Skin cells from HPSI0314i-sojd_skin", + "biosd_biomaterial": "SAMEA2418243", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "skin of body", + "ontology": "UBERON:0002097", + "ontology_label": "skin of body" + }, + "organ_part": { + "text": "skin epidermis", + "ontology": "UBERON:0001003", + "ontology_label": "skin epidermis" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "provenance": { + "document_id": "2e32e319-53d4-4e69-af0f-c43e2b15a94f", + "submission_date": "2019-01-03T12:07:51.019Z", + "update_date": "2019-01-03T12:08:03.124Z" + } + }, + "donor_organism_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "HPSI0314i-sojd", + "biomaterial_name": "donor HPSI0314i-sojd", + "biomaterial_description": "donor HPSI0314i-sojd_3, iPSC, cell line, skin", + "ncbi_taxon_id": [ + 9606 + ], + "biosd_biomaterial": "SAMEA2418245" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "sex": "female", + "organism_age": "45-49", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "human_specific": { + "ethnicity": [ + { + "text": "White - other, Ad Mixed American", + "ontology": "HANCESTRO:0463", + "ontology_label": "American" + } + ] + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "is_living": "yes", + "provenance": { + "document_id": "872169f4-8479-4476-9646-20b3997e1f01", + "submission_date": "2019-01-03T12:07:50.965Z", + "update_date": "2019-01-03T12:08:02.262Z" + } + }, + "sequence_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_2_S6_L007_I1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "fdb858b0c02365a1ac66b93eb7d6ad91" + }, + "read_index": "index1", + "lane_index": 7, + "read_length": 8, + "provenance": { + "document_id": "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", + "submission_date": "2019-01-03T12:07:50.674Z", + "update_date": "2019-01-03T12:16:54.090Z" + } + }, + "sequence_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_2_S6_L007_R1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "be86a99afeb1e9142db887d9fcdfe3c7" + }, + "read_index": "read1", + "lane_index": 7, + "read_length": 26, + "provenance": { + "document_id": "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", + "submission_date": "2019-01-03T12:07:50.685Z", + "update_date": "2019-01-03T12:20:06.160Z" + } + }, + "sequence_file_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "GAC027_hOrg_HipSci_2_S6_L007_R2_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "611ba41c18875cc6392c64e0b01ce875" + }, + "read_index": "read2", + "lane_index": 7, + "read_length": 100, + "provenance": { + "document_id": "5989ca50-45b5-4834-bfde-d290a8dfa97e", + "submission_date": "2019-01-03T12:07:50.705Z", + "update_date": "2019-01-03T12:28:59.095Z" + } + }, + "supplementary_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "hipsci-ipsc-pipeline.pdf", + "file_format": "pdf" + }, + "file_description": "iPSC induction by Sendai virus protocol.", + "provenance": { + "document_id": "434fa581-90e3-43cc-8ff5-2596e6e8d366", + "submission_date": "2019-01-03T12:07:50.566Z", + "update_date": "2019-01-03T12:12:23.302Z" + } + }, + "supplementary_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Dissociation_protocol_130-092-628.pdf", + "file_format": "pdf" + }, + "file_description": "Cerebral organoid dissociation protocol.", + "provenance": { + "document_id": "f126dd41-0041-46b7-8c63-7da264be6b81", + "submission_date": "2019-01-03T12:07:50.578Z", + "update_date": "2019-01-03T12:11:14.380Z" + } + }, + "supplementary_file_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", + "file_format": "pdf" + }, + "file_description": "10x Chromium single cell 3' v2 library preparation.", + "provenance": { + "document_id": "f48ebd9a-f3ac-4e02-b698-7146cd396946", + "submission_date": "2019-01-03T12:07:50.588Z", + "update_date": "2019-01-03T12:11:14.378Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/project/9.0.4/project", + "schema_type": "project", + "project_core": { + "project_short_name": "HPSI human cerebral organoids", + "project_title": "Assessing the relevance of organoids to model inter-individual variation", + "project_description": "The purpose of this project is to assess the relevance of pluripotent stem cell-derived cerebral and liver organoids to recapitulate the variation in cell-type specific gene expression programs between individuals. Towards this aim, we will generate reference atlases of the developing cortex and liver from multiple individuals, derive iPSC lines from these same individuals, and determine if inter-individual gene expression variation is recapitulated in cerebral and liver organoids from the same individual from which we have reference maps. In parallel we will assess the genetic contribution to variablity between organoids from different iPSCs of multiple human individuals that are available in existing iPSC resources (e.g. HipSci)." + }, + "contributors": [ + { + "contact_name": "Barbara,,Treutlein", + "email": "barbara_treutlein@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "project_role": "principal investigator", + "orcid_id": "0000-0002-3299-5597", + "corresponding_contributor": true + }, + { + "contact_name": "J,Gray,Camp", + "email": "gray_camp@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Zhisong,,He", + "email": "zhisong_he@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Sabina,,Kanton", + "email": "sabina_kanton@eva.mpg.de", + "institution": "Max Planck Institute for Evolutionary Anthropology", + "address": "Deutscher Pl. 6, 04103 Leipzig", + "country": "Germany", + "corresponding_contributor": false + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + } + ], + "provenance": { + "document_id": "d96c2451-6e22-441f-a3e6-70fd0878bb1b", + "submission_date": "2019-01-03T12:07:50.548Z", + "update_date": "2019-01-03T12:07:59.988Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/4.4.0/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "10x_3'_library_preparation", + "protocol_name": "10x 3' single cell library preparation", + "protocol_description": "10x Chromium single cell 3' v2 library preparation", + "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" + }, + "nucleic_acid_source": "single cell", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869", + "ontology_label": "polyA RNA" + }, + "library_construction_approach": { + "text": "Chromium 3' Single Cell v2", + "ontology": "EFO:0009310", + "ontology_label": "10X v2 sequencing" + }, + "end_bias": "3 prime tag", + "primer": "poly-dT", + "strand": "unstranded", + "cell_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 15, + "barcode_length": 10 + }, + "library_construction_kit": { + "retail_name": "10X Chromium Single Cell 3' Solution v2 Chemistry", + "manufacturer": "10X Genomics" + }, + "provenance": { + "document_id": "65ce5281-b07e-4b21-be8d-66ac5dea4d69", + "submission_date": "2019-01-03T12:07:51.265Z", + "update_date": "2019-01-03T12:07:58.774Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/9.0.3/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "10x_scRNASeq", + "protocol_name": "10x single cell RNA Sequencing", + "protocol_description": "10x RNA sequencing", + "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565", + "ontology_label": "Illumina HiSeq 2500" + }, + "paired_end": true, + "sequencing_approach": { + "text": "tag based single cell RNA sequencing", + "ontology": "EFO:0008440", + "ontology_label": "tag based single cell RNA sequencing" + }, + "provenance": { + "document_id": "1547584e-d9e4-4519-a72a-91db0d0fec3c", + "submission_date": "2019-01-03T12:07:51.274Z", + "update_date": "2019-01-03T12:07:58.338Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Cerebral_organoid_dissociation", + "protocol_name": "cerebral organoid dissociation", + "protocol_description": "cerebral organoid dissociation", + "document": "Dissociation_protocol_130-092-628.pdf" + }, + "dissociation_method": { + "text": "Papain-based enzymatic dissociation", + "ontology": "EFO:0009128", + "ontology_label": "enzymatic dissociation" + }, + "protocol_reagents": [ + { + "retail_name": "Neural Tissue Dissociation Kit", + "catalog_number": "130-092-628", + "manufacturer": "Miltenyi Biotec" + } + ], + "provenance": { + "document_id": "c23de226-536c-403d-a757-f4200cb1777b", + "submission_date": "2019-01-03T12:07:51.254Z", + "update_date": "2019-01-03T12:07:58.689Z" + } + }, + "differentiation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/1.3.0/differentiation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Org_Lanc_2014", + "protocol_name": "Differentiation of cerebral organoids", + "protocol_description": "Generation of cerebral organoids from human pluripotent stem cells", + "publication_doi": "10.1038/nprot.2014.158" + }, + "differentiation_method": "embryoid bodies", + "target_pathway": "RHO, ROCK", + "validation_method": "immunostaining", + "reagents": [ + { + "retail_name": "ROCK inhibitor Y27632" + } + ], + "small_molecules": "Vitamin A (retinoic acid)", + "provenance": { + "document_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47", + "submission_date": "2019-01-03T12:07:51.244Z", + "update_date": "2019-01-03T12:07:58.180Z" + } + }, + "ipsc_induction_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.0.1/ipsc_induction_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "ipsc_induction_protocol_1", + "protocol_name": "iPSC induction by Sendai virus", + "protocol_description": "Fibroblasts are thawed, transduced using Cytotune 2.0 Sendai virus (containing the Yamanaka genes encoding transcription factors Oct4, Sox2, cMyc and Klf4) and maintained until iPSC colony formation. Colonies are then picked and cultured to obtain a sizable yield of IPS cells, which are banked to a commercial grade standard. These banks then undergo quality checks to ensure the banks pass resuscitation tests and are free of mycoplasma.", + "document": "hipsci-ipsc-pipeline.pdf" + }, + "ipsc_induction_method": "sendai virus", + "pluripotency_vector_removed": "yes", + "ipsc_induction_kit": { + "retail_name": "Cytotune 1.0", + "manufacturer": "Thermofisher" + }, + "pluripotency_test": "HipSci Pluri test", + "ipsc_induction_produced_in_house": false, + "provenance": { + "document_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7", + "submission_date": "2019-01-03T12:07:51.230Z", + "update_date": "2019-01-03T12:07:58.380Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "tech_rep_3" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "54438211-29fb-4e57-87f4-95412e5d8b15", + "submission_date": "2019-01-03T12:07:51.302Z", + "update_date": "2019-01-03T12:07:59.105Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_22" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", + "submission_date": "2019-01-03T12:07:51.550Z", + "update_date": "2019-01-03T12:07:59.380Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_10" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", + "submission_date": "2019-01-03T12:07:51.438Z", + "update_date": "2019-01-03T12:08:00.039Z" + } + }, + "process_3.json": { + "process_core": { + "process_id": "process_id_5" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", + "submission_date": "2019-01-03T12:07:51.383Z", + "update_date": "2019-01-03T12:07:58.898Z" + } + }, + "process_4.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "01e52705-77de-4715-b35f-442aff9312be", + "submission_date": "2019-01-03T12:07:51.338Z", + "update_date": "2019-01-03T12:07:59.330Z" + } + }, + "process_5.json": { + "process_core": { + "process_id": "process_id_13" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "58a58315-2f03-4a36-9cea-dd306b609ba9", + "submission_date": "2019-01-03T12:07:51.477Z", + "update_date": "2019-01-03T12:07:59.265Z" + } + }, + "process_6.json": { + "process_core": { + "process_id": "process_id_6" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "56c911d5-6b99-486c-9ce7-141ee41528eb", + "submission_date": "2019-01-03T12:07:51.391Z", + "update_date": "2019-01-03T12:07:59.791Z" + } + }, + "process_7.json": { + "process_core": { + "process_id": "process_id_2" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "23fe1739-6bbe-4a86-be96-bd75f19f8375", + "submission_date": "2019-01-03T12:07:51.346Z", + "update_date": "2019-01-03T12:07:58.637Z" + } + }, + "process_8.json": { + "process_core": { + "process_id": "process_id_16" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "831dc734-9813-4c34-a163-16dd5b75d9a0", + "submission_date": "2019-01-03T12:07:51.503Z", + "update_date": "2019-01-03T12:07:59.485Z" + } + }, + "process_9.json": { + "process_core": { + "process_id": "process_id_7" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "d8f1d436-6bc3-4638-9801-8a9241996d28", + "submission_date": "2019-01-03T12:07:51.413Z", + "update_date": "2019-01-03T12:07:59.548Z" + } + }, + "process_10.json": { + "process_core": { + "process_id": "process_id_3" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", + "submission_date": "2019-01-03T12:07:51.354Z", + "update_date": "2019-01-03T12:07:58.435Z" + } + }, + "process_11.json": { + "process_core": { + "process_id": "process_id_19" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "024c9f05-1743-4d66-83b7-134a31cd1c27", + "submission_date": "2019-01-03T12:07:51.527Z", + "update_date": "2019-01-03T12:07:59.150Z" + } + }, + "process_12.json": { + "process_core": { + "process_id": "process_id_8" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", + "submission_date": "2019-01-03T12:07:51.421Z", + "update_date": "2019-01-03T12:07:59.502Z" + } + }, + "process_13.json": { + "process_core": { + "process_id": "process_id_4" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "baa3a061-534c-4b6e-8c51-a11a8307f537", + "submission_date": "2019-01-03T12:07:51.362Z", + "update_date": "2019-01-03T12:07:58.911Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.4/links", + "schema_type": "link_bundle", + "schema_version": "1.1.4", + "links": [ + { + "process": "54438211-29fb-4e57-87f4-95412e5d8b15", + "inputs": [ + "c2396f83-22e4-4a2d-8cce-a30feb533603" + ], + "input_type": "biomaterial", + "outputs": [ + "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", + "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", + "5989ca50-45b5-4834-bfde-d290a8dfa97e" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "65ce5281-b07e-4b21-be8d-66ac5dea4d69" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "1547584e-d9e4-4519-a72a-91db0d0fec3c" + } + ] + }, + { + "process": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", + "inputs": [ + "a690df06-cc52-4346-a926-fe5e5b3a7547", + "f0b636ce-505c-4339-a69c-2305352b6796", + "46e7ed04-5916-4c10-8a05-fe510eda819a", + "d49998ff-c873-41fd-bb44-f221f89b8f15" + ], + "input_type": "biomaterial", + "outputs": [ + "c2396f83-22e4-4a2d-8cce-a30feb533603" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "c23de226-536c-403d-a757-f4200cb1777b" + } + ] + }, + { + "process": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", + "inputs": [ + "a689172e-cae2-4e2c-b1d2-5aeff0a90171" + ], + "input_type": "biomaterial", + "outputs": [ + "a690df06-cc52-4346-a926-fe5e5b3a7547" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" + } + ] + }, + { + "process": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", + "inputs": [ + "597b4050-0778-4a81-b882-e1704ab0b6ad" + ], + "input_type": "biomaterial", + "outputs": [ + "a689172e-cae2-4e2c-b1d2-5aeff0a90171" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" + } + ] + }, + { + "process": "01e52705-77de-4715-b35f-442aff9312be", + "inputs": [ + "4934d9c3-753b-47bc-b2d5-468ce255a139" + ], + "input_type": "biomaterial", + "outputs": [ + "597b4050-0778-4a81-b882-e1704ab0b6ad" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "58a58315-2f03-4a36-9cea-dd306b609ba9", + "inputs": [ + "37833da3-505d-4bb2-916e-26aa8985d183" + ], + "input_type": "biomaterial", + "outputs": [ + "f0b636ce-505c-4339-a69c-2305352b6796" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" + } + ] + }, + { + "process": "56c911d5-6b99-486c-9ce7-141ee41528eb", + "inputs": [ + "1fc181fe-60c6-4b94-85c1-1f227be60658" + ], + "input_type": "biomaterial", + "outputs": [ + "37833da3-505d-4bb2-916e-26aa8985d183" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" + } + ] + }, + { + "process": "23fe1739-6bbe-4a86-be96-bd75f19f8375", + "inputs": [ + "7c3a6d87-9f43-4de5-b47d-6fa78a897624" + ], + "input_type": "biomaterial", + "outputs": [ + "1fc181fe-60c6-4b94-85c1-1f227be60658" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "831dc734-9813-4c34-a163-16dd5b75d9a0", + "inputs": [ + "d954547d-94bc-401d-bdff-ccd727251c74" + ], + "input_type": "biomaterial", + "outputs": [ + "46e7ed04-5916-4c10-8a05-fe510eda819a" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" + } + ] + }, + { + "process": "d8f1d436-6bc3-4638-9801-8a9241996d28", + "inputs": [ + "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b" + ], + "input_type": "biomaterial", + "outputs": [ + "d954547d-94bc-401d-bdff-ccd727251c74" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" + } + ] + }, + { + "process": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", + "inputs": [ + "3322ea3a-30ea-4e6e-b187-18525de4ee3e" + ], + "input_type": "biomaterial", + "outputs": [ + "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "024c9f05-1743-4d66-83b7-134a31cd1c27", + "inputs": [ + "95deef55-86e9-42be-9f82-3102b0d89dbe" + ], + "input_type": "biomaterial", + "outputs": [ + "d49998ff-c873-41fd-bb44-f221f89b8f15" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" + } + ] + }, + { + "process": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", + "inputs": [ + "2e32e319-53d4-4e69-af0f-c43e2b15a94f" + ], + "input_type": "biomaterial", + "outputs": [ + "95deef55-86e9-42be-9f82-3102b0d89dbe" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "ipsc_induction_protocol", + "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" + } + ] + }, + { + "process": "baa3a061-534c-4b6e-8c51-a11a8307f537", + "inputs": [ + "872169f4-8479-4476-9646-20b3997e1f01" + ], + "input_type": "biomaterial", + "outputs": [ + "2e32e319-53d4-4e69-af0f-c43e2b15a94f" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/manifest.json b/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/manifest.json deleted file mode 100644 index 9583a9627..000000000 --- a/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/manifest.json +++ /dev/null @@ -1,598 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "afa286ee", - "indexed": true, - "name": "cell_suspension_0.json", - "sha1": "9300432ea2bf3550791904b26f824dbc547178dc", - "sha256": "1ae2592f34e00d6c322a660f5cde9a943304bc4f59fc824c0fb2789e0dd4886f", - "size": 1032, - "uuid": "c2396f83-22e4-4a2d-8cce-a30feb533603", - "version": "2019-01-03T120803.256000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "4235974a", - "indexed": true, - "name": "organoid_0.json", - "s3_etag": "5195c84d0f7054aea3323fd948f5e511", - "sha256": "21a2f091afc05363f42cf1a7c08a121c934487873c34d8fc56bb47d20aa1b7cb", - "size": 1168, - "uuid": "a690df06-cc52-4346-a926-fe5e5b3a7547", - "version": "2019-01-03T120802.342000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "85ccc604", - "indexed": true, - "name": "organoid_1.json", - "sha256": "7ddccdaaf573866f4209286dd3c33e537ec2ef721ff8f9c0d09b1d7bcc696d9a", - "size": 1168, - "uuid": "f0b636ce-505c-4339-a69c-2305352b6796", - "version": "2019-01-03T120802.944000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "63a7a393", - "indexed": true, - "name": "organoid_2.json", - "s3_etag": "f7a0d0a3e693e85ea08052dfc44c2bce", - "sha1": "9b0ac909a7da9b5880a44012e56b2e117c785b0a", - "sha256": "9eef75155bbaa5c79cfc77827665b2f8067918b65ad0482303cd33db61b94f2f", - "size": 1168, - "uuid": "46e7ed04-5916-4c10-8a05-fe510eda819a", - "version": "2019-01-03T120802.497000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "d8c2c98c", - "indexed": true, - "name": "organoid_3.json", - "s3_etag": "4c3cd57575bff9d04fe4573e25efcac6", - "sha1": "d4e0a390817ac5716d61c653165cc137a9011895", - "sha256": "bae81b043f76bd48176a6c5ccf2bc8a5e1d03e80a46a23d7c5021eaa042b2c4c", - "size": 1168, - "uuid": "d49998ff-c873-41fd-bb44-f221f89b8f15", - "version": "2019-01-03T120802.781000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "3cd2322f", - "indexed": true, - "name": "cell_line_0.json", - "s3_etag": "85961d8cbc047f0862d28f09221cd3e6", - "sha1": "efa33bef8ddba25abf573296a4df15b51054bfba", - "sha256": "b970cff1e46ad1acfe13f1fafee59e1d70a26790caf8fb4b913b9f586ffa1157", - "size": 1678, - "uuid": "a689172e-cae2-4e2c-b1d2-5aeff0a90171", - "version": "2019-01-03T120803.319000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ca683efb", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "4e9b5e737dae780305fd5989dc780dd1", - "sha1": "22ffc7d31d3cf1288dd622220cdfc714b4881e78", - "sha256": "676809680438caa238f96ec5bd57c2583119da75c4dc9f1302d1e8167a6fc870", - "size": 1257, - "uuid": "597b4050-0778-4a81-b882-e1704ab0b6ad", - "version": "2019-01-03T120803.189000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "598ba993", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "f06cf20ad6626e64bcfb40cc58c338eb", - "sha1": "0de454cd94d8b688172ad9eae61745b1798df118", - "sha256": "39166e66f23bd463433e7fac29eff5f2b49e79e4b86e435296aa878201ea9a8b", - "size": 1398, - "uuid": "4934d9c3-753b-47bc-b2d5-468ce255a139", - "version": "2019-01-03T120802.040000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "d01fdbf8", - "indexed": true, - "name": "cell_line_1.json", - "s3_etag": "2a687e214f7d1038c8a27737f16b6320", - "sha1": "29c1bb162dafaaee8bf540723c0e8c2dd2db97bf", - "sha256": "f057ec45975208ea545811718dc8d18a6bd3014590394bdad58fe0122b51670a", - "size": 1678, - "uuid": "37833da3-505d-4bb2-916e-26aa8985d183", - "version": "2019-01-03T120803.268000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "8e41e730", - "indexed": true, - "name": "specimen_from_organism_1.json", - "s3_etag": "e196f22360bd55a15bca6c0a502c7d80", - "sha1": "24d2cfcd3960bc8c2acb5505cd723260fcc1e3c7", - "sha256": "ca006d67545e3559b1d6f2678f5cdb281cc6f9c1f95bcacdaa76388e1fce13f9", - "size": 1257, - "uuid": "1fc181fe-60c6-4b94-85c1-1f227be60658", - "version": "2019-01-03T120803.087000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "03ac9a76", - "indexed": true, - "name": "donor_organism_1.json", - "s3_etag": "0571d5a3915257d7d9006fcc0419015e", - "sha1": "25d111b18c4be8dc54d79d86b19ff4b5e59a5ad0", - "sha256": "26f7b846c1113b715299c6bf18ee35061cfe5f83b201e81ef5742c8100b577e8", - "size": 1396, - "uuid": "7c3a6d87-9f43-4de5-b47d-6fa78a897624", - "version": "2019-01-03T120801.492000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "6c7d1fa2", - "indexed": true, - "name": "cell_line_2.json", - "s3_etag": "6efb331d562b34df5a37e97e8fc6fb5a", - "sha1": "66e983196ebc0ade70eae096568dfe3bb8915d9a", - "sha256": "2af9c3bbdfc3ed703e65d5d50025f6324cb3f88de58ae26292f9fa5c8465d989", - "size": 1678, - "uuid": "d954547d-94bc-401d-bdff-ccd727251c74", - "version": "2019-01-03T120803.322000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "83d1a919", - "indexed": true, - "name": "specimen_from_organism_2.json", - "s3_etag": "ef04ff3f06c4c8df62c9bfa293694941", - "sha1": "61d3cc9c8634cec08982bbc8752575bcb420b7aa", - "sha256": "b829951cb42c9874c322d9814a435a58eb13085b166dec0110d3c3003c789c1f", - "size": 1257, - "uuid": "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b", - "version": "2019-01-03T120802.789000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ead1dfb1", - "indexed": true, - "name": "donor_organism_2.json", - "s3_etag": "d0b0f8a0ab16faff1a998f387c5efc4e", - "sha1": "c5cf07458adaabc2e73b20d313f84eed28fae953", - "sha256": "045855bbf12635ecf201f0deaae20545f326232febbaca18b82dc6aeb44d4872", - "size": 1398, - "uuid": "3322ea3a-30ea-4e6e-b187-18525de4ee3e", - "version": "2019-01-03T120802.270000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "cb757d6c", - "indexed": true, - "name": "cell_line_3.json", - "s3_etag": "3ae0bcec51465a494e66f9a642cb0938", - "sha1": "2926de34f6defbb183d6ec5394b1108fe824f22e", - "sha256": "53ae852982d333683afd20777ba8339d2f16701578409f10c48930fac13db2b2", - "size": 1678, - "uuid": "95deef55-86e9-42be-9f82-3102b0d89dbe", - "version": "2019-01-03T120803.373000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "3b8708bc", - "indexed": true, - "name": "specimen_from_organism_3.json", - "s3_etag": "aa46f028b0aa97a2bf5edc8e6621bb27", - "sha1": "386967d4c00d3c441115e9835b46b3fff2546436", - "sha256": "eef045cc397d6307ea961ae808eedab597838af2bce70978efafacbcd631d648", - "size": 1257, - "uuid": "2e32e319-53d4-4e69-af0f-c43e2b15a94f", - "version": "2019-01-03T120803.124000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "41f8f72d", - "indexed": true, - "name": "donor_organism_3.json", - "s3_etag": "8cb98b3bfd8b0b1339e854be6f17f23a", - "sha1": "51abc11e8dbf046c5164e8bc1a4c858ebfc39648", - "sha256": "3a27a63a2d66dbae5a48c4496145ee0e575c0ebc06bd31c417bd7d39a0dded2f", - "size": 1407, - "uuid": "872169f4-8479-4476-9646-20b3997e1f01", - "version": "2019-01-03T120802.262000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1be9ccbe", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "7bd8ff5e1c9dd5dd36365efbc98e8210", - "sha1": "4d4c8549f4ca7511217cb10c3623d6aa6524ecfb", - "sha256": "99a503dc8a77636d8021105bd13a193830bac52d88196bbfcb72e9fafe0cb5f3", - "size": 566, - "uuid": "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", - "version": "2019-01-03T121654.090000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "92ef8e38", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "320a849048a4116ea6194908da26c479", - "sha1": "0056c763c8533709d03edfb6ce85101c529a4559", - "sha256": "01cddae2b2c6f7c75b0b31ecc4a08370345c6c02c39ed9554611bc8622637406", - "size": 566, - "uuid": "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", - "version": "2019-01-03T122006.160000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c82b84f2", - "indexed": true, - "name": "sequence_file_2.json", - "s3_etag": "b13eb24bf7db24564b1368e679a4f4fa", - "sha1": "eff2165c5d136daa1cbc81b404e103d6cf0797a3", - "sha256": "d134597f4ca9a48ba93262cb3694c41380f76aee79f7b6e31051f98712fe3d09", - "size": 567, - "uuid": "5989ca50-45b5-4834-bfde-d290a8dfa97e", - "version": "2019-01-03T122859.095000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3ddc4d7e", - "indexed": true, - "name": "supplementary_file_0.json", - "s3_etag": "e8833dc3fb340484d17608d352d37f33", - "sha1": "ff398382541406dcdcfa43b62e69ee45c69b106f", - "sha256": "d5a1ce702e46cbc02d7b6858c44f4782d769ce3c92f1f5930232f175d0f6d89b", - "size": 487, - "uuid": "434fa581-90e3-43cc-8ff5-2596e6e8d366", - "version": "2019-01-03T121223.302000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9ee02c8f", - "indexed": true, - "name": "supplementary_file_1.json", - "s3_etag": "18eb29ac307128e9d1820e6caa8686fd", - "sha1": "f087317f3f0b2bf5efbd0f4c284f79306451e973", - "sha256": "f81fb4158ec4ecab30571203aba5250fba5e0b4d1102d10af3c1efed184fef21", - "size": 500, - "uuid": "f126dd41-0041-46b7-8c63-7da264be6b81", - "version": "2019-01-03T121114.380000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "01a56f5a", - "indexed": true, - "name": "supplementary_file_2.json", - "s3_etag": "25fb47a4e51efd3465e7f4c3a98274c6", - "sha1": "3d474eab3fef8b7b561d1bd5ecd4bb363e03f03d", - "sha256": "004b6c7703d8523d72634a16def554894fb419d0161a32b4b4587ffbe4f0624a", - "size": 524, - "uuid": "f48ebd9a-f3ac-4e02-b698-7146cd396946", - "version": "2019-01-03T121114.378000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "f15ac967", - "indexed": true, - "name": "project_0.json", - "s3_etag": "63bcb8c74527ccae08ec84c61383da41", - "sha1": "e6d19bef0f73a64448a68007d83955d122cb49f7", - "sha256": "452c8ffdea142f80eb33688dfcc422391ba145777f7e9d1d110d1aafe36cc399", - "size": 3219, - "uuid": "d96c2451-6e22-441f-a3e6-70fd0878bb1b", - "version": "2019-01-03T120759.988000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "3515de18", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "7b13cbaa59ae18e27ab05cb60a9e3d83", - "sha1": "debb00d797f61c62488a565839d51fd221ffffaa", - "sha256": "95fc2be7fe2927195f2abc53be16c8565ebd37336c7f7c3cb02b74173bfeadeb", - "size": 1496, - "uuid": "65ce5281-b07e-4b21-be8d-66ac5dea4d69", - "version": "2019-01-03T120758.774000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "a867568a", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "c8106026cb90ed80ee87e3ac312d2f18", - "sha1": "1e46ea0d3235678e6b4bc9b48eb68be3f78252a2", - "sha256": "68b22661d8b278c41885507dc60ec36ecd0ce251eb6dccd232f07374b72bd52f", - "size": 974, - "uuid": "1547584e-d9e4-4519-a72a-91db0d0fec3c", - "version": "2019-01-03T120758.338000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "94e11474", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "5c534467f93b7c332b7cd77767c6adba", - "sha1": "a988e153f0f5062bccb1a9da3fcd2b10323840c4", - "sha256": "f5f74aaee1cc1532ea46b97e1c70c0d2c279f07439c1cd5193186a374754d055", - "size": 1004, - "uuid": "c23de226-536c-403d-a757-f4200cb1777b", - "version": "2019-01-03T120758.689000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "9f4c2096", - "indexed": true, - "name": "differentiation_protocol_0.json", - "s3_etag": "b76b565518fdca7544d5626058e5be24", - "sha1": "16e7a52063b0309003d51d4c2ccfb5914395bfa1", - "sha256": "102fd289b29dd3966a98bbbc411ab0b777dcde492f9514f9dd2c2e46b3e86adf", - "size": 917, - "uuid": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47", - "version": "2019-01-03T120758.180000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "a307f381", - "indexed": true, - "name": "ipsc_induction_protocol_0.json", - "s3_etag": "320ebeeebba24fc28f00a72e8505db05", - "sha1": "6e8ead81e1e9446e788303805b731751fdc76947", - "sha256": "337d1da6924e12850f4c84621c66fd7499ea45abb2f58d4d37f4b1b2ea256988", - "size": 1307, - "uuid": "97a30135-246f-4c0d-aef8-4e33183d1ff7", - "version": "2019-01-03T120758.380000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "6dcc6044", - "indexed": true, - "name": "process_0.json", - "s3_etag": "f5f227b3782c918113fde3c62ec984f7", - "sha1": "39cdc568f243008212bf5b23ee72b337d053d9de", - "sha256": "b06ea546c7bc9361638b0ae23fd4a8249ba948763663100ec482077cf223912a", - "size": 374, - "uuid": "54438211-29fb-4e57-87f4-95412e5d8b15", - "version": "2019-01-03T120759.105000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "71ebe85d", - "indexed": true, - "name": "process_1.json", - "s3_etag": "9f793ba347928422e8cf04bc50851661", - "sha1": "b653df6c511b15c3955993074a04761778711e33", - "sha256": "6434db203a9d221d1a490d53e4eabe03ebe347bf21c62e3321241677af8f5371", - "size": 377, - "uuid": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", - "version": "2019-01-03T120759.380000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "6331c92d", - "indexed": true, - "name": "process_2.json", - "s3_etag": "0ecad67daf2ef144f2a41bd47f5d1733", - "sha1": "5618962e8e4290dda82cb439a42d0750e43e4da5", - "sha256": "6deb4b2cadf627a05951deffa7433fc4c3ddbe7e0ffa77871a7d4b37d217383b", - "size": 377, - "uuid": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", - "version": "2019-01-03T120800.039000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "9df664b5", - "indexed": true, - "name": "process_3.json", - "s3_etag": "7aa2fb47abb5daa854097aa75cf58bfb", - "sha1": "351e1bbc94effffa7f0402f16bc43f5bf8d3f8ec", - "sha256": "3ede35448a4bf65f2692cd78569cdbe49a2c0e0b19c93f389e2f45a11f5dc575", - "size": 376, - "uuid": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", - "version": "2019-01-03T120758.898000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "125e9818", - "indexed": true, - "name": "process_4.json", - "s3_etag": "394f4b0f89c7e6c4030cd2df6a7131eb", - "sha1": "af6097d04175fe6df41b643300fc98e9170ef024", - "sha256": "a2fc1d4431fc6ffdff5d62ce29913e07250f964cc8dedf91cd12cfc0a250a3ea", - "size": 376, - "uuid": "01e52705-77de-4715-b35f-442aff9312be", - "version": "2019-01-03T120759.330000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "861ecaaf", - "indexed": true, - "name": "process_5.json", - "s3_etag": "399d4bcd6a651a2cd3d6ba80bcc19104", - "sha1": "5daa2979d968c91cc7805387f70e0064783dc9df", - "sha256": "cd846e9f1349360bdbca428e3f9c3d710ef9a37ea7e2733c85e2e5b9bf3c7788", - "size": 377, - "uuid": "58a58315-2f03-4a36-9cea-dd306b609ba9", - "version": "2019-01-03T120759.265000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "6ce6daf2", - "indexed": true, - "name": "process_6.json", - "s3_etag": "6f0225a503dc91dcb2678329fe680eb1", - "sha1": "e71608bea7275f3af7d9879401e7cb267d1b9687", - "sha256": "611f3c4ab888c282cb5d88acb8a3c594a72793a98261512983c52f55ef944035", - "size": 376, - "uuid": "56c911d5-6b99-486c-9ce7-141ee41528eb", - "version": "2019-01-03T120759.791000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "f299a8f3", - "indexed": true, - "name": "process_7.json", - "s3_etag": "f67d3d210a6f32b08aa4da5af9056456", - "sha1": "da4e705a7a0f119c61bd43a980ebbc8089ce598d", - "sha256": "582f904907ac833f0f6d572af21c9d962a354e17a9faa4da5884612d663d2dba", - "size": 376, - "uuid": "23fe1739-6bbe-4a86-be96-bd75f19f8375", - "version": "2019-01-03T120758.637000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "65fa577c", - "indexed": true, - "name": "process_8.json", - "s3_etag": "112515a7d340075710a58b90173418c7", - "sha1": "baeb3497a9b0d1c828c07fc17026cda319c26b5b", - "sha256": "f30226107b2790036343a32ad647cac07bddf6bf2cbe9f93f71a93f8678380c2", - "size": 377, - "uuid": "831dc734-9813-4c34-a163-16dd5b75d9a0", - "version": "2019-01-03T120759.485000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "598152c1", - "indexed": true, - "name": "process_9.json", - "s3_etag": "14f00ef483b6f95310a54a09ecde5f77", - "sha1": "b2a8b92a7213e1ad6ec8c9b8f14c3df63886f61f", - "sha256": "1e4ef25ce76830e22baa8b58f020d24d4c5bb3ee25c203e2c2719096b21d3200", - "size": 376, - "uuid": "d8f1d436-6bc3-4638-9801-8a9241996d28", - "version": "2019-01-03T120759.548000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "f7aba80f", - "indexed": true, - "name": "process_10.json", - "s3_etag": "ddbbe694af830525e53c62d210c2dffe", - "sha1": "750cd4dc3682d04d4e215b247a27b5a58fceed8c", - "sha256": "39b6e58fd21152ebfa02ebb100e5a2dbec94556dba907e5d0ebb0ad8e1fa7c04", - "size": 376, - "uuid": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", - "version": "2019-01-03T120758.435000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "3a68767c", - "indexed": true, - "name": "process_11.json", - "s3_etag": "c3bf4d77dd2aab587f40a42e54dcde59", - "sha1": "5b59e80e17220fad995b629502f85f69316e84e9", - "sha256": "f09320ea773b07952c1cd356ddfa144c63448b2ad0837096a480eb51e015207f", - "size": 377, - "uuid": "024c9f05-1743-4d66-83b7-134a31cd1c27", - "version": "2019-01-03T120759.150000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "5bbd64bc", - "indexed": true, - "name": "process_12.json", - "s3_etag": "2e32941e1137fad0ca6b99add0bd43cc", - "sha1": "fc48af8d0889781fc16c87db5da63a9f9b8ac919", - "sha256": "3327b5cec92de3655b8fad150f2a06ada081016ee74003ed8774f3176c1b84f6", - "size": 376, - "uuid": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", - "version": "2019-01-03T120759.502000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "90e1ca34", - "indexed": true, - "name": "process_13.json", - "s3_etag": "acd6d4af269a0d32a45fff2a709e4dc5", - "sha1": "292d57e39218d0a74b1c8dde501b5a2a0805ba85", - "sha256": "d46cde10f8f51b5542f00e12d0f708a575ce8c890c5c0d02a457be4dfe936d8a", - "size": 376, - "uuid": "baa3a061-534c-4b6e-8c51-a11a8307f537", - "version": "2019-01-03T120758.911000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "8296c70e", - "indexed": true, - "name": "links.json", - "s3_etag": "dcda06d2eb79d368ac84a47a06689773", - "sha1": "3d4d918d7deae23cade8abb3269ca957c315ad0d", - "sha256": "a0c53628a804b864567b1c6a87879a040dba1d24b539418710dc3979599301e1", - "size": 7860, - "uuid": "5b71a545-1f04-477b-98b5-f15664311970", - "version": "2019-01-03T163557.511721Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "dec968a1", - "indexed": false, - "name": "GAC027_hOrg_HipSci_2_S6_L007_I1_001.fastq.gz", - "s3_etag": "786fc96923a5679756310bdfd04fc556-11", - "sha1": "c9e9bc9a41f08542ef10f0b1703ca4fa929597cb", - "sha256": "db46327da5d22af03508e0e277631003872d2b8eb5557eaec6b68b57c55a24f8", - "size": 682675184, - "uuid": "44b4cb90-1ae1-48a8-aaf9-2a0b8023f3d1", - "version": "2019-01-03T163557.783237Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "d5532b5f", - "indexed": false, - "name": "GAC027_hOrg_HipSci_2_S6_L007_R1_001.fastq.gz", - "s3_etag": "d598e1a0973c6897c2a12eb2e9406172-29", - "sha1": "f8baf75d483900aadb3998008b39e7df9b6babb8", - "sha256": "329fa460251c519fd13c2006b93ac4aca4fe83f224aeb3f120327062f8f66751", - "size": 1935574142, - "uuid": "9df72772-4e7f-443d-ba15-4c1000f60003", - "version": "2019-01-03T163558.131144Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "802b0183", - "indexed": false, - "name": "GAC027_hOrg_HipSci_2_S6_L007_R2_001.fastq.gz", - "s3_etag": "d7501ecd11fa347731cdce263da225ec-93", - "sha1": "24940d3ce2b37303c2ae2364380e611c95f9eff1", - "sha256": "f8b9ce92fb34b95c4c930c7df607e5adcda097bffa803b0f0f473a1ea607c90d", - "size": 6230565577, - "uuid": "4de318e4-8292-4b51-8f06-25bf2f6697bf", - "version": "2019-01-03T163558.311125Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "1e67ff31", - "indexed": false, - "name": "hipsci-ipsc-pipeline.pdf", - "s3_etag": "d276fabcc867f6100a053ee354b0fc9a", - "sha1": "09855c6bf665c999ebfb1a5ffe66bcee5a606762", - "sha256": "d5928f0c9fc0c67352df51f4747c76efebe5749a59b4b6c7effc722c01ddf4c6", - "size": 10012457, - "uuid": "83361a8e-5029-45fd-9705-68e5a9bb4074", - "version": "2019-01-03T163558.501100Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "201fded1", - "indexed": false, - "name": "Dissociation_protocol_130-092-628.pdf", - "s3_etag": "6ecf47fe7a612eec681b313225744035", - "sha1": "5180c3713cd1a0a01a8bb3991cb1ab872d1a8813", - "sha256": "745844f42a0bef18e57eca252c2d52ef6042a1b55a7df8c74232cdc36f5a34e6", - "size": 104805, - "uuid": "f633ef07-9c42-4771-9057-16f4adfb2350", - "version": "2019-01-03T163558.748211Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "47441108", - "indexed": false, - "name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", - "s3_etag": "67e93ad84439bc3515066da4362d2439", - "sha1": "194a0f2b6b8db8272f33f3c1f6a2cf2dca26160d", - "sha256": "b6b98dc6b82be35951bf0a8f47cd6e1c2262c18ea75532ca0800223d1f846910", - "size": 5645416, - "uuid": "d2eedcf0-e06b-4975-99f8-f3c810ca1e39", - "version": "2019-01-03T163559.110502Z" - } -] diff --git a/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/metadata.json b/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/metadata.json deleted file mode 100644 index 8af61d675..000000000 --- a/test/hca_metadata_api/cans/prod/6b498499-c5b4-452f-9ff9-2318dbb86000/2019-01-03T163633.780215Z/metadata.json +++ /dev/null @@ -1,1449 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.6.2/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI_organoids_pooled_2", - "biomaterial_name": "pooled cells from 4 dissociated organoids", - "biomaterial_description": "pooled cells from 4 dissociated organoids (wibj_2, kucg_2, hoik_1, sojd_3)", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "selected_cell_type": [ - { - "text": "neural cell", - "ontology": "CL:0002319", - "ontology_label": "neural cell" - } - ], - "total_estimated_cells": 6210, - "provenance": { - "document_id": "c2396f83-22e4-4a2d-8cce-a30feb533603", - "submission_date": "2019-01-03T12:07:51.214Z", - "update_date": "2019-01-03T12:08:03.256Z" - } - }, - "organoid_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0214i-wibj_2_2", - "biomaterial_name": "human cerebral organoid wibj_2", - "biomaterial_description": "human cerebral organoid wibj_2, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033", - "ontology_label": "day" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": true, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "a690df06-cc52-4346-a926-fe5e5b3a7547", - "submission_date": "2019-01-03T12:07:51.090Z", - "update_date": "2019-01-03T12:08:02.342Z" - } - }, - "organoid_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0214i-kucg_2_2", - "biomaterial_name": "human cerebral organoid kucg_2", - "biomaterial_description": "human cerebral organoid kucg_2, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033", - "ontology_label": "day" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": true, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "f0b636ce-505c-4339-a69c-2305352b6796", - "submission_date": "2019-01-03T12:07:51.122Z", - "update_date": "2019-01-03T12:08:02.944Z" - } - }, - "organoid_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0314i-hoik_1_2", - "biomaterial_name": "human cerebral organoid hoik_1", - "biomaterial_description": "human cerebral organoid hoik_1, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033", - "ontology_label": "day" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": true, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "46e7ed04-5916-4c10-8a05-fe510eda819a", - "submission_date": "2019-01-03T12:07:51.151Z", - "update_date": "2019-01-03T12:08:02.497Z" - } - }, - "organoid_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.3.9/organoid", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Org_HPSI0314i-sojd_3_2", - "biomaterial_name": "human cerebral organoid sojd_3", - "biomaterial_description": "human cerebral organoid sojd_3, 62d", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "model_for_organ": { - "text": "Brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "organoid_age": 62, - "organoid_age_unit": { - "text": "day", - "ontology": "UO:0000033", - "ontology_label": "day" - }, - "organoid_type": "stem cell-derived", - "embedded_in_matrigel": true, - "organoid_growth_environment": "suspension", - "provenance": { - "document_id": "d49998ff-c873-41fd-bb44-f221f89b8f15", - "submission_date": "2019-01-03T12:07:51.178Z", - "update_date": "2019-01-03T12:08:02.781Z" - } - }, - "cell_line_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj_2", - "biomaterial_name": "iPS cell line wibj_2", - "biomaterial_description": "iPS cell line wibj_2", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2627567" - }, - "disease": { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248", - "ontology_label": "pluripotent stem cell" - }, - "catalog_number": "77650057", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-wibj_2", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 32, - "growth_medium": "mTeSR1", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2014-10-24T00:00:00Z", - "provenance": { - "document_id": "a689172e-cae2-4e2c-b1d2-5aeff0a90171", - "submission_date": "2019-01-03T12:07:51.043Z", - "update_date": "2019-01-03T12:08:03.319Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj_skin", - "biomaterial_name": "Skin cells from HPSI0214i-wibj_skin", - "biomaterial_description": "Skin cells from HPSI0214i-wibj_skin", - "biosd_biomaterial": "SAMEA2397844", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097", - "ontology_label": "skin of body" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003", - "ontology_label": "skin epidermis" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "provenance": { - "document_id": "597b4050-0778-4a81-b882-e1704ab0b6ad", - "submission_date": "2019-01-03T12:07:50.973Z", - "update_date": "2019-01-03T12:08:03.189Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-wibj", - "biomaterial_name": "donor HPSI0214i-wibj", - "biomaterial_description": "donor HPSI0214i-wibj_2, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2398911" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "sex": "female", - "organism_age": "55-59", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "HANCESTRO:0462", - "ontology_label": "British" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "4934d9c3-753b-47bc-b2d5-468ce255a139", - "submission_date": "2019-01-03T12:07:50.939Z", - "update_date": "2019-01-03T12:08:02.040Z" - } - }, - "cell_line_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg_2", - "biomaterial_name": "iPS cell line kucg_2", - "biomaterial_description": "iPS cell line kucg_2", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2645814" - }, - "disease": { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248", - "ontology_label": "pluripotent stem cell" - }, - "catalog_number": "77650065", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0214i-kucg_2", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 36, - "growth_medium": "mTeSR1", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2014-11-03T00:00:00Z", - "provenance": { - "document_id": "37833da3-505d-4bb2-916e-26aa8985d183", - "submission_date": "2019-01-03T12:07:51.052Z", - "update_date": "2019-01-03T12:08:03.268Z" - } - }, - "specimen_from_organism_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg_skin", - "biomaterial_name": "Skin cells from HPSI0214i-kucg_skin", - "biomaterial_description": "Skin cells from HPSI0214i-kucg_skin", - "biosd_biomaterial": "SAMEA2398627", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097", - "ontology_label": "skin of body" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003", - "ontology_label": "skin epidermis" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "provenance": { - "document_id": "1fc181fe-60c6-4b94-85c1-1f227be60658", - "submission_date": "2019-01-03T12:07:50.987Z", - "update_date": "2019-01-03T12:08:03.087Z" - } - }, - "donor_organism_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0214i-kucg", - "biomaterial_name": "donor HPSI0214i-kucg", - "biomaterial_description": "donor HPSI0214i-kucg_2, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2397923" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "sex": "male", - "organism_age": "65-69", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "HANCESTRO:0462", - "ontology_label": "British" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "7c3a6d87-9f43-4de5-b47d-6fa78a897624", - "submission_date": "2019-01-03T12:07:50.949Z", - "update_date": "2019-01-03T12:08:01.492Z" - } - }, - "cell_line_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik_1", - "biomaterial_name": "iPS cell line hoik_1", - "biomaterial_description": "iPS cell line hoik_1", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2698315" - }, - "disease": { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248", - "ontology_label": "pluripotent stem cell" - }, - "catalog_number": "77650129", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-hoik_1", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 28, - "growth_medium": "mTeSR1", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2015-02-02T00:00:00Z", - "provenance": { - "document_id": "d954547d-94bc-401d-bdff-ccd727251c74", - "submission_date": "2019-01-03T12:07:51.061Z", - "update_date": "2019-01-03T12:08:03.322Z" - } - }, - "specimen_from_organism_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik_skin", - "biomaterial_name": "Skin cells from HPSI0314i-hoik_skin", - "biomaterial_description": "Skin cells from HPSI0314i-hoik_skin", - "biosd_biomaterial": "SAMEA2399963", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097", - "ontology_label": "skin of body" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003", - "ontology_label": "skin epidermis" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "provenance": { - "document_id": "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b", - "submission_date": "2019-01-03T12:07:50.997Z", - "update_date": "2019-01-03T12:08:02.789Z" - } - }, - "donor_organism_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-hoik", - "biomaterial_name": "donor HPSI0314i-hoik", - "biomaterial_description": "donor HPSI0314i-hoik_1, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2399961" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "sex": "female", - "organism_age": "40-44", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "human_specific": { - "ethnicity": [ - { - "text": "European, White, British", - "ontology": "HANCESTRO:0462", - "ontology_label": "British" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "3322ea3a-30ea-4e6e-b187-18525de4ee3e", - "submission_date": "2019-01-03T12:07:50.957Z", - "update_date": "2019-01-03T12:08:02.270Z" - } - }, - "cell_line_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.1/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd_3", - "biomaterial_name": "iPS cell line sojd_3", - "biomaterial_description": "iPS cell line sojd_3", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2627569" - }, - "disease": { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "cell_type": { - "text": "pluripotent stem cell", - "ontology": "CL:0002248", - "ontology_label": "pluripotent stem cell" - }, - "catalog_number": "77650126", - "catalog_url": "http://www.hipsci.org/lines/#/lines/HPSI0314i-sojd_3", - "cell_line_type": "induced pluripotent", - "cell_morphology": { - "cell_viability_method": "Growth to confluence post-thaw" - }, - "growth_conditions": { - "passage_number": 29, - "growth_medium": "mTeSR1", - "feeder_layer_type": "feeder-free", - "drug_treatment": "Cells were cultured in presence of Penicillin and Streptomycin", - "mycoplasma_testing_method": "PCR", - "mycoplasma_testing_results": "pass" - }, - "date_established": "2015-01-09T00:00:00Z", - "provenance": { - "document_id": "95deef55-86e9-42be-9f82-3102b0d89dbe", - "submission_date": "2019-01-03T12:07:51.071Z", - "update_date": "2019-01-03T12:08:03.373Z" - } - }, - "specimen_from_organism_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.4/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd_skin", - "biomaterial_name": "Skin cells from HPSI0314i-sojd_skin", - "biomaterial_description": "Skin cells from HPSI0314i-sojd_skin", - "biosd_biomaterial": "SAMEA2418243", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "skin of body", - "ontology": "UBERON:0002097", - "ontology_label": "skin of body" - }, - "organ_part": { - "text": "skin epidermis", - "ontology": "UBERON:0001003", - "ontology_label": "skin epidermis" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "provenance": { - "document_id": "2e32e319-53d4-4e69-af0f-c43e2b15a94f", - "submission_date": "2019-01-03T12:07:51.019Z", - "update_date": "2019-01-03T12:08:03.124Z" - } - }, - "donor_organism_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.1/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "HPSI0314i-sojd", - "biomaterial_name": "donor HPSI0314i-sojd", - "biomaterial_description": "donor HPSI0314i-sojd_3, iPSC, cell line, skin", - "ncbi_taxon_id": [ - 9606 - ], - "biosd_biomaterial": "SAMEA2418245" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "sex": "female", - "organism_age": "45-49", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "human_specific": { - "ethnicity": [ - { - "text": "White - other, Ad Mixed American", - "ontology": "HANCESTRO:0463", - "ontology_label": "American" - } - ] - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "is_living": "yes", - "provenance": { - "document_id": "872169f4-8479-4476-9646-20b3997e1f01", - "submission_date": "2019-01-03T12:07:50.965Z", - "update_date": "2019-01-03T12:08:02.262Z" - } - }, - "sequence_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_2_S6_L007_I1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "fdb858b0c02365a1ac66b93eb7d6ad91" - }, - "read_index": "index1", - "lane_index": 7, - "read_length": 8, - "provenance": { - "document_id": "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", - "submission_date": "2019-01-03T12:07:50.674Z", - "update_date": "2019-01-03T12:16:54.090Z" - } - }, - "sequence_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_2_S6_L007_R1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "be86a99afeb1e9142db887d9fcdfe3c7" - }, - "read_index": "read1", - "lane_index": 7, - "read_length": 26, - "provenance": { - "document_id": "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", - "submission_date": "2019-01-03T12:07:50.685Z", - "update_date": "2019-01-03T12:20:06.160Z" - } - }, - "sequence_file_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/7.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "GAC027_hOrg_HipSci_2_S6_L007_R2_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "611ba41c18875cc6392c64e0b01ce875" - }, - "read_index": "read2", - "lane_index": 7, - "read_length": 100, - "provenance": { - "document_id": "5989ca50-45b5-4834-bfde-d290a8dfa97e", - "submission_date": "2019-01-03T12:07:50.705Z", - "update_date": "2019-01-03T12:28:59.095Z" - } - }, - "supplementary_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "hipsci-ipsc-pipeline.pdf", - "file_format": "pdf" - }, - "file_description": "iPSC induction by Sendai virus protocol.", - "provenance": { - "document_id": "434fa581-90e3-43cc-8ff5-2596e6e8d366", - "submission_date": "2019-01-03T12:07:50.566Z", - "update_date": "2019-01-03T12:12:23.302Z" - } - }, - "supplementary_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Dissociation_protocol_130-092-628.pdf", - "file_format": "pdf" - }, - "file_description": "Cerebral organoid dissociation protocol.", - "provenance": { - "document_id": "f126dd41-0041-46b7-8c63-7da264be6b81", - "submission_date": "2019-01-03T12:07:50.578Z", - "update_date": "2019-01-03T12:11:14.380Z" - } - }, - "supplementary_file_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/1.1.5/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf", - "file_format": "pdf" - }, - "file_description": "10x Chromium single cell 3' v2 library preparation.", - "provenance": { - "document_id": "f48ebd9a-f3ac-4e02-b698-7146cd396946", - "submission_date": "2019-01-03T12:07:50.588Z", - "update_date": "2019-01-03T12:11:14.378Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/project/9.0.4/project", - "schema_type": "project", - "project_core": { - "project_short_name": "HPSI human cerebral organoids", - "project_title": "Assessing the relevance of organoids to model inter-individual variation", - "project_description": "The purpose of this project is to assess the relevance of pluripotent stem cell-derived cerebral and liver organoids to recapitulate the variation in cell-type specific gene expression programs between individuals. Towards this aim, we will generate reference atlases of the developing cortex and liver from multiple individuals, derive iPSC lines from these same individuals, and determine if inter-individual gene expression variation is recapitulated in cerebral and liver organoids from the same individual from which we have reference maps. In parallel we will assess the genetic contribution to variablity between organoids from different iPSCs of multiple human individuals that are available in existing iPSC resources (e.g. HipSci)." - }, - "contributors": [ - { - "contact_name": "Barbara,,Treutlein", - "email": "barbara_treutlein@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "project_role": "principal investigator", - "orcid_id": "0000-0002-3299-5597", - "corresponding_contributor": true - }, - { - "contact_name": "J,Gray,Camp", - "email": "gray_camp@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Zhisong,,He", - "email": "zhisong_he@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Sabina,,Kanton", - "email": "sabina_kanton@eva.mpg.de", - "institution": "Max Planck Institute for Evolutionary Anthropology", - "address": "Deutscher Pl. 6, 04103 Leipzig", - "country": "Germany", - "corresponding_contributor": false - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - } - ], - "provenance": { - "document_id": "d96c2451-6e22-441f-a3e6-70fd0878bb1b", - "submission_date": "2019-01-03T12:07:50.548Z", - "update_date": "2019-01-03T12:07:59.988Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/4.4.0/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "10x_3'_library_preparation", - "protocol_name": "10x 3' single cell library preparation", - "protocol_description": "10x Chromium single cell 3' v2 library preparation", - "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" - }, - "nucleic_acid_source": "single cell", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869", - "ontology_label": "polyA RNA" - }, - "library_construction_approach": { - "text": "Chromium 3' Single Cell v2", - "ontology": "EFO:0009310", - "ontology_label": "10X v2 sequencing" - }, - "end_bias": "3 prime tag", - "primer": "poly-dT", - "strand": "unstranded", - "cell_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 15, - "barcode_length": 10 - }, - "library_construction_kit": { - "retail_name": "10X Chromium Single Cell 3' Solution v2 Chemistry", - "manufacturer": "10X Genomics" - }, - "provenance": { - "document_id": "65ce5281-b07e-4b21-be8d-66ac5dea4d69", - "submission_date": "2019-01-03T12:07:51.265Z", - "update_date": "2019-01-03T12:07:58.774Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/9.0.3/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "10x_scRNASeq", - "protocol_name": "10x single cell RNA Sequencing", - "protocol_description": "10x RNA sequencing", - "document": "CG00052_SingleCell3_ReagentKitv2UserGuide_RevE.pdf" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565", - "ontology_label": "Illumina HiSeq 2500" - }, - "paired_end": true, - "sequencing_approach": { - "text": "tag based single cell RNA sequencing", - "ontology": "EFO:0008440", - "ontology_label": "tag based single cell RNA sequencing" - }, - "provenance": { - "document_id": "1547584e-d9e4-4519-a72a-91db0d0fec3c", - "submission_date": "2019-01-03T12:07:51.274Z", - "update_date": "2019-01-03T12:07:58.338Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Cerebral_organoid_dissociation", - "protocol_name": "cerebral organoid dissociation", - "protocol_description": "cerebral organoid dissociation", - "document": "Dissociation_protocol_130-092-628.pdf" - }, - "dissociation_method": { - "text": "Papain-based enzymatic dissociation", - "ontology": "EFO:0009128", - "ontology_label": "enzymatic dissociation" - }, - "protocol_reagents": [ - { - "retail_name": "Neural Tissue Dissociation Kit", - "catalog_number": "130-092-628", - "manufacturer": "Miltenyi Biotec" - } - ], - "provenance": { - "document_id": "c23de226-536c-403d-a757-f4200cb1777b", - "submission_date": "2019-01-03T12:07:51.254Z", - "update_date": "2019-01-03T12:07:58.689Z" - } - }, - "differentiation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/1.3.0/differentiation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Org_Lanc_2014", - "protocol_name": "Differentiation of cerebral organoids", - "protocol_description": "Generation of cerebral organoids from human pluripotent stem cells", - "publication_doi": "10.1038/nprot.2014.158" - }, - "differentiation_method": "embryoid bodies", - "target_pathway": "RHO, ROCK", - "validation_method": "immunostaining", - "reagents": [ - { - "retail_name": "ROCK inhibitor Y27632" - } - ], - "small_molecules": "Vitamin A (retinoic acid)", - "provenance": { - "document_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47", - "submission_date": "2019-01-03T12:07:51.244Z", - "update_date": "2019-01-03T12:07:58.180Z" - } - }, - "ipsc_induction_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.0.1/ipsc_induction_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "ipsc_induction_protocol_1", - "protocol_name": "iPSC induction by Sendai virus", - "protocol_description": "Fibroblasts are thawed, transduced using Cytotune 2.0 Sendai virus (containing the Yamanaka genes encoding transcription factors Oct4, Sox2, cMyc and Klf4) and maintained until iPSC colony formation. Colonies are then picked and cultured to obtain a sizable yield of IPS cells, which are banked to a commercial grade standard. These banks then undergo quality checks to ensure the banks pass resuscitation tests and are free of mycoplasma.", - "document": "hipsci-ipsc-pipeline.pdf" - }, - "ipsc_induction_method": "sendai virus", - "pluripotency_vector_removed": "yes", - "ipsc_induction_kit": { - "retail_name": "Cytotune 1.0", - "manufacturer": "Thermofisher" - }, - "pluripotency_test": "HipSci Pluri test", - "ipsc_induction_produced_in_house": false, - "provenance": { - "document_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7", - "submission_date": "2019-01-03T12:07:51.230Z", - "update_date": "2019-01-03T12:07:58.380Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "tech_rep_3" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "54438211-29fb-4e57-87f4-95412e5d8b15", - "submission_date": "2019-01-03T12:07:51.302Z", - "update_date": "2019-01-03T12:07:59.105Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_22" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", - "submission_date": "2019-01-03T12:07:51.550Z", - "update_date": "2019-01-03T12:07:59.380Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_10" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", - "submission_date": "2019-01-03T12:07:51.438Z", - "update_date": "2019-01-03T12:08:00.039Z" - } - }, - "process_3.json": { - "process_core": { - "process_id": "process_id_5" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", - "submission_date": "2019-01-03T12:07:51.383Z", - "update_date": "2019-01-03T12:07:58.898Z" - } - }, - "process_4.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "01e52705-77de-4715-b35f-442aff9312be", - "submission_date": "2019-01-03T12:07:51.338Z", - "update_date": "2019-01-03T12:07:59.330Z" - } - }, - "process_5.json": { - "process_core": { - "process_id": "process_id_13" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "58a58315-2f03-4a36-9cea-dd306b609ba9", - "submission_date": "2019-01-03T12:07:51.477Z", - "update_date": "2019-01-03T12:07:59.265Z" - } - }, - "process_6.json": { - "process_core": { - "process_id": "process_id_6" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "56c911d5-6b99-486c-9ce7-141ee41528eb", - "submission_date": "2019-01-03T12:07:51.391Z", - "update_date": "2019-01-03T12:07:59.791Z" - } - }, - "process_7.json": { - "process_core": { - "process_id": "process_id_2" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "23fe1739-6bbe-4a86-be96-bd75f19f8375", - "submission_date": "2019-01-03T12:07:51.346Z", - "update_date": "2019-01-03T12:07:58.637Z" - } - }, - "process_8.json": { - "process_core": { - "process_id": "process_id_16" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "831dc734-9813-4c34-a163-16dd5b75d9a0", - "submission_date": "2019-01-03T12:07:51.503Z", - "update_date": "2019-01-03T12:07:59.485Z" - } - }, - "process_9.json": { - "process_core": { - "process_id": "process_id_7" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "d8f1d436-6bc3-4638-9801-8a9241996d28", - "submission_date": "2019-01-03T12:07:51.413Z", - "update_date": "2019-01-03T12:07:59.548Z" - } - }, - "process_10.json": { - "process_core": { - "process_id": "process_id_3" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", - "submission_date": "2019-01-03T12:07:51.354Z", - "update_date": "2019-01-03T12:07:58.435Z" - } - }, - "process_11.json": { - "process_core": { - "process_id": "process_id_19" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "024c9f05-1743-4d66-83b7-134a31cd1c27", - "submission_date": "2019-01-03T12:07:51.527Z", - "update_date": "2019-01-03T12:07:59.150Z" - } - }, - "process_12.json": { - "process_core": { - "process_id": "process_id_8" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", - "submission_date": "2019-01-03T12:07:51.421Z", - "update_date": "2019-01-03T12:07:59.502Z" - } - }, - "process_13.json": { - "process_core": { - "process_id": "process_id_4" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "baa3a061-534c-4b6e-8c51-a11a8307f537", - "submission_date": "2019-01-03T12:07:51.362Z", - "update_date": "2019-01-03T12:07:58.911Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.4/links", - "schema_type": "link_bundle", - "schema_version": "1.1.4", - "links": [ - { - "process": "54438211-29fb-4e57-87f4-95412e5d8b15", - "inputs": [ - "c2396f83-22e4-4a2d-8cce-a30feb533603" - ], - "input_type": "biomaterial", - "outputs": [ - "9c49bbf2-cf62-4f94-9b9d-a3da42e2d52a", - "ac93d656-4aa5-4f6c-b273-dc1d8be1934c", - "5989ca50-45b5-4834-bfde-d290a8dfa97e" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "65ce5281-b07e-4b21-be8d-66ac5dea4d69" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "1547584e-d9e4-4519-a72a-91db0d0fec3c" - } - ] - }, - { - "process": "7d683bc4-6e59-4c7e-bbc8-5dad46fe2684", - "inputs": [ - "a690df06-cc52-4346-a926-fe5e5b3a7547", - "f0b636ce-505c-4339-a69c-2305352b6796", - "46e7ed04-5916-4c10-8a05-fe510eda819a", - "d49998ff-c873-41fd-bb44-f221f89b8f15" - ], - "input_type": "biomaterial", - "outputs": [ - "c2396f83-22e4-4a2d-8cce-a30feb533603" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "c23de226-536c-403d-a757-f4200cb1777b" - } - ] - }, - { - "process": "d1a9aae1-99dc-4b49-bee3-af685b7f013a", - "inputs": [ - "a689172e-cae2-4e2c-b1d2-5aeff0a90171" - ], - "input_type": "biomaterial", - "outputs": [ - "a690df06-cc52-4346-a926-fe5e5b3a7547" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" - } - ] - }, - { - "process": "a02a2a59-cdb4-4261-b220-b0cfebaec5ac", - "inputs": [ - "597b4050-0778-4a81-b882-e1704ab0b6ad" - ], - "input_type": "biomaterial", - "outputs": [ - "a689172e-cae2-4e2c-b1d2-5aeff0a90171" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" - } - ] - }, - { - "process": "01e52705-77de-4715-b35f-442aff9312be", - "inputs": [ - "4934d9c3-753b-47bc-b2d5-468ce255a139" - ], - "input_type": "biomaterial", - "outputs": [ - "597b4050-0778-4a81-b882-e1704ab0b6ad" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "58a58315-2f03-4a36-9cea-dd306b609ba9", - "inputs": [ - "37833da3-505d-4bb2-916e-26aa8985d183" - ], - "input_type": "biomaterial", - "outputs": [ - "f0b636ce-505c-4339-a69c-2305352b6796" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" - } - ] - }, - { - "process": "56c911d5-6b99-486c-9ce7-141ee41528eb", - "inputs": [ - "1fc181fe-60c6-4b94-85c1-1f227be60658" - ], - "input_type": "biomaterial", - "outputs": [ - "37833da3-505d-4bb2-916e-26aa8985d183" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" - } - ] - }, - { - "process": "23fe1739-6bbe-4a86-be96-bd75f19f8375", - "inputs": [ - "7c3a6d87-9f43-4de5-b47d-6fa78a897624" - ], - "input_type": "biomaterial", - "outputs": [ - "1fc181fe-60c6-4b94-85c1-1f227be60658" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "831dc734-9813-4c34-a163-16dd5b75d9a0", - "inputs": [ - "d954547d-94bc-401d-bdff-ccd727251c74" - ], - "input_type": "biomaterial", - "outputs": [ - "46e7ed04-5916-4c10-8a05-fe510eda819a" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" - } - ] - }, - { - "process": "d8f1d436-6bc3-4638-9801-8a9241996d28", - "inputs": [ - "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b" - ], - "input_type": "biomaterial", - "outputs": [ - "d954547d-94bc-401d-bdff-ccd727251c74" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" - } - ] - }, - { - "process": "a9a39b30-8243-4d08-8f36-8f2e1275e8d0", - "inputs": [ - "3322ea3a-30ea-4e6e-b187-18525de4ee3e" - ], - "input_type": "biomaterial", - "outputs": [ - "ad702cb9-3b40-4f8f-b9a5-331eeb153d9b" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "024c9f05-1743-4d66-83b7-134a31cd1c27", - "inputs": [ - "95deef55-86e9-42be-9f82-3102b0d89dbe" - ], - "input_type": "biomaterial", - "outputs": [ - "d49998ff-c873-41fd-bb44-f221f89b8f15" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "3ec905f4-5950-4cfa-bd0b-86cc0370fd47" - } - ] - }, - { - "process": "50d53f80-5e54-4cda-97f0-5acb4d686d3e", - "inputs": [ - "2e32e319-53d4-4e69-af0f-c43e2b15a94f" - ], - "input_type": "biomaterial", - "outputs": [ - "95deef55-86e9-42be-9f82-3102b0d89dbe" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "ipsc_induction_protocol", - "protocol_id": "97a30135-246f-4c0d-aef8-4e33183d1ff7" - } - ] - }, - { - "process": "baa3a061-534c-4b6e-8c51-a11a8307f537", - "inputs": [ - "872169f4-8479-4476-9646-20b3997e1f01" - ], - "input_type": "biomaterial", - "outputs": [ - "2e32e319-53d4-4e69-af0f-c43e2b15a94f" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44.2019-09-20T103932.395795Z.json b/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44.2019-09-20T103932.395795Z.json new file mode 100644 index 000000000..8b58a1e79 --- /dev/null +++ b/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44.2019-09-20T103932.395795Z.json @@ -0,0 +1,1072 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "27d5df55", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "c2ae104c7e048e34f7e11c33d336ea76", + "sha1": "2d934a2d27629d3d0b1c146e9ebd8403f49f8bec", + "sha256": "2f9df9ebcdd0440e89070985d6d1868b5d9ab39b5ba6845afcb069f82e29e114", + "size": 1167, + "uuid": "eb27c398-f017-4ef1-acc8-3f51af87fe17", + "version": "2019-09-20T082959.187000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "5c140335", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "a0bf601a253a5f851b45b9236af45064", + "sha1": "434291f6cc51414b40d886e46c3778be45beaa25", + "sha256": "24d0c61756a18088e1fb337b868ab636eae6dc2a0c3c0ea7e64da2dee72b16d5", + "size": 1095, + "uuid": "0a63e007-09d0-4330-989b-ca248f8b3c3c", + "version": "2019-09-20T082955.265000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ec11426d", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "1c9ddd9f5a7b1e02e58b243561ec767a", + "sha1": "abf4c58394716263dffd188cf07555a5a73c948d", + "sha256": "83c0f4789214b4fd6419d8ee7d4c0ef7c3b46ce3df1dbc1856de85221316e182", + "size": 1762, + "uuid": "fa1bd656-7f7b-4288-84c6-d511232cfe95", + "version": "2019-09-20T082955.262000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5523b822", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "dd9a989d9708f2c409f2eeaf758a682c", + "sha1": "cf0fa61520f7d160c5772da8e7b54eda67c2dfa5", + "sha256": "bd07544040ea5435e48e590e8647acf428011fcf987ef8f407c2a3bea57ea010", + "size": 770, + "uuid": "12484c33-24ec-4293-8f96-4cb1a43a6479", + "version": "2019-09-20T101335.720000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "68f76fda", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "30ef56ceb478adcd8f2a2b51fdccd8cd", + "sha1": "4e2aeb77d253e7a85b73a7ca82d5dd3ae0c01a36", + "sha256": "65e0770ccb79a470304401311baed3a7247de80049fd776fdb6c491b9aca42d1", + "size": 771, + "uuid": "f85b458b-b189-4ee7-939a-c905b70ae431", + "version": "2019-09-20T100406.780000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a6941bf4", + "indexed": true, + "name": "sequence_file_2.json", + "s3_etag": "385e335a401d98060b8d2950b9356ad1", + "sha1": "ad40563e13450f6ac9fe5638a5c29bccbfdbcab2", + "sha256": "de0dd3f2711790d9bf2ab61b6409660a424e20c7e59610d3cd7c5d6b56e45ca7", + "size": 770, + "uuid": "18feeb7d-66ca-4ea4-a019-a10e5b762465", + "version": "2019-09-20T085013.111000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4269da20", + "indexed": true, + "name": "supplementary_file_0.json", + "s3_etag": "8e9cb0ab1486df5372f1aa2990ce5da5", + "sha1": "0093b1b2f18c2936ae1a4aa96ba97797bddb18d2", + "sha256": "4c805fb81b53e9f986ad9880e03ed361d1a61c3557dea154c7837151fca17294", + "size": 554, + "uuid": "2e64e936-85ec-49a0-8365-578b5621bcb1", + "version": "2019-09-20T083858.167000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "553a2b98", + "indexed": true, + "name": "supplementary_file_1.json", + "s3_etag": "62410fdf0c79371940f7f9ca2f5e96e5", + "sha1": "239127a04d5a7e15380b1e2b5165f407ef47cd1d", + "sha256": "4da49acced5a0dec44273236d1f8d3f33a75ee559b85ce7c59e8e614f3efe9ea", + "size": 556, + "uuid": "720e6453-71ff-4742-ba6a-e5a3a5d3cee0", + "version": "2019-09-20T083858.165000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ef1f212e", + "indexed": true, + "name": "supplementary_file_2.json", + "s3_etag": "28af52bb75f5e1f461abf53dfd6d97da", + "sha1": "fb14f93b5d5210370b7d1eda27f25324d1443d36", + "sha256": "ae0027df4ef2eafcce8de66882c88f100b28a5cd14d5bd0b2bcafca6813d8631", + "size": 527, + "uuid": "09917cf3-76de-4b85-8944-03664cd0d954", + "version": "2019-09-20T083858.165000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "418269cd", + "indexed": true, + "name": "supplementary_file_3.json", + "s3_etag": "749ef86309a7536393c144e8bb084dc5", + "sha1": "08a4f5e4d962a351e5b0d3e8feff5c58e5a0a202", + "sha256": "d68462f8d2a4884682f07d15337c8a1bbe20d556f82e27d6e73520846b1e10da", + "size": 556, + "uuid": "8fb964a1-fd66-43b6-9d13-57db6bd185f2", + "version": "2019-09-20T083858.167000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "993805d8", + "indexed": true, + "name": "project_0.json", + "s3_etag": "0e2ac7fd8c4314b99ebcc238f6438279", + "sha1": "f40ac161cceb808cfc9d1b59d05c157bd5104539", + "sha256": "f2f10063aa3580d3447fce1f05854f0a389987bb565b3b41d6730b6084c704e6", + "size": 9450, + "uuid": "9c20a245-f2c0-43ae-82c9-2232ec6b594f", + "version": "2019-09-20T082955.163000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "05938885", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "8170f907f8bf4e41d4e414f271203975", + "sha1": "1e8f848f6749206458f94242ce1f5b733b2caa85", + "sha256": "34a9158f4cfa419fd856cd081aaed7d5df3735e8d62459eef07ae664645079b8", + "size": 1751, + "uuid": "6ce5a9c7-b4f7-41e5-a182-21e85627feee", + "version": "2019-09-20T082958.625000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "807e47ff", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "86a3feb1fab676572a24dad257c57806", + "sha1": "6f9d6ed5c6dcc0c45bb82114417298793598eeec", + "sha256": "6bc9d2998d34d98867aff7efb5136df709f8f8589bca8d11e6288c996c5eb112", + "size": 1157, + "uuid": "e01aa420-488b-4189-a8c8-98ada395ee91", + "version": "2019-09-20T082958.905000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "7cf5db5c", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "379074d6d018be136a0f04a6a2225edc", + "sha1": "12f381c7b7aba53604acc8b43ec2ab24d098d477", + "sha256": "1778d7a31e2d214cd46879f95b91d5be0a4a118c339e2cfe0a4ec5388c523a55", + "size": 782, + "uuid": "a3623f22-83e7-4207-b204-34041abb54e2", + "version": "2019-09-20T082958.448000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "7aa6c098", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "28f770ae6c883b95fdd51d73f8779613", + "sha1": "57a39ecdcf603f23079027997447cc4245abdc24", + "sha256": "bad90547359f4c4042087d371d305d381fb473ce682797969da1ffc5da279887", + "size": 973, + "uuid": "76f64d5b-fa01-4efe-ad4a-097d70311581", + "version": "2019-09-20T082958.761000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "27c8384f", + "indexed": true, + "name": "collection_protocol_0.json", + "s3_etag": "6d9c738cdd08d0dc7a6c4c7bcc396146", + "sha1": "6c7bb54ccd242881736b313c6bdd1ef324efa975", + "sha256": "34df8edc132c77a64a4d371ce284d28f415bca77cc4db42925c6f32bddd05403", + "size": 915, + "uuid": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2", + "version": "2019-09-20T082958.737000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "347672b1", + "indexed": true, + "name": "process_0.json", + "s3_etag": "2cd6d99bc699352ac6323d52d06bacc6", + "sha1": "76b12b430baff64132c0da39c22755e759b393bc", + "sha256": "0f790f4f47685127eb71f0401061c13add6d406a2bfc946f637eee80ffc0b80e", + "size": 476, + "uuid": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", + "version": "2019-09-20T082959.338000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "67528748", + "indexed": true, + "name": "process_1.json", + "s3_etag": "b06f6b5b98fbf590e5cbdf8f4872c3a3", + "sha1": "27505dcd710973cbaa6edf7b293c7364f980f1bc", + "sha256": "53b504c283ef059354e481928416841c3166e4cdaa6009941d472dbda3cdb165", + "size": 447, + "uuid": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", + "version": "2019-09-20T082959.191000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "97a6eef6", + "indexed": true, + "name": "process_2.json", + "s3_etag": "31d84fdd3bd9ec3ef0cc09e738168270", + "sha1": "4df3d0c3cbd4a18b98fa091920318d459dc2253e", + "sha256": "105d79c7027b2b795cd67f96433d46a11ab718a4a3b67a36084678873d7afdae", + "size": 446, + "uuid": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", + "version": "2019-09-20T082959.366000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "afe1de7d", + "indexed": true, + "name": "links.json", + "s3_etag": "e00d35caa8374da25b82de4a4358611d", + "sha1": "769e482e1902871370aa269dc264379a7bdb64b9", + "sha256": "e237b747a7f00824d9e7fca8285500dcf26c335c31a7169b2b5a655f1145776b", + "size": 2322, + "uuid": "774029ec-ba28-49e6-ae47-6403f5a9555e", + "version": "2019-09-20T104007.387625Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "759039c3", + "indexed": false, + "name": "19D015_NeuNT_R1.fastq.gz", + "s3_etag": "ed76eee572ae35b0eff88a66d07e4109-769", + "sha1": "5b5562b854a46298f2459b471def0f6e02d51752", + "sha256": "ce7471e89d0432c46ba22a1421ec5e89282d051a1691824a912205d9a8f08092", + "size": 51558308013, + "uuid": "ea5eea99-d788-4762-8de5-32602316da79", + "version": "2019-09-20T104007.794231Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "9069c15e", + "indexed": false, + "name": "19D015_NeuNT_R2.fastq.gz", + "s3_etag": "a4224318fdcbe14d2445bb2accfee3e8-633", + "sha1": "78f248cc1a43c307e77476a1195ed887ab0329c7", + "sha256": "90a8b913b628cfcad5a02b8628b1dfd17a5964ba9f590107404ee42035a69b1e", + "size": 42457074211, + "uuid": "351cae9c-9695-4797-b455-526dd29117bb", + "version": "2019-09-20T104008.028755Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "80b75620", + "indexed": false, + "name": "19D015_NeuNT_I1.fastq.gz", + "s3_etag": "6a9109b858d853ad276e1049bd7f5738-59", + "sha1": "a889db5ca65a684e3c25ebfb94d950e7d5b25060", + "sha256": "b1ed22a4f76feb2459ff5f2b958a18ea443aae44d93556cfeac53417ae74f017", + "size": 3935041540, + "uuid": "b64d8e12-028a-46fd-a778-5a5a8e971289", + "version": "2019-09-20T104008.305993Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "82c6888c", + "indexed": false, + "name": "NeuN_enrichment_protocol.pdf", + "s3_etag": "07f40c8891e3ee6c8afcbefc5ae5666e", + "sha1": "cd7fc7a040f22d885e6dce51a88c2ab4d39c9208", + "sha256": "347151ff3cc9aba252ca2bbb48f0aaaea0164105f5cac88ce9fb438c2efd76c3", + "size": 74562, + "uuid": "8e71749b-d445-409a-bc53-ba359438df69", + "version": "2019-09-20T104008.555357Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "18cb622e", + "indexed": false, + "name": "Single_nuclei_dissociation_protocol.pdf", + "s3_etag": "65ff1ba0ab370718fea68ba8ecaa5f62", + "sha1": "2b8981a89132fbbad5270b3079b7ca1422613e8a", + "sha256": "c004a0458be630d278542be89de54184fd61166deb61316a434d22381cc9e7b8", + "size": 72083, + "uuid": "dfa8a3b3-192c-4867-8c52-f956a6ebab06", + "version": "2019-09-20T104008.746891Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "ced2f561", + "indexed": false, + "name": "seq_protocol.pdf", + "s3_etag": "c74d7e9b5d3fe25d13cfc0c2ccc2c6c5", + "sha1": "29496e4720dee72f475bce872be3cba5091bf61e", + "sha256": "20554cc86f4388dcd35cf5810bf0cd3039405dcb7f8e759ea08498c7603aca37", + "size": 2008495, + "uuid": "deb6c7db-8ed1-4c87-ab39-44c3499e8499", + "version": "2019-09-20T104008.919497Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "5ef01a45", + "indexed": false, + "name": "standard_10x_library_preparation.pdf", + "s3_etag": "769a1335f7a9e6ec65c6284120f4b609", + "sha1": "11fae8d7a1ad844e3244163fc943e085e4bf87c6", + "sha256": "ab21d955fb53246c78b9828a8d83707720768a752ba0731a5e2145bb3a48de14", + "size": 7910067, + "uuid": "58b2c404-62c7-46cc-912f-99a5731cd8e5", + "version": "2019-09-20T104009.214107Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/13.3.0/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "19D015_NeuNT_nuclei", + "biomaterial_name": "19D015_NeuNT", + "biomaterial_description": "dissocitated nuclei of human retina (peripheral region), incubated with anti-NeuN antibody and FACS sorted (Nuclei with top 5% signal intensity)", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "selected_cell_types": [ + { + "text": "NeuN-positive-nuclei in peripheral retina", + "ontology": "CL:0000540", + "ontology_label": "neuron" + } + ], + "estimated_cell_count": 24600, + "provenance": { + "document_id": "eb27c398-f017-4ef1-acc8-3f51af87fe17", + "submission_date": "2019-09-20T08:29:51.970Z", + "update_date": "2019-09-20T08:29:59.187Z", + "schema_major_version": 13, + "schema_minor_version": 3 + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.4.0/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "19D015_per", + "biomaterial_name": "19D015_per", + "biomaterial_description": "retinal tissues from the donor body", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "eye", + "ontology": "UBERON:0000970", + "ontology_label": "eye" + }, + "organ_parts": [ + { + "text": "retina", + "ontology": "UBERON:0000966", + "ontology_label": "retina" + } + ], + "provenance": { + "document_id": "0a63e007-09d0-4330-989b-ca248f8b3c3c", + "submission_date": "2019-09-20T08:29:51.904Z", + "update_date": "2019-09-20T08:29:55.265Z", + "schema_major_version": 10, + "schema_minor_version": 4 + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/15.5.0/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "19D015", + "biomaterial_name": "Homo Sapiens", + "biomaterial_description": "postmortem human donor", + "ncbi_taxon_id": [ + 9606 + ] + }, + "human_specific": { + "ethnicity": [ + { + "text": "Caucasian", + "ontology": "HANCESTRO:0005", + "ontology_label": "European" + } + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "sex": "male", + "is_living": "no", + "organism_age": "73", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "development_stage": { + "text": "human adult", + "ontology": "HsapDv:0000087", + "ontology_label": "human adult stage" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "death": { + "cause_of_death": "heart failure", + "cold_perfused": false, + "hardy_scale": 2, + "organ_donation_death_type": "Donation after brainstem death (DBD)", + "normothermic_regional_perfusion": "no" + }, + "provenance": { + "document_id": "fa1bd656-7f7b-4288-84c6-d511232cfe95", + "submission_date": "2019-09-20T08:29:51.866Z", + "update_date": "2019-09-20T08:29:55.262Z", + "schema_major_version": 15, + "schema_minor_version": 5 + } + }, + "sequence_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "19D015_NeuNT_R1.fastq.gz", + "format": "fastq.gz", + "content_description": [ + { + "text": "DNA sequence", + "ontology": "data:3494", + "ontology_label": "DNA sequence" + } + ] + }, + "read_index": "read1", + "read_length": 26, + "library_prep_id": "batch_1", + "provenance": { + "document_id": "12484c33-24ec-4293-8f96-4cb1a43a6479", + "submission_date": "2019-09-20T08:29:52.232Z", + "update_date": "2019-09-20T10:13:35.720Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "sequence_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "19D015_NeuNT_R2.fastq.gz", + "format": "fastq.gz", + "content_description": [ + { + "text": "DNA sequence", + "ontology": "data:3494", + "ontology_label": "DNA sequence" + } + ] + }, + "read_index": "read2", + "read_length": 151, + "library_prep_id": "batch_1", + "provenance": { + "document_id": "f85b458b-b189-4ee7-939a-c905b70ae431", + "submission_date": "2019-09-20T08:29:52.239Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "sequence_file_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "19D015_NeuNT_I1.fastq.gz", + "format": "fastq.gz", + "content_description": [ + { + "text": "DNA sequence", + "ontology": "data:3494", + "ontology_label": "DNA sequence" + } + ] + }, + "read_index": "index1", + "read_length": 8, + "library_prep_id": "batch_1", + "provenance": { + "document_id": "18feeb7d-66ca-4ea4-a019-a10e5b762465", + "submission_date": "2019-09-20T08:29:52.247Z", + "update_date": "2019-09-20T08:50:13.111Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "supplementary_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "NeuN_enrichment_protocol.pdf", + "format": "pdf" + }, + "file_description": "Protocol for enrichment in NeuN+ Cells", + "provenance": { + "document_id": "2e64e936-85ec-49a0-8365-578b5621bcb1", + "submission_date": "2019-09-20T08:29:52.277Z", + "update_date": "2019-09-20T08:38:58.167Z", + "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", + "schema_major_version": 2, + "schema_minor_version": 2 + } + }, + "supplementary_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "Single_nuclei_dissociation_protocol.pdf", + "format": "pdf" + }, + "file_description": "Protocol to dissociate nuclei", + "provenance": { + "document_id": "720e6453-71ff-4742-ba6a-e5a3a5d3cee0", + "submission_date": "2019-09-20T08:29:52.285Z", + "update_date": "2019-09-20T08:38:58.165Z", + "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", + "schema_major_version": 2, + "schema_minor_version": 2 + } + }, + "supplementary_file_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "seq_protocol.pdf", + "format": "pdf" + }, + "file_description": "Protocol for sequencing", + "provenance": { + "document_id": "09917cf3-76de-4b85-8944-03664cd0d954", + "submission_date": "2019-09-20T08:29:52.292Z", + "update_date": "2019-09-20T08:38:58.165Z", + "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", + "schema_major_version": 2, + "schema_minor_version": 2 + } + }, + "supplementary_file_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "standard_10x_library_preparation.pdf", + "format": "pdf" + }, + "file_description": "Protocol for library preparation", + "provenance": { + "document_id": "8fb964a1-fd66-43b6-9d13-57db6bd185f2", + "submission_date": "2019-09-20T08:29:52.299Z", + "update_date": "2019-09-20T08:38:58.167Z", + "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", + "schema_major_version": 2, + "schema_minor_version": 2 + } + }, + "project_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/project/14.1.0/project", + "schema_type": "project", + "project_core": { + "project_short_name": "snRNA-seq_for_human_retina", + "project_title": "Transcriptomic classification of human retinal cell types with single-nuclei RNA-seq.", + "project_description": "The human neural retina is a heterogenous tissue that is an ordered array of approximately 70 different types of neurons, each playing a unique role in processing the visual signal. Currently, the transcriptomic-level classification of human retinal cell types is still limited. Using single-nuclei RNA-seq, a comprehensive single-cell profiling study has been carried out for healthy human retina from four individual donors. With the transcriptomic profiles for a total of over 200K nuclei being generated, we aim at revealing the transcriptome profiles for most subtypes of the retinal cells. Comparison with previous published macaque and mice dataset indicates an overall good alignment among species. In addition, the gene expression profile that is unique to human has been discovered. Furthermore, over 200 genes associated with human retinal diseases are investigated in our dataset and are found to show both cell type and regional specificity. In summary, results from our study serves as not only a cell atlas reference but also the foundation for future studies of human retinal diseases." + }, + "contributors": [ + { + "name": "Qingnan,,Liang", + "email": "qingnan.liang@bcm.edu", + "phone": "(+1)7137983610", + "institution": "Baylor College of Medicine", + "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", + "address": "One Baylor Plaza, Houston, Texas, 77054", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Xuesen,,Cheng", + "email": "xuesen.cheng@bcm.edu", + "phone": "(+1)7137983654", + "institution": "Baylor College of Medicine", + "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", + "address": "One Baylor Plaza, Houston, Texas, 77054", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Yumei,,Li", + "email": "yumeil@bcm.edu", + "phone": "(+1)7137987565", + "institution": "Baylor College of Medicine", + "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", + "address": "One Baylor Plaza, Houston, Texas, 77054", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Leah,,Owen", + "email": "leah.owen@hsc.utah.edu", + "phone": "(+1)8015812352", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Denise,,Morgan", + "email": "denisej.jones@hsc.utah.edu", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Sangbae,,Kim", + "email": "sangbae.kim@bcm.edu", + "phone": "(+1)7137983348", + "institution": "Baylor College of Medicine", + "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", + "address": "One Baylor Plaza, Houston, Texas, 77054", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Albert,,Vitale", + "email": "Albert.Vitale@hsc.utah.edu", + "phone": "(+1)8015812352", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Ivana,,Kim", + "email": "Ivana_Kim@meei.harvard.edu", + "phone": "(+1)6175733367", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Akbar,,Shakoor", + "email": "akbar.shakoor@hsc.utah.edu", + "phone": "(+1)8015856701", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "experimental scientist", + "ontology": "EFO:0009741", + "ontology_label": "experimental scientist" + } + }, + { + "name": "Margaret,,DeAngelis", + "email": "margaret.deangelis@utah.edu", + "phone": "(+1)8015812352", + "institution": "University of Utah", + "laboratory": "Department of Ophthalmology and Visual Sciences", + "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", + "country": "USA", + "corresponding_contributor": false, + "project_role": { + "text": "principal investigator", + "ontology": "EFO:0009736", + "ontology_label": "principal investigator" + } + }, + { + "name": "Rui,,Chen", + "email": "ruichen@bcm.edu", + "phone": "(+1)7137985194", + "institution": "Baylor College of Medicine", + "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", + "address": "One Baylor Plaza, Houston, Texas, 77054", + "country": "USA", + "corresponding_contributor": true, + "project_role": { + "text": "principal investigator", + "ontology": "EFO:0009736", + "ontology_label": "principal investigator" + } + }, + { + "name": "Zinaida,A,Perova", + "email": "zina@ebi.ac.uk", + "phone": "(+44) 01223494121", + "institution": "EMBL-EBI", + "address": "Wellcome Trust Genome Center, Hinxton, CB10 1SD", + "country": "UK", + "corresponding_contributor": false, + "project_role": { + "text": "HCA data wrangler", + "ontology": "EFO:0009737", + "ontology_label": "data curator" + }, + "orcid_id": "0000-0001-9913-3249" + } + ], + "funders": [ + { + "grant_title": "Cell Atlas of the Neural Retina Seed Networks", + "grant_id": "CZF2019-002425", + "organization": "Chan Zuckerberg Foundation" + } + ], + "provenance": { + "document_id": "9c20a245-f2c0-43ae-82c9-2232ec6b594f", + "submission_date": "2019-09-20T08:29:51.843Z", + "update_date": "2019-09-20T08:29:55.163Z", + "schema_major_version": 14, + "schema_minor_version": 1 + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/6.2.0/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "standard_10x_library_preparation", + "protocol_name": "standard_10x_library_preparation", + "protocol_description": "This is a standard 10x genomics library preparation method", + "document": "standard_10x_library_preparation.pdf" + }, + "cell_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869", + "ontology_label": "polyA RNA" + }, + "nucleic_acid_source": "single nucleus", + "library_construction_method": { + "text": "10X 3' v3 sequencing", + "ontology": "EFO:0009922", + "ontology_label": "10x 3' v3 sequencing" + }, + "end_bias": "3 prime tag", + "primer": "poly-dT", + "strand": "unstranded", + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 16, + "barcode_length": 12 + }, + "library_preamplification_method": { + "text": "reverse transcription PCR", + "ontology": "OBI:0000552", + "ontology_label": "reverse transcription PCR" + }, + "cdna_library_amplification_method": { + "text": "PCR", + "ontology": "OBI:0000415", + "ontology_label": "PCR" + }, + "nominal_length": 150, + "provenance": { + "document_id": "6ce5a9c7-b4f7-41e5-a182-21e85627feee", + "submission_date": "2019-09-20T08:29:52.319Z", + "update_date": "2019-09-20T08:29:58.625Z", + "schema_major_version": 6, + "schema_minor_version": 2 + } + }, + "sequencing_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/10.1.0/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "seq_protocol", + "protocol_name": "seq_protocol", + "protocol_description": "a standard illumina sequencing protocol", + "document": "seq_protocol.pdf" + }, + "instrument_manufacturer_model": { + "text": "Illumina Novaseq 6000", + "ontology": "EFO:0008637", + "ontology_label": "Illumina NovaSeq 6000" + }, + "paired_end": false, + "method": { + "text": "tag based single cell RNA sequencing", + "ontology": "EFO:0008440", + "ontology_label": "tag based single cell RNA sequencing" + }, + "10x": { + "fastq_method": "Cellranger mkfastq", + "fastq_method_version": "Cell Ranger 3.0.2", + "pooled_channels": 4.0 + }, + "provenance": { + "document_id": "e01aa420-488b-4189-a8c8-98ada395ee91", + "submission_date": "2019-09-20T08:29:52.324Z", + "update_date": "2019-09-20T08:29:58.905Z", + "schema_major_version": 10, + "schema_minor_version": 1 + } + }, + "dissociation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/6.2.0/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Single-nuclei-dissociation-protocol", + "protocol_name": "Single-nuclei-dissociation-protocol", + "document": "Single_nuclei_dissociation_protocol.pdf" + }, + "method": { + "text": "sample dissociation", + "ontology": "EFO:0009091", + "ontology_label": "sample dissociation" + }, + "provenance": { + "document_id": "a3623f22-83e7-4207-b204-34041abb54e2", + "submission_date": "2019-09-20T08:29:52.309Z", + "update_date": "2019-09-20T08:29:58.448Z", + "schema_major_version": 6, + "schema_minor_version": 2 + } + }, + "enrichment_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/3.1.0/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "NeuN-enrichment-protocol", + "protocol_name": "NeuN-enrichment-protocol", + "protocol_description": "Enrichment of the NeuN positive nuclei in the peripheral retina. The purpose is to enrich amacrine cells and retinal ganglion cells.", + "document": "NeuN_enrichment_protocol.pdf" + }, + "method": { + "text": "antibody enrichment with FACS sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "NeuN+", + "provenance": { + "document_id": "76f64d5b-fa01-4efe-ad4a-097d70311581", + "submission_date": "2019-09-20T08:29:52.314Z", + "update_date": "2019-09-20T08:29:58.761Z", + "schema_major_version": 3, + "schema_minor_version": 1 + } + }, + "collection_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/9.2.0/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "Retina_collection_protocol", + "protocol_name": "Retina_collection_protocol", + "protocol_description": "This is a standard protocol including post-mortem phenotyping (to make sure the donor does not have an retinal disease) and dissection of the eye.", + "publication_doi": "10.1167/iovs.18-24254" + }, + "method": { + "text": "dissection", + "ontology": "EFO:0003856", + "ontology_label": "dissection" + }, + "provenance": { + "document_id": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2", + "submission_date": "2019-09-20T08:29:52.304Z", + "update_date": "2019-09-20T08:29:58.737Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "process_0.json": { + "start_time": "2019/08/28", + "process_core": { + "process_id": "lib_prep10" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", + "provenance": { + "document_id": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", + "submission_date": "2019-09-20T08:29:52.505Z", + "update_date": "2019-09-20T08:29:59.338Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_19" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", + "provenance": { + "document_id": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", + "submission_date": "2019-09-20T08:29:52.437Z", + "update_date": "2019-09-20T08:29:59.191Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_7" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", + "provenance": { + "document_id": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", + "submission_date": "2019-09-20T08:29:52.365Z", + "update_date": "2019-09-20T08:29:59.366Z", + "schema_major_version": 9, + "schema_minor_version": 2 + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.5/links", + "schema_type": "link_bundle", + "schema_version": "1.1.5", + "links": [ + { + "process": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", + "inputs": [ + "eb27c398-f017-4ef1-acc8-3f51af87fe17" + ], + "input_type": "biomaterial", + "outputs": [ + "12484c33-24ec-4293-8f96-4cb1a43a6479", + "f85b458b-b189-4ee7-939a-c905b70ae431", + "18feeb7d-66ca-4ea4-a019-a10e5b762465" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "6ce5a9c7-b4f7-41e5-a182-21e85627feee" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "e01aa420-488b-4189-a8c8-98ada395ee91" + } + ] + }, + { + "process": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", + "inputs": [ + "0a63e007-09d0-4330-989b-ca248f8b3c3c" + ], + "input_type": "biomaterial", + "outputs": [ + "eb27c398-f017-4ef1-acc8-3f51af87fe17" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "a3623f22-83e7-4207-b204-34041abb54e2" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "76f64d5b-fa01-4efe-ad4a-097d70311581" + } + ] + }, + { + "process": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", + "inputs": [ + "fa1bd656-7f7b-4288-84c6-d511232cfe95" + ], + "input_type": "biomaterial", + "outputs": [ + "0a63e007-09d0-4330-989b-ca248f8b3c3c" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2" + } + ] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/manifest.json b/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/manifest.json deleted file mode 100644 index 481850e65..000000000 --- a/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/manifest.json +++ /dev/null @@ -1,326 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "27d5df55", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "c2ae104c7e048e34f7e11c33d336ea76", - "sha1": "2d934a2d27629d3d0b1c146e9ebd8403f49f8bec", - "sha256": "2f9df9ebcdd0440e89070985d6d1868b5d9ab39b5ba6845afcb069f82e29e114", - "size": 1167, - "uuid": "eb27c398-f017-4ef1-acc8-3f51af87fe17", - "version": "2019-09-20T082959.187000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "5c140335", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "a0bf601a253a5f851b45b9236af45064", - "sha1": "434291f6cc51414b40d886e46c3778be45beaa25", - "sha256": "24d0c61756a18088e1fb337b868ab636eae6dc2a0c3c0ea7e64da2dee72b16d5", - "size": 1095, - "uuid": "0a63e007-09d0-4330-989b-ca248f8b3c3c", - "version": "2019-09-20T082955.265000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ec11426d", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "1c9ddd9f5a7b1e02e58b243561ec767a", - "sha1": "abf4c58394716263dffd188cf07555a5a73c948d", - "sha256": "83c0f4789214b4fd6419d8ee7d4c0ef7c3b46ce3df1dbc1856de85221316e182", - "size": 1762, - "uuid": "fa1bd656-7f7b-4288-84c6-d511232cfe95", - "version": "2019-09-20T082955.262000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5523b822", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "dd9a989d9708f2c409f2eeaf758a682c", - "sha1": "cf0fa61520f7d160c5772da8e7b54eda67c2dfa5", - "sha256": "bd07544040ea5435e48e590e8647acf428011fcf987ef8f407c2a3bea57ea010", - "size": 770, - "uuid": "12484c33-24ec-4293-8f96-4cb1a43a6479", - "version": "2019-09-20T101335.720000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "68f76fda", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "30ef56ceb478adcd8f2a2b51fdccd8cd", - "sha1": "4e2aeb77d253e7a85b73a7ca82d5dd3ae0c01a36", - "sha256": "65e0770ccb79a470304401311baed3a7247de80049fd776fdb6c491b9aca42d1", - "size": 771, - "uuid": "f85b458b-b189-4ee7-939a-c905b70ae431", - "version": "2019-09-20T100406.780000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a6941bf4", - "indexed": true, - "name": "sequence_file_2.json", - "s3_etag": "385e335a401d98060b8d2950b9356ad1", - "sha1": "ad40563e13450f6ac9fe5638a5c29bccbfdbcab2", - "sha256": "de0dd3f2711790d9bf2ab61b6409660a424e20c7e59610d3cd7c5d6b56e45ca7", - "size": 770, - "uuid": "18feeb7d-66ca-4ea4-a019-a10e5b762465", - "version": "2019-09-20T085013.111000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4269da20", - "indexed": true, - "name": "supplementary_file_0.json", - "s3_etag": "8e9cb0ab1486df5372f1aa2990ce5da5", - "sha1": "0093b1b2f18c2936ae1a4aa96ba97797bddb18d2", - "sha256": "4c805fb81b53e9f986ad9880e03ed361d1a61c3557dea154c7837151fca17294", - "size": 554, - "uuid": "2e64e936-85ec-49a0-8365-578b5621bcb1", - "version": "2019-09-20T083858.167000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "553a2b98", - "indexed": true, - "name": "supplementary_file_1.json", - "s3_etag": "62410fdf0c79371940f7f9ca2f5e96e5", - "sha1": "239127a04d5a7e15380b1e2b5165f407ef47cd1d", - "sha256": "4da49acced5a0dec44273236d1f8d3f33a75ee559b85ce7c59e8e614f3efe9ea", - "size": 556, - "uuid": "720e6453-71ff-4742-ba6a-e5a3a5d3cee0", - "version": "2019-09-20T083858.165000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ef1f212e", - "indexed": true, - "name": "supplementary_file_2.json", - "s3_etag": "28af52bb75f5e1f461abf53dfd6d97da", - "sha1": "fb14f93b5d5210370b7d1eda27f25324d1443d36", - "sha256": "ae0027df4ef2eafcce8de66882c88f100b28a5cd14d5bd0b2bcafca6813d8631", - "size": 527, - "uuid": "09917cf3-76de-4b85-8944-03664cd0d954", - "version": "2019-09-20T083858.165000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "418269cd", - "indexed": true, - "name": "supplementary_file_3.json", - "s3_etag": "749ef86309a7536393c144e8bb084dc5", - "sha1": "08a4f5e4d962a351e5b0d3e8feff5c58e5a0a202", - "sha256": "d68462f8d2a4884682f07d15337c8a1bbe20d556f82e27d6e73520846b1e10da", - "size": 556, - "uuid": "8fb964a1-fd66-43b6-9d13-57db6bd185f2", - "version": "2019-09-20T083858.167000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "993805d8", - "indexed": true, - "name": "project_0.json", - "s3_etag": "0e2ac7fd8c4314b99ebcc238f6438279", - "sha1": "f40ac161cceb808cfc9d1b59d05c157bd5104539", - "sha256": "f2f10063aa3580d3447fce1f05854f0a389987bb565b3b41d6730b6084c704e6", - "size": 9450, - "uuid": "9c20a245-f2c0-43ae-82c9-2232ec6b594f", - "version": "2019-09-20T082955.163000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "05938885", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "8170f907f8bf4e41d4e414f271203975", - "sha1": "1e8f848f6749206458f94242ce1f5b733b2caa85", - "sha256": "34a9158f4cfa419fd856cd081aaed7d5df3735e8d62459eef07ae664645079b8", - "size": 1751, - "uuid": "6ce5a9c7-b4f7-41e5-a182-21e85627feee", - "version": "2019-09-20T082958.625000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "807e47ff", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "86a3feb1fab676572a24dad257c57806", - "sha1": "6f9d6ed5c6dcc0c45bb82114417298793598eeec", - "sha256": "6bc9d2998d34d98867aff7efb5136df709f8f8589bca8d11e6288c996c5eb112", - "size": 1157, - "uuid": "e01aa420-488b-4189-a8c8-98ada395ee91", - "version": "2019-09-20T082958.905000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "7cf5db5c", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "379074d6d018be136a0f04a6a2225edc", - "sha1": "12f381c7b7aba53604acc8b43ec2ab24d098d477", - "sha256": "1778d7a31e2d214cd46879f95b91d5be0a4a118c339e2cfe0a4ec5388c523a55", - "size": 782, - "uuid": "a3623f22-83e7-4207-b204-34041abb54e2", - "version": "2019-09-20T082958.448000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "7aa6c098", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "28f770ae6c883b95fdd51d73f8779613", - "sha1": "57a39ecdcf603f23079027997447cc4245abdc24", - "sha256": "bad90547359f4c4042087d371d305d381fb473ce682797969da1ffc5da279887", - "size": 973, - "uuid": "76f64d5b-fa01-4efe-ad4a-097d70311581", - "version": "2019-09-20T082958.761000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "27c8384f", - "indexed": true, - "name": "collection_protocol_0.json", - "s3_etag": "6d9c738cdd08d0dc7a6c4c7bcc396146", - "sha1": "6c7bb54ccd242881736b313c6bdd1ef324efa975", - "sha256": "34df8edc132c77a64a4d371ce284d28f415bca77cc4db42925c6f32bddd05403", - "size": 915, - "uuid": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2", - "version": "2019-09-20T082958.737000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "347672b1", - "indexed": true, - "name": "process_0.json", - "s3_etag": "2cd6d99bc699352ac6323d52d06bacc6", - "sha1": "76b12b430baff64132c0da39c22755e759b393bc", - "sha256": "0f790f4f47685127eb71f0401061c13add6d406a2bfc946f637eee80ffc0b80e", - "size": 476, - "uuid": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", - "version": "2019-09-20T082959.338000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "67528748", - "indexed": true, - "name": "process_1.json", - "s3_etag": "b06f6b5b98fbf590e5cbdf8f4872c3a3", - "sha1": "27505dcd710973cbaa6edf7b293c7364f980f1bc", - "sha256": "53b504c283ef059354e481928416841c3166e4cdaa6009941d472dbda3cdb165", - "size": 447, - "uuid": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", - "version": "2019-09-20T082959.191000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "97a6eef6", - "indexed": true, - "name": "process_2.json", - "s3_etag": "31d84fdd3bd9ec3ef0cc09e738168270", - "sha1": "4df3d0c3cbd4a18b98fa091920318d459dc2253e", - "sha256": "105d79c7027b2b795cd67f96433d46a11ab718a4a3b67a36084678873d7afdae", - "size": 446, - "uuid": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", - "version": "2019-09-20T082959.366000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "afe1de7d", - "indexed": true, - "name": "links.json", - "s3_etag": "e00d35caa8374da25b82de4a4358611d", - "sha1": "769e482e1902871370aa269dc264379a7bdb64b9", - "sha256": "e237b747a7f00824d9e7fca8285500dcf26c335c31a7169b2b5a655f1145776b", - "size": 2322, - "uuid": "774029ec-ba28-49e6-ae47-6403f5a9555e", - "version": "2019-09-20T104007.387625Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "759039c3", - "indexed": false, - "name": "19D015_NeuNT_R1.fastq.gz", - "s3_etag": "ed76eee572ae35b0eff88a66d07e4109-769", - "sha1": "5b5562b854a46298f2459b471def0f6e02d51752", - "sha256": "ce7471e89d0432c46ba22a1421ec5e89282d051a1691824a912205d9a8f08092", - "size": 51558308013, - "uuid": "ea5eea99-d788-4762-8de5-32602316da79", - "version": "2019-09-20T104007.794231Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "9069c15e", - "indexed": false, - "name": "19D015_NeuNT_R2.fastq.gz", - "s3_etag": "a4224318fdcbe14d2445bb2accfee3e8-633", - "sha1": "78f248cc1a43c307e77476a1195ed887ab0329c7", - "sha256": "90a8b913b628cfcad5a02b8628b1dfd17a5964ba9f590107404ee42035a69b1e", - "size": 42457074211, - "uuid": "351cae9c-9695-4797-b455-526dd29117bb", - "version": "2019-09-20T104008.028755Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "80b75620", - "indexed": false, - "name": "19D015_NeuNT_I1.fastq.gz", - "s3_etag": "6a9109b858d853ad276e1049bd7f5738-59", - "sha1": "a889db5ca65a684e3c25ebfb94d950e7d5b25060", - "sha256": "b1ed22a4f76feb2459ff5f2b958a18ea443aae44d93556cfeac53417ae74f017", - "size": 3935041540, - "uuid": "b64d8e12-028a-46fd-a778-5a5a8e971289", - "version": "2019-09-20T104008.305993Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "82c6888c", - "indexed": false, - "name": "NeuN_enrichment_protocol.pdf", - "s3_etag": "07f40c8891e3ee6c8afcbefc5ae5666e", - "sha1": "cd7fc7a040f22d885e6dce51a88c2ab4d39c9208", - "sha256": "347151ff3cc9aba252ca2bbb48f0aaaea0164105f5cac88ce9fb438c2efd76c3", - "size": 74562, - "uuid": "8e71749b-d445-409a-bc53-ba359438df69", - "version": "2019-09-20T104008.555357Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "18cb622e", - "indexed": false, - "name": "Single_nuclei_dissociation_protocol.pdf", - "s3_etag": "65ff1ba0ab370718fea68ba8ecaa5f62", - "sha1": "2b8981a89132fbbad5270b3079b7ca1422613e8a", - "sha256": "c004a0458be630d278542be89de54184fd61166deb61316a434d22381cc9e7b8", - "size": 72083, - "uuid": "dfa8a3b3-192c-4867-8c52-f956a6ebab06", - "version": "2019-09-20T104008.746891Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "ced2f561", - "indexed": false, - "name": "seq_protocol.pdf", - "s3_etag": "c74d7e9b5d3fe25d13cfc0c2ccc2c6c5", - "sha1": "29496e4720dee72f475bce872be3cba5091bf61e", - "sha256": "20554cc86f4388dcd35cf5810bf0cd3039405dcb7f8e759ea08498c7603aca37", - "size": 2008495, - "uuid": "deb6c7db-8ed1-4c87-ab39-44c3499e8499", - "version": "2019-09-20T104008.919497Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "5ef01a45", - "indexed": false, - "name": "standard_10x_library_preparation.pdf", - "s3_etag": "769a1335f7a9e6ec65c6284120f4b609", - "sha1": "11fae8d7a1ad844e3244163fc943e085e4bf87c6", - "sha256": "ab21d955fb53246c78b9828a8d83707720768a752ba0731a5e2145bb3a48de14", - "size": 7910067, - "uuid": "58b2c404-62c7-46cc-912f-99a5731cd8e5", - "version": "2019-09-20T104009.214107Z" - } -] diff --git a/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/metadata.json b/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/metadata.json deleted file mode 100644 index 5d3ab627d..000000000 --- a/test/hca_metadata_api/cans/prod/86e7b58e-b9f0-4020-8b34-c61d6da02d44/2019-09-20T103932.395795Z/metadata.json +++ /dev/null @@ -1,744 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/13.3.0/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "19D015_NeuNT_nuclei", - "biomaterial_name": "19D015_NeuNT", - "biomaterial_description": "dissocitated nuclei of human retina (peripheral region), incubated with anti-NeuN antibody and FACS sorted (Nuclei with top 5% signal intensity)", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "selected_cell_types": [ - { - "text": "NeuN-positive-nuclei in peripheral retina", - "ontology": "CL:0000540", - "ontology_label": "neuron" - } - ], - "estimated_cell_count": 24600, - "provenance": { - "document_id": "eb27c398-f017-4ef1-acc8-3f51af87fe17", - "submission_date": "2019-09-20T08:29:51.970Z", - "update_date": "2019-09-20T08:29:59.187Z", - "schema_major_version": 13, - "schema_minor_version": 3 - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.4.0/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "19D015_per", - "biomaterial_name": "19D015_per", - "biomaterial_description": "retinal tissues from the donor body", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "eye", - "ontology": "UBERON:0000970", - "ontology_label": "eye" - }, - "organ_parts": [ - { - "text": "retina", - "ontology": "UBERON:0000966", - "ontology_label": "retina" - } - ], - "provenance": { - "document_id": "0a63e007-09d0-4330-989b-ca248f8b3c3c", - "submission_date": "2019-09-20T08:29:51.904Z", - "update_date": "2019-09-20T08:29:55.265Z", - "schema_major_version": 10, - "schema_minor_version": 4 - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/15.5.0/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "19D015", - "biomaterial_name": "Homo Sapiens", - "biomaterial_description": "postmortem human donor", - "ncbi_taxon_id": [ - 9606 - ] - }, - "human_specific": { - "ethnicity": [ - { - "text": "Caucasian", - "ontology": "HANCESTRO:0005", - "ontology_label": "European" - } - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "sex": "male", - "is_living": "no", - "organism_age": "73", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "development_stage": { - "text": "human adult", - "ontology": "HsapDv:0000087", - "ontology_label": "human adult stage" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "death": { - "cause_of_death": "heart failure", - "cold_perfused": false, - "hardy_scale": 2, - "organ_donation_death_type": "Donation after brainstem death (DBD)", - "normothermic_regional_perfusion": "no" - }, - "provenance": { - "document_id": "fa1bd656-7f7b-4288-84c6-d511232cfe95", - "submission_date": "2019-09-20T08:29:51.866Z", - "update_date": "2019-09-20T08:29:55.262Z", - "schema_major_version": 15, - "schema_minor_version": 5 - } - }, - "sequence_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "19D015_NeuNT_R1.fastq.gz", - "format": "fastq.gz", - "content_description": [ - { - "text": "DNA sequence", - "ontology": "data:3494", - "ontology_label": "DNA sequence" - } - ] - }, - "read_index": "read1", - "read_length": 26, - "library_prep_id": "batch_1", - "provenance": { - "document_id": "12484c33-24ec-4293-8f96-4cb1a43a6479", - "submission_date": "2019-09-20T08:29:52.232Z", - "update_date": "2019-09-20T10:13:35.720Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "sequence_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "19D015_NeuNT_R2.fastq.gz", - "format": "fastq.gz", - "content_description": [ - { - "text": "DNA sequence", - "ontology": "data:3494", - "ontology_label": "DNA sequence" - } - ] - }, - "read_index": "read2", - "read_length": 151, - "library_prep_id": "batch_1", - "provenance": { - "document_id": "f85b458b-b189-4ee7-939a-c905b70ae431", - "submission_date": "2019-09-20T08:29:52.239Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "sequence_file_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/9.2.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "19D015_NeuNT_I1.fastq.gz", - "format": "fastq.gz", - "content_description": [ - { - "text": "DNA sequence", - "ontology": "data:3494", - "ontology_label": "DNA sequence" - } - ] - }, - "read_index": "index1", - "read_length": 8, - "library_prep_id": "batch_1", - "provenance": { - "document_id": "18feeb7d-66ca-4ea4-a019-a10e5b762465", - "submission_date": "2019-09-20T08:29:52.247Z", - "update_date": "2019-09-20T08:50:13.111Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "supplementary_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "NeuN_enrichment_protocol.pdf", - "format": "pdf" - }, - "file_description": "Protocol for enrichment in NeuN+ Cells", - "provenance": { - "document_id": "2e64e936-85ec-49a0-8365-578b5621bcb1", - "submission_date": "2019-09-20T08:29:52.277Z", - "update_date": "2019-09-20T08:38:58.167Z", - "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", - "schema_major_version": 2, - "schema_minor_version": 2 - } - }, - "supplementary_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "Single_nuclei_dissociation_protocol.pdf", - "format": "pdf" - }, - "file_description": "Protocol to dissociate nuclei", - "provenance": { - "document_id": "720e6453-71ff-4742-ba6a-e5a3a5d3cee0", - "submission_date": "2019-09-20T08:29:52.285Z", - "update_date": "2019-09-20T08:38:58.165Z", - "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", - "schema_major_version": 2, - "schema_minor_version": 2 - } - }, - "supplementary_file_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "seq_protocol.pdf", - "format": "pdf" - }, - "file_description": "Protocol for sequencing", - "provenance": { - "document_id": "09917cf3-76de-4b85-8944-03664cd0d954", - "submission_date": "2019-09-20T08:29:52.292Z", - "update_date": "2019-09-20T08:38:58.165Z", - "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", - "schema_major_version": 2, - "schema_minor_version": 2 - } - }, - "supplementary_file_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.2.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "standard_10x_library_preparation.pdf", - "format": "pdf" - }, - "file_description": "Protocol for library preparation", - "provenance": { - "document_id": "8fb964a1-fd66-43b6-9d13-57db6bd185f2", - "submission_date": "2019-09-20T08:29:52.299Z", - "update_date": "2019-09-20T08:38:58.167Z", - "submitter_id": "67a720af-4482-4619-81d7-3693b2d3cc4c", - "schema_major_version": 2, - "schema_minor_version": 2 - } - }, - "project_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/project/14.1.0/project", - "schema_type": "project", - "project_core": { - "project_short_name": "snRNA-seq_for_human_retina", - "project_title": "Transcriptomic classification of human retinal cell types with single-nuclei RNA-seq.", - "project_description": "The human neural retina is a heterogenous tissue that is an ordered array of approximately 70 different types of neurons, each playing a unique role in processing the visual signal. Currently, the transcriptomic-level classification of human retinal cell types is still limited. Using single-nuclei RNA-seq, a comprehensive single-cell profiling study has been carried out for healthy human retina from four individual donors. With the transcriptomic profiles for a total of over 200K nuclei being generated, we aim at revealing the transcriptome profiles for most subtypes of the retinal cells. Comparison with previous published macaque and mice dataset indicates an overall good alignment among species. In addition, the gene expression profile that is unique to human has been discovered. Furthermore, over 200 genes associated with human retinal diseases are investigated in our dataset and are found to show both cell type and regional specificity. In summary, results from our study serves as not only a cell atlas reference but also the foundation for future studies of human retinal diseases." - }, - "contributors": [ - { - "name": "Qingnan,,Liang", - "email": "qingnan.liang@bcm.edu", - "phone": "(+1)7137983610", - "institution": "Baylor College of Medicine", - "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", - "address": "One Baylor Plaza, Houston, Texas, 77054", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Xuesen,,Cheng", - "email": "xuesen.cheng@bcm.edu", - "phone": "(+1)7137983654", - "institution": "Baylor College of Medicine", - "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", - "address": "One Baylor Plaza, Houston, Texas, 77054", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Yumei,,Li", - "email": "yumeil@bcm.edu", - "phone": "(+1)7137987565", - "institution": "Baylor College of Medicine", - "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", - "address": "One Baylor Plaza, Houston, Texas, 77054", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Leah,,Owen", - "email": "leah.owen@hsc.utah.edu", - "phone": "(+1)8015812352", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Denise,,Morgan", - "email": "denisej.jones@hsc.utah.edu", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Sangbae,,Kim", - "email": "sangbae.kim@bcm.edu", - "phone": "(+1)7137983348", - "institution": "Baylor College of Medicine", - "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", - "address": "One Baylor Plaza, Houston, Texas, 77054", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Albert,,Vitale", - "email": "Albert.Vitale@hsc.utah.edu", - "phone": "(+1)8015812352", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Ivana,,Kim", - "email": "Ivana_Kim@meei.harvard.edu", - "phone": "(+1)6175733367", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Akbar,,Shakoor", - "email": "akbar.shakoor@hsc.utah.edu", - "phone": "(+1)8015856701", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "experimental scientist", - "ontology": "EFO:0009741", - "ontology_label": "experimental scientist" - } - }, - { - "name": "Margaret,,DeAngelis", - "email": "margaret.deangelis@utah.edu", - "phone": "(+1)8015812352", - "institution": "University of Utah", - "laboratory": "Department of Ophthalmology and Visual Sciences", - "address": "65 Mario Capecchi Drive, Salt Lake City, Utah, 84132", - "country": "USA", - "corresponding_contributor": false, - "project_role": { - "text": "principal investigator", - "ontology": "EFO:0009736", - "ontology_label": "principal investigator" - } - }, - { - "name": "Rui,,Chen", - "email": "ruichen@bcm.edu", - "phone": "(+1)7137985194", - "institution": "Baylor College of Medicine", - "laboratory": "Human Genome Sequencing Center, Department of Molecular and Human Genetics,", - "address": "One Baylor Plaza, Houston, Texas, 77054", - "country": "USA", - "corresponding_contributor": true, - "project_role": { - "text": "principal investigator", - "ontology": "EFO:0009736", - "ontology_label": "principal investigator" - } - }, - { - "name": "Zinaida,A,Perova", - "email": "zina@ebi.ac.uk", - "phone": "(+44) 01223494121", - "institution": "EMBL-EBI", - "address": "Wellcome Trust Genome Center, Hinxton, CB10 1SD", - "country": "UK", - "corresponding_contributor": false, - "project_role": { - "text": "HCA data wrangler", - "ontology": "EFO:0009737", - "ontology_label": "data curator" - }, - "orcid_id": "0000-0001-9913-3249" - } - ], - "funders": [ - { - "grant_title": "Cell Atlas of the Neural Retina Seed Networks", - "grant_id": "CZF2019-002425", - "organization": "Chan Zuckerberg Foundation" - } - ], - "provenance": { - "document_id": "9c20a245-f2c0-43ae-82c9-2232ec6b594f", - "submission_date": "2019-09-20T08:29:51.843Z", - "update_date": "2019-09-20T08:29:55.163Z", - "schema_major_version": 14, - "schema_minor_version": 1 - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/6.2.0/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "standard_10x_library_preparation", - "protocol_name": "standard_10x_library_preparation", - "protocol_description": "This is a standard 10x genomics library preparation method", - "document": "standard_10x_library_preparation.pdf" - }, - "cell_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869", - "ontology_label": "polyA RNA" - }, - "nucleic_acid_source": "single nucleus", - "library_construction_method": { - "text": "10X 3' v3 sequencing", - "ontology": "EFO:0009922", - "ontology_label": "10x 3' v3 sequencing" - }, - "end_bias": "3 prime tag", - "primer": "poly-dT", - "strand": "unstranded", - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 16, - "barcode_length": 12 - }, - "library_preamplification_method": { - "text": "reverse transcription PCR", - "ontology": "OBI:0000552", - "ontology_label": "reverse transcription PCR" - }, - "cdna_library_amplification_method": { - "text": "PCR", - "ontology": "OBI:0000415", - "ontology_label": "PCR" - }, - "nominal_length": 150, - "provenance": { - "document_id": "6ce5a9c7-b4f7-41e5-a182-21e85627feee", - "submission_date": "2019-09-20T08:29:52.319Z", - "update_date": "2019-09-20T08:29:58.625Z", - "schema_major_version": 6, - "schema_minor_version": 2 - } - }, - "sequencing_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/10.1.0/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "seq_protocol", - "protocol_name": "seq_protocol", - "protocol_description": "a standard illumina sequencing protocol", - "document": "seq_protocol.pdf" - }, - "instrument_manufacturer_model": { - "text": "Illumina Novaseq 6000", - "ontology": "EFO:0008637", - "ontology_label": "Illumina NovaSeq 6000" - }, - "paired_end": false, - "method": { - "text": "tag based single cell RNA sequencing", - "ontology": "EFO:0008440", - "ontology_label": "tag based single cell RNA sequencing" - }, - "10x": { - "fastq_method": "Cellranger mkfastq", - "fastq_method_version": "Cell Ranger 3.0.2", - "pooled_channels": 4.0 - }, - "provenance": { - "document_id": "e01aa420-488b-4189-a8c8-98ada395ee91", - "submission_date": "2019-09-20T08:29:52.324Z", - "update_date": "2019-09-20T08:29:58.905Z", - "schema_major_version": 10, - "schema_minor_version": 1 - } - }, - "dissociation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/6.2.0/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Single-nuclei-dissociation-protocol", - "protocol_name": "Single-nuclei-dissociation-protocol", - "document": "Single_nuclei_dissociation_protocol.pdf" - }, - "method": { - "text": "sample dissociation", - "ontology": "EFO:0009091", - "ontology_label": "sample dissociation" - }, - "provenance": { - "document_id": "a3623f22-83e7-4207-b204-34041abb54e2", - "submission_date": "2019-09-20T08:29:52.309Z", - "update_date": "2019-09-20T08:29:58.448Z", - "schema_major_version": 6, - "schema_minor_version": 2 - } - }, - "enrichment_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/3.1.0/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "NeuN-enrichment-protocol", - "protocol_name": "NeuN-enrichment-protocol", - "protocol_description": "Enrichment of the NeuN positive nuclei in the peripheral retina. The purpose is to enrich amacrine cells and retinal ganglion cells.", - "document": "NeuN_enrichment_protocol.pdf" - }, - "method": { - "text": "antibody enrichment with FACS sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "NeuN+", - "provenance": { - "document_id": "76f64d5b-fa01-4efe-ad4a-097d70311581", - "submission_date": "2019-09-20T08:29:52.314Z", - "update_date": "2019-09-20T08:29:58.761Z", - "schema_major_version": 3, - "schema_minor_version": 1 - } - }, - "collection_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/9.2.0/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "Retina_collection_protocol", - "protocol_name": "Retina_collection_protocol", - "protocol_description": "This is a standard protocol including post-mortem phenotyping (to make sure the donor does not have an retinal disease) and dissection of the eye.", - "publication_doi": "10.1167/iovs.18-24254" - }, - "method": { - "text": "dissection", - "ontology": "EFO:0003856", - "ontology_label": "dissection" - }, - "provenance": { - "document_id": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2", - "submission_date": "2019-09-20T08:29:52.304Z", - "update_date": "2019-09-20T08:29:58.737Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "process_0.json": { - "start_time": "2019/08/28", - "process_core": { - "process_id": "lib_prep10" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", - "provenance": { - "document_id": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", - "submission_date": "2019-09-20T08:29:52.505Z", - "update_date": "2019-09-20T08:29:59.338Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_19" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", - "provenance": { - "document_id": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", - "submission_date": "2019-09-20T08:29:52.437Z", - "update_date": "2019-09-20T08:29:59.191Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_7" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.2.0/process", - "provenance": { - "document_id": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", - "submission_date": "2019-09-20T08:29:52.365Z", - "update_date": "2019-09-20T08:29:59.366Z", - "schema_major_version": 9, - "schema_minor_version": 2 - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.5/links", - "schema_type": "link_bundle", - "schema_version": "1.1.5", - "links": [ - { - "process": "a29d4d8a-e8bf-4e1a-aacc-eeea8f3b65d2", - "inputs": [ - "eb27c398-f017-4ef1-acc8-3f51af87fe17" - ], - "input_type": "biomaterial", - "outputs": [ - "12484c33-24ec-4293-8f96-4cb1a43a6479", - "f85b458b-b189-4ee7-939a-c905b70ae431", - "18feeb7d-66ca-4ea4-a019-a10e5b762465" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "6ce5a9c7-b4f7-41e5-a182-21e85627feee" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "e01aa420-488b-4189-a8c8-98ada395ee91" - } - ] - }, - { - "process": "b6e09f03-0ddc-44ff-8cc9-7caf9eb70f57", - "inputs": [ - "0a63e007-09d0-4330-989b-ca248f8b3c3c" - ], - "input_type": "biomaterial", - "outputs": [ - "eb27c398-f017-4ef1-acc8-3f51af87fe17" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "a3623f22-83e7-4207-b204-34041abb54e2" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "76f64d5b-fa01-4efe-ad4a-097d70311581" - } - ] - }, - { - "process": "b3cddf6f-65ee-4aa8-8682-60f00c55be73", - "inputs": [ - "fa1bd656-7f7b-4288-84c6-d511232cfe95" - ], - "input_type": "biomaterial", - "outputs": [ - "0a63e007-09d0-4330-989b-ca248f8b3c3c" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "9a46c161-fb6e-4a4f-8c8d-a91a3c7b99c2" - } - ] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-03-29T142048.835519Z.json b/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-03-29T142048.835519Z.json new file mode 100644 index 000000000..9f0938781 --- /dev/null +++ b/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953.2018-03-29T142048.835519Z.json @@ -0,0 +1,678 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "aa2dfbb1", + "indexed": true, + "name": "project.json", + "s3_etag": "066f4af443f5db0e1d893bcee16db0e6", + "sha1": "fe667c736c9cbc5b129905cc04609d3f5b9a8caa", + "sha256": "df3e4f52d63201bc1c9f47af0a6717187b3d4d8f82213bf87dcf79440e93cfec", + "size": 4798, + "uuid": "22713018-0a12-41a5-af52-aa1b3cde7ff6", + "version": "2018-03-29T142043.412028Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "85c42f70", + "indexed": true, + "name": "biomaterial.json", + "s3_etag": "88e04bfa58a3324416e2c6eb5e9c56e9", + "sha1": "22b88d82742915e8e17861fcd233c3a06ee2f7ec", + "sha256": "dfa9e7a4c41adfb0f82d3a3cab1507d7060148f07431cc7c061af029ce2ea6a3", + "size": 4173, + "uuid": "abe560e2-4137-407f-a712-43d738e150f8", + "version": "2018-03-29T142043.838438Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "f93b9d00", + "indexed": false, + "name": "22011_1#268_1.fastq.gz", + "s3_etag": "7d462983b8d41346d61513f9e03f8036-2", + "sha1": "beeb73e062974cd9f37fc09822fea4fec2ceb609", + "sha256": "ee09a5fc9ba7ce42f8ebef0904950f6cf017cff3b0e4882b7b35ce26e20158f7", + "size": 74420452, + "uuid": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", + "version": "2018-03-29T142044.370144Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "1b953a24", + "indexed": false, + "name": "22011_1#268_2.fastq.gz", + "s3_etag": "a9ec4ab980a8ef01ad111e667d2c50ae-2", + "sha1": "284b9be625b43327f353fd3d77b6aa5b4d32e69c", + "sha256": "124645d6130107c1368568b91a37f7ea08dc7eae57bcd9eb519ac8ddb328880d", + "size": 88782381, + "uuid": "aa662c76-d220-49f4-8316-f4af5820d60b", + "version": "2018-03-29T142045.025802Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "02db8e33", + "indexed": true, + "name": "file.json", + "s3_etag": "5db0f991abd24ce20d7f2584cac3dbf4", + "sha1": "ead8da55acf55d14f3205a5d1380f327d270f6d4", + "sha256": "5637f92e2b7d4fd1d141ecdfc2256ceb9f01530294b337ac6e78f2872d8e6ac3", + "size": 1376, + "uuid": "ee309cce-7151-4d07-b749-547877782222", + "version": "2018-03-29T142045.727350Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "ef33a4cd", + "indexed": true, + "name": "process.json", + "s3_etag": "08dffc6ec94e2db7883a794517fbaefb", + "sha1": "5cfebf086a4de37e5a13745cf1617ddc3fde4f02", + "sha256": "fed78a606dcfcd899ae30769b5ea943cbd5dedb08ed3f5af7465405704cb942c", + "size": 5135, + "uuid": "1bd6c9f6-3841-48b4-a201-e86c7e68d5bc", + "version": "2018-03-29T142046.201431Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "ce01b7a3", + "indexed": true, + "name": "protocol.json", + "s3_etag": "43344cd080486f596a4de622631d2d93", + "sha1": "b4407c8f8ddb3610f756d2d845b12612f2ea9835", + "sha256": "55a766a6a67c67dbfc021653d4a7e1b58e083dcff6f3d5c8e7fb122f8fd6926d", + "size": 3174, + "uuid": "7db5a820-e612-402c-aaf3-d2676e19d862", + "version": "2018-03-29T142047.303889Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "4e6ce5dd", + "indexed": true, + "name": "links.json", + "s3_etag": "14c01392fd55df2b2cdbd08994009e24", + "sha1": "6ab7fdb229d9f0971a05e781ef52cbcfbf680e00", + "sha256": "be6a5c420109f6208e2a663c7d9fdc66de6dac9b08180c4aa0993ada30754645", + "size": 5963, + "uuid": "8c45f35c-c070-4bf4-999a-1de1676ad598", + "version": "2018-03-29T142047.912393Z" + } + ], + "metadata": { + "project_0.json": { + "content": { + "describedBy": "https://schema.humancellatlas.org/type/project/5.1.0/project", + "project_core": { + "project_shortname": "Mouse Melanoma", + "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications.", + "project_title": "Melanoma infiltration of stromal and immune cells" + }, + "publications": [], + "contributors": [ + { + "country": "UK", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Sarah,A,Teichmann", + "email": "st9@sanger.ac.uk" + }, + { + "country": "UK", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Mirjana,,Efremova", + "email": "me5@sanger.ac.uk" + }, + { + "country": "UK", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Bidesh,,Mahata", + "email": "bm11@sanger.ac.uk" + }, + { + "country": "UK", + "institution": "University of Cambridge", + "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", + "laboratory": "MRC Cancer Unit", + "contact_name": "Jacqueline,D,Shields", + "email": "JS970@MRCCU.cam.ac.uk" + }, + { + "country": "UK", + "institution": "University of Cambridge", + "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", + "laboratory": "MRC Cancer Unit", + "contact_name": "Sarah,,Davidson", + "email": "SED49@MRCCU.cam.ac.uk" + }, + { + "country": "Germany", + "contact_name": "Angela,,Riedel", + "email": "a.riedel@dkfz-heidelberg.de", + "institution": "DKFZ German Cancer Research Center" + }, + { + "country": "UK", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Roser,,Veno-Tormo", + "email": "rv4@sanger.ac.uk" + }, + { + "country": "UK", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Jhuma,,Pramanik", + "email": "jp19@sanger.ac.uk" + }, + { + "country": "UK", + "institution": "EMBL-EBI", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "laboratory": "Sarah Teichmann", + "contact_name": "Gozde,,Kar", + "email": "gkar@ebi.ac.uk" + }, + { + "country": "Finland", + "contact_name": "Jani,,Huuhtanen", + "email": "jani.huuhtanen@helsinki.fi", + "institution": "University of Helsinki" + } + ], + "schema_type": "project" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:26.025Z", + "updateDate": "2018-03-28T14:27:32.460Z", + "document_id": "93f6a42f-1790-4af4-b5d1-8c436cb6feae" + }, + "describedBy": "https://schema.humancellatlas.org/bundle/5.1.0/project", + "schema_version": "5.1.0", + "schema_type": "project_bundle" + }, + "cell_suspension_0.json": { + "content": { + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "total_estimated_cells": 1, + "target_cell_type": [ + { + "text": "CD11b+ Macrophages/monocytes" + } + ], + "schema_type": "biomaterial", + "biomaterial_core": { + "has_input_biomaterial": "1139_T", + "ncbi_taxon_id": [ + 10090 + ], + "biomaterial_id": "22011_1#268" + }, + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/cell_suspension" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:00:05.544Z", + "updateDate": "2018-03-28T14:39:28.596Z", + "document_id": "603a818f-dbe7-466a-8241-58b9c1618846" + } + }, + "specimen_from_organism_1.json": { + "content": { + "biomaterial_core": { + "has_input_biomaterial": "1139", + "ncbi_taxon_id": [ + 10090 + ], + "biomaterial_id": "1139_T", + "supplementary_files": [ + "FACS_sorting_markers.pdf" + ], + "biomaterial_name": "Mouse_day11_T_rep5" + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/specimen_from_organism", + "organ": { + "text": "tumor" + }, + "schema_type": "biomaterial" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:31.072Z", + "updateDate": "2018-03-28T14:15:11.657Z", + "document_id": "4e41a067-dbb7-439f-b72f-80240ce858f6" + } + }, + "donor_organism_2.json": { + "content": { + "is_living": false, + "mus_musculus_specific": { + "strain": [ + { + "text": "C57BL/6" + } + ] + }, + "biological_sex": "female", + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090" + } + ], + "disease": [ + { + "text": "subcutaneous melanoma", + "ontology": "EFO:0000756" + } + ], + "organism_age": "6-12", + "schema_type": "biomaterial", + "biomaterial_core": { + "ncbi_taxon_id": [ + 10090 + ], + "biomaterial_id": "1139", + "biomaterial_name": "Mouse_day11_rep5" + }, + "organism_age_unit": { + "text": "week", + "ontology": "UO:0000034" + }, + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/donor_organism" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:58:05.518Z", + "updateDate": "2018-03-28T14:01:13.757Z", + "document_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410" + } + }, + "sequence_file_0.json": { + "content": { + "file_core": { + "file_name": "22011_1#268_1.fastq.gz", + "file_format": "fastq.gz" + }, + "lane_index": 1, + "read_index": "read1", + "describedBy": "https://schema.humancellatlas.org/type/file/5.1.0/sequence_file", + "schema_type": "file" + }, + "hca_ingest": { + "submissionDate": "2018-03-28T14:00:30.935Z", + "document_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1" + } + }, + "sequence_file_1.json": { + "content": { + "file_core": { + "file_name": "22011_1#268_2.fastq.gz", + "file_format": "fastq.gz" + }, + "lane_index": 1, + "read_index": "read2", + "describedBy": "https://schema.humancellatlas.org/type/file/5.1.0/sequence_file", + "schema_type": "file" + }, + "hca_ingest": { + "submissionDate": "2018-03-28T14:00:30.947Z", + "document_id": "aa662c76-d220-49f4-8316-f4af5820d60b" + } + }, + "dissociation_process_0.json": { + "content": { + "nucleic_acid_source": "single cell", + "process_core": { + "process_id": "TissueDissociationProcess", + "process_name": "Extracting cells from lymph nodes" + }, + "dissociation_method": "mechanical", + "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/dissociation_process", + "schema_type": "process" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:04:14.574Z", + "updateDate": "2018-03-28T14:13:28.361Z", + "document_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902" + } + }, + "process_1.json": { + "content": { + "process_core": { + "process_id": "sampling_process_6" + }, + "describedBy": "https://schema.humancellatlas.org/type/process/1.0.0/process", + "schema_type": "process" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:00:15.938Z", + "updateDate": "2018-03-28T14:51:13.100Z", + "document_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9" + } + }, + "enrichment_process_2.json": { + "content": { + "enrichment_method": "FACS", + "process_core": { + "process_id": "FACS2" + }, + "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/enrichment_process", + "markers": "CD45+ CD3e- B220- CD11c+", + "schema_type": "process" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:05:22.289Z", + "updateDate": "2018-03-28T14:29:50.280Z", + "document_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78" + } + }, + "enrichment_process_3.json": { + "content": { + "enrichment_method": "FACS", + "process_core": { + "process_id": "FACS3.7" + }, + "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/enrichment_process", + "markers": "CD45+ CD3e- B220- CD11b+", + "schema_type": "process" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:04:02.056Z", + "updateDate": "2018-03-28T14:32:20.272Z", + "document_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215" + } + }, + "library_preparation_process_4.json": { + "content": { + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "process_core": { + "process_id": "lib_prep_1", + "process_name": "Library preparation process" + }, + "umi_barcode": { + "barcode_offset": 0, + "barcode_length": 16, + "barcode_read": "Read 1" + }, + "library_construction_approach": "Smart-seq2", + "schema_type": "process", + "end_bias": "full length", + "primer": "poly-dT", + "describedBy": "https://schema.humancellatlas.org/type/process/sequencing/5.1.0/library_preparation_process", + "strand": "unstranded" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:05:43.803Z", + "updateDate": "2018-03-28T14:43:01.679Z", + "document_id": "687065f3-c70f-46c3-8452-a5eead33a1bf" + } + }, + "sequencing_process_5.json": { + "content": { + "paired_ends": true, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008567" + }, + "process_core": { + "process_id": "seq_264", + "process_name": "Sequencing process" + }, + "smartseq2": { + "well_name": "F02", + "plate_id": "575" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/sequencing/5.1.0/sequencing_process" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T14:03:27.156Z", + "updateDate": "2018-03-28T14:32:54.422Z", + "document_id": "2580dcf9-3f7d-4421-b962-ab860e10d072" + } + }, + "protocol_0.json": { + "content": { + "protocol_core": { + "protocol_name": "Extracting cells from lymph nodes", + "document": "TissueDissociationProtocol.pdf", + "protocol_id": "tissue_dissociation_protocol" + }, + "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", + "schema_type": "protocol" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:26.033Z", + "updateDate": "2018-03-28T14:14:33.716Z", + "document_id": "c9a1e203-bddc-45d3-87c4-6010be8e0127" + } + }, + "protocol_1.json": { + "content": { + "protocol_core": { + "protocol_name": "FACS sorting cells by surface markers", + "document": "FACSsortingProtocol.pdf", + "protocol_id": "FACS_sorting_protocol" + }, + "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", + "schema_type": "protocol" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:26.040Z", + "updateDate": "2018-03-28T14:45:43.500Z", + "document_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6" + } + }, + "protocol_2.json": { + "content": { + "protocol_core": { + "protocol_name": "Make/amplify cDNA for each cell", + "document": "SmartSeq2_RTPCR_protocol.pdf", + "protocol_id": "SmartSeq2_RTPCR_protocol" + }, + "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", + "protocol_type": { + "text": "Smart-seq2 protocol", + "ontology": "EFO:0008442" + }, + "schema_type": "protocol" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:26.044Z", + "updateDate": "2018-03-28T14:24:04.790Z", + "document_id": "52d79a89-4b49-4c1b-b857-5cc5da07f643" + } + }, + "protocol_3.json": { + "content": { + "protocol_core": { + "protocol_name": "Sequencing SmartSeq2 cells", + "protocol_id": "SmartSeq2_sequencing_protocol" + }, + "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", + "schema_type": "protocol" + }, + "hca_ingest": { + "accession": "", + "submissionDate": "2018-03-28T13:55:26.050Z", + "updateDate": "2018-03-28T14:30:39.321Z", + "document_id": "ca6096cf-13c1-4930-8308-6ab05865e2c9" + } + }, + "links.json": { + "links": [ + { + "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "source_type": "biomaterial", + "destination_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", + "destination_type": "dissociation_process" + }, + { + "source_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", + "source_type": "dissociation_process", + "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", + "destination_type": "biomaterial" + }, + { + "source_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", + "source_type": "dissociation_process", + "destination_id": "c9a1e203-bddc-45d3-87c4-6010be8e0127", + "destination_type": "protocol" + }, + { + "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "source_type": "process", + "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "destination_type": "biomaterial" + }, + { + "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", + "source_type": "biomaterial", + "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "destination_type": "process" + }, + { + "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "source_type": "biomaterial", + "destination_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", + "destination_type": "enrichment_process" + }, + { + "source_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", + "source_type": "enrichment_process", + "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", + "destination_type": "biomaterial" + }, + { + "source_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", + "source_type": "enrichment_process", + "destination_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6", + "destination_type": "protocol" + }, + { + "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "source_type": "process", + "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "destination_type": "biomaterial" + }, + { + "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", + "source_type": "biomaterial", + "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "destination_type": "process" + }, + { + "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "source_type": "biomaterial", + "destination_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", + "destination_type": "enrichment_process" + }, + { + "source_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", + "source_type": "enrichment_process", + "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", + "destination_type": "biomaterial" + }, + { + "source_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", + "source_type": "enrichment_process", + "destination_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6", + "destination_type": "protocol" + }, + { + "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "source_type": "process", + "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", + "destination_type": "biomaterial" + }, + { + "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", + "source_type": "biomaterial", + "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", + "destination_type": "process" + }, + { + "source_id": "603a818f-dbe7-466a-8241-58b9c1618846", + "source_type": "biomaterial", + "destination_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", + "destination_type": "library_preparation_process" + }, + { + "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", + "source_type": "library_preparation_process", + "destination_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", + "destination_type": "file" + }, + { + "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", + "source_type": "library_preparation_process", + "destination_id": "aa662c76-d220-49f4-8316-f4af5820d60b", + "destination_type": "file" + }, + { + "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", + "source_type": "library_preparation_process", + "destination_id": "52d79a89-4b49-4c1b-b857-5cc5da07f643", + "destination_type": "protocol" + }, + { + "source_id": "603a818f-dbe7-466a-8241-58b9c1618846", + "source_type": "biomaterial", + "destination_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", + "destination_type": "sequencing_process" + }, + { + "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", + "source_type": "sequencing_process", + "destination_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", + "destination_type": "file" + }, + { + "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", + "source_type": "sequencing_process", + "destination_id": "aa662c76-d220-49f4-8316-f4af5820d60b", + "destination_type": "file" + }, + { + "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", + "source_type": "sequencing_process", + "destination_id": "ca6096cf-13c1-4930-8308-6ab05865e2c9", + "destination_type": "protocol" + } + ], + "describedBy": "https://schema.humancellatlas.org/bundle/1.0.0/links", + "schema_version": "1.0.0", + "schema_type": "link_bundle" + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/manifest.json b/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/manifest.json deleted file mode 100644 index 445440e89..000000000 --- a/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/manifest.json +++ /dev/null @@ -1,98 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "aa2dfbb1", - "indexed": true, - "name": "project.json", - "s3_etag": "066f4af443f5db0e1d893bcee16db0e6", - "sha1": "fe667c736c9cbc5b129905cc04609d3f5b9a8caa", - "sha256": "df3e4f52d63201bc1c9f47af0a6717187b3d4d8f82213bf87dcf79440e93cfec", - "size": 4798, - "uuid": "22713018-0a12-41a5-af52-aa1b3cde7ff6", - "version": "2018-03-29T142043.412028Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "85c42f70", - "indexed": true, - "name": "biomaterial.json", - "s3_etag": "88e04bfa58a3324416e2c6eb5e9c56e9", - "sha1": "22b88d82742915e8e17861fcd233c3a06ee2f7ec", - "sha256": "dfa9e7a4c41adfb0f82d3a3cab1507d7060148f07431cc7c061af029ce2ea6a3", - "size": 4173, - "uuid": "abe560e2-4137-407f-a712-43d738e150f8", - "version": "2018-03-29T142043.838438Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "f93b9d00", - "indexed": false, - "name": "22011_1#268_1.fastq.gz", - "s3_etag": "7d462983b8d41346d61513f9e03f8036-2", - "sha1": "beeb73e062974cd9f37fc09822fea4fec2ceb609", - "sha256": "ee09a5fc9ba7ce42f8ebef0904950f6cf017cff3b0e4882b7b35ce26e20158f7", - "size": 74420452, - "uuid": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", - "version": "2018-03-29T142044.370144Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "1b953a24", - "indexed": false, - "name": "22011_1#268_2.fastq.gz", - "s3_etag": "a9ec4ab980a8ef01ad111e667d2c50ae-2", - "sha1": "284b9be625b43327f353fd3d77b6aa5b4d32e69c", - "sha256": "124645d6130107c1368568b91a37f7ea08dc7eae57bcd9eb519ac8ddb328880d", - "size": 88782381, - "uuid": "aa662c76-d220-49f4-8316-f4af5820d60b", - "version": "2018-03-29T142045.025802Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "02db8e33", - "indexed": true, - "name": "file.json", - "s3_etag": "5db0f991abd24ce20d7f2584cac3dbf4", - "sha1": "ead8da55acf55d14f3205a5d1380f327d270f6d4", - "sha256": "5637f92e2b7d4fd1d141ecdfc2256ceb9f01530294b337ac6e78f2872d8e6ac3", - "size": 1376, - "uuid": "ee309cce-7151-4d07-b749-547877782222", - "version": "2018-03-29T142045.727350Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "ef33a4cd", - "indexed": true, - "name": "process.json", - "s3_etag": "08dffc6ec94e2db7883a794517fbaefb", - "sha1": "5cfebf086a4de37e5a13745cf1617ddc3fde4f02", - "sha256": "fed78a606dcfcd899ae30769b5ea943cbd5dedb08ed3f5af7465405704cb942c", - "size": 5135, - "uuid": "1bd6c9f6-3841-48b4-a201-e86c7e68d5bc", - "version": "2018-03-29T142046.201431Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "ce01b7a3", - "indexed": true, - "name": "protocol.json", - "s3_etag": "43344cd080486f596a4de622631d2d93", - "sha1": "b4407c8f8ddb3610f756d2d845b12612f2ea9835", - "sha256": "55a766a6a67c67dbfc021653d4a7e1b58e083dcff6f3d5c8e7fb122f8fd6926d", - "size": 3174, - "uuid": "7db5a820-e612-402c-aaf3-d2676e19d862", - "version": "2018-03-29T142047.303889Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "4e6ce5dd", - "indexed": true, - "name": "links.json", - "s3_etag": "14c01392fd55df2b2cdbd08994009e24", - "sha1": "6ab7fdb229d9f0971a05e781ef52cbcfbf680e00", - "sha256": "be6a5c420109f6208e2a663c7d9fdc66de6dac9b08180c4aa0993ada30754645", - "size": 5963, - "uuid": "8c45f35c-c070-4bf4-999a-1de1676ad598", - "version": "2018-03-29T142047.912393Z" - } -] diff --git a/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/metadata.json b/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/metadata.json deleted file mode 100644 index 49a0fdfdd..000000000 --- a/test/hca_metadata_api/cans/prod/b2216048-7eaa-45f4-8077-5a3fb4204953/2018-03-29T142048.835519Z/metadata.json +++ /dev/null @@ -1,578 +0,0 @@ -{ - "project_0.json": { - "content": { - "describedBy": "https://schema.humancellatlas.org/type/project/5.1.0/project", - "project_core": { - "project_shortname": "Mouse Melanoma", - "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications.", - "project_title": "Melanoma infiltration of stromal and immune cells" - }, - "publications": [], - "contributors": [ - { - "country": "UK", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Sarah,A,Teichmann", - "email": "st9@sanger.ac.uk" - }, - { - "country": "UK", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Mirjana,,Efremova", - "email": "me5@sanger.ac.uk" - }, - { - "country": "UK", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Bidesh,,Mahata", - "email": "bm11@sanger.ac.uk" - }, - { - "country": "UK", - "institution": "University of Cambridge", - "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", - "laboratory": "MRC Cancer Unit", - "contact_name": "Jacqueline,D,Shields", - "email": "JS970@MRCCU.cam.ac.uk" - }, - { - "country": "UK", - "institution": "University of Cambridge", - "address": "Box 197, Cambridge Biomedical Campus, Cambridge, CB2 0XZ", - "laboratory": "MRC Cancer Unit", - "contact_name": "Sarah,,Davidson", - "email": "SED49@MRCCU.cam.ac.uk" - }, - { - "country": "Germany", - "contact_name": "Angela,,Riedel", - "email": "a.riedel@dkfz-heidelberg.de", - "institution": "DKFZ German Cancer Research Center" - }, - { - "country": "UK", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Roser,,Veno-Tormo", - "email": "rv4@sanger.ac.uk" - }, - { - "country": "UK", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Jhuma,,Pramanik", - "email": "jp19@sanger.ac.uk" - }, - { - "country": "UK", - "institution": "EMBL-EBI", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "laboratory": "Sarah Teichmann", - "contact_name": "Gozde,,Kar", - "email": "gkar@ebi.ac.uk" - }, - { - "country": "Finland", - "contact_name": "Jani,,Huuhtanen", - "email": "jani.huuhtanen@helsinki.fi", - "institution": "University of Helsinki" - } - ], - "schema_type": "project" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:26.025Z", - "updateDate": "2018-03-28T14:27:32.460Z", - "document_id": "93f6a42f-1790-4af4-b5d1-8c436cb6feae" - }, - "describedBy": "https://schema.humancellatlas.org/bundle/5.1.0/project", - "schema_version": "5.1.0", - "schema_type": "project_bundle" - }, - "cell_suspension_0.json": { - "content": { - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "total_estimated_cells": 1, - "target_cell_type": [ - { - "text": "CD11b+ Macrophages/monocytes" - } - ], - "schema_type": "biomaterial", - "biomaterial_core": { - "has_input_biomaterial": "1139_T", - "ncbi_taxon_id": [ - 10090 - ], - "biomaterial_id": "22011_1#268" - }, - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/cell_suspension" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:00:05.544Z", - "updateDate": "2018-03-28T14:39:28.596Z", - "document_id": "603a818f-dbe7-466a-8241-58b9c1618846" - } - }, - "specimen_from_organism_1.json": { - "content": { - "biomaterial_core": { - "has_input_biomaterial": "1139", - "ncbi_taxon_id": [ - 10090 - ], - "biomaterial_id": "1139_T", - "supplementary_files": [ - "FACS_sorting_markers.pdf" - ], - "biomaterial_name": "Mouse_day11_T_rep5" - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/specimen_from_organism", - "organ": { - "text": "tumor" - }, - "schema_type": "biomaterial" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:31.072Z", - "updateDate": "2018-03-28T14:15:11.657Z", - "document_id": "4e41a067-dbb7-439f-b72f-80240ce858f6" - } - }, - "donor_organism_2.json": { - "content": { - "is_living": false, - "mus_musculus_specific": { - "strain": [ - { - "text": "C57BL/6" - } - ] - }, - "biological_sex": "female", - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090" - } - ], - "disease": [ - { - "text": "subcutaneous melanoma", - "ontology": "EFO:0000756" - } - ], - "organism_age": "6-12", - "schema_type": "biomaterial", - "biomaterial_core": { - "ncbi_taxon_id": [ - 10090 - ], - "biomaterial_id": "1139", - "biomaterial_name": "Mouse_day11_rep5" - }, - "organism_age_unit": { - "text": "week", - "ontology": "UO:0000034" - }, - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/5.1.0/donor_organism" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:58:05.518Z", - "updateDate": "2018-03-28T14:01:13.757Z", - "document_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410" - } - }, - "sequence_file_0.json": { - "content": { - "file_core": { - "file_name": "22011_1#268_1.fastq.gz", - "file_format": "fastq.gz" - }, - "lane_index": 1, - "read_index": "read1", - "describedBy": "https://schema.humancellatlas.org/type/file/5.1.0/sequence_file", - "schema_type": "file" - }, - "hca_ingest": { - "submissionDate": "2018-03-28T14:00:30.935Z", - "document_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1" - } - }, - "sequence_file_1.json": { - "content": { - "file_core": { - "file_name": "22011_1#268_2.fastq.gz", - "file_format": "fastq.gz" - }, - "lane_index": 1, - "read_index": "read2", - "describedBy": "https://schema.humancellatlas.org/type/file/5.1.0/sequence_file", - "schema_type": "file" - }, - "hca_ingest": { - "submissionDate": "2018-03-28T14:00:30.947Z", - "document_id": "aa662c76-d220-49f4-8316-f4af5820d60b" - } - }, - "dissociation_process_0.json": { - "content": { - "nucleic_acid_source": "single cell", - "process_core": { - "process_id": "TissueDissociationProcess", - "process_name": "Extracting cells from lymph nodes" - }, - "dissociation_method": "mechanical", - "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/dissociation_process", - "schema_type": "process" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:04:14.574Z", - "updateDate": "2018-03-28T14:13:28.361Z", - "document_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902" - } - }, - "process_1.json": { - "content": { - "process_core": { - "process_id": "sampling_process_6" - }, - "describedBy": "https://schema.humancellatlas.org/type/process/1.0.0/process", - "schema_type": "process" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:00:15.938Z", - "updateDate": "2018-03-28T14:51:13.100Z", - "document_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9" - } - }, - "enrichment_process_2.json": { - "content": { - "enrichment_method": "FACS", - "process_core": { - "process_id": "FACS2" - }, - "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/enrichment_process", - "markers": "CD45+ CD3e- B220- CD11c+", - "schema_type": "process" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:05:22.289Z", - "updateDate": "2018-03-28T14:29:50.280Z", - "document_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78" - } - }, - "enrichment_process_3.json": { - "content": { - "enrichment_method": "FACS", - "process_core": { - "process_id": "FACS3.7" - }, - "describedBy": "https://schema.humancellatlas.org/type/process/biomaterial_collection/5.1.0/enrichment_process", - "markers": "CD45+ CD3e- B220- CD11b+", - "schema_type": "process" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:04:02.056Z", - "updateDate": "2018-03-28T14:32:20.272Z", - "document_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215" - } - }, - "library_preparation_process_4.json": { - "content": { - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "process_core": { - "process_id": "lib_prep_1", - "process_name": "Library preparation process" - }, - "umi_barcode": { - "barcode_offset": 0, - "barcode_length": 16, - "barcode_read": "Read 1" - }, - "library_construction_approach": "Smart-seq2", - "schema_type": "process", - "end_bias": "full length", - "primer": "poly-dT", - "describedBy": "https://schema.humancellatlas.org/type/process/sequencing/5.1.0/library_preparation_process", - "strand": "unstranded" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:05:43.803Z", - "updateDate": "2018-03-28T14:43:01.679Z", - "document_id": "687065f3-c70f-46c3-8452-a5eead33a1bf" - } - }, - "sequencing_process_5.json": { - "content": { - "paired_ends": true, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008567" - }, - "process_core": { - "process_id": "seq_264", - "process_name": "Sequencing process" - }, - "smartseq2": { - "well_name": "F02", - "plate_id": "575" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/sequencing/5.1.0/sequencing_process" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T14:03:27.156Z", - "updateDate": "2018-03-28T14:32:54.422Z", - "document_id": "2580dcf9-3f7d-4421-b962-ab860e10d072" - } - }, - "protocol_0.json": { - "content": { - "protocol_core": { - "protocol_name": "Extracting cells from lymph nodes", - "document": "TissueDissociationProtocol.pdf", - "protocol_id": "tissue_dissociation_protocol" - }, - "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", - "schema_type": "protocol" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:26.033Z", - "updateDate": "2018-03-28T14:14:33.716Z", - "document_id": "c9a1e203-bddc-45d3-87c4-6010be8e0127" - } - }, - "protocol_1.json": { - "content": { - "protocol_core": { - "protocol_name": "FACS sorting cells by surface markers", - "document": "FACSsortingProtocol.pdf", - "protocol_id": "FACS_sorting_protocol" - }, - "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", - "schema_type": "protocol" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:26.040Z", - "updateDate": "2018-03-28T14:45:43.500Z", - "document_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6" - } - }, - "protocol_2.json": { - "content": { - "protocol_core": { - "protocol_name": "Make/amplify cDNA for each cell", - "document": "SmartSeq2_RTPCR_protocol.pdf", - "protocol_id": "SmartSeq2_RTPCR_protocol" - }, - "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", - "protocol_type": { - "text": "Smart-seq2 protocol", - "ontology": "EFO:0008442" - }, - "schema_type": "protocol" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:26.044Z", - "updateDate": "2018-03-28T14:24:04.790Z", - "document_id": "52d79a89-4b49-4c1b-b857-5cc5da07f643" - } - }, - "protocol_3.json": { - "content": { - "protocol_core": { - "protocol_name": "Sequencing SmartSeq2 cells", - "protocol_id": "SmartSeq2_sequencing_protocol" - }, - "describedBy": "https://schema.humancellatlas.org/type/protocol/5.1.0/protocol", - "schema_type": "protocol" - }, - "hca_ingest": { - "accession": "", - "submissionDate": "2018-03-28T13:55:26.050Z", - "updateDate": "2018-03-28T14:30:39.321Z", - "document_id": "ca6096cf-13c1-4930-8308-6ab05865e2c9" - } - }, - "links.json": { - "links": [ - { - "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "source_type": "biomaterial", - "destination_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", - "destination_type": "dissociation_process" - }, - { - "source_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", - "source_type": "dissociation_process", - "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", - "destination_type": "biomaterial" - }, - { - "source_id": "b7bbb2dc-3131-47c3-bcb9-4b7e0eeed902", - "source_type": "dissociation_process", - "destination_id": "c9a1e203-bddc-45d3-87c4-6010be8e0127", - "destination_type": "protocol" - }, - { - "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "source_type": "process", - "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "destination_type": "biomaterial" - }, - { - "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", - "source_type": "biomaterial", - "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "destination_type": "process" - }, - { - "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "source_type": "biomaterial", - "destination_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", - "destination_type": "enrichment_process" - }, - { - "source_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", - "source_type": "enrichment_process", - "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", - "destination_type": "biomaterial" - }, - { - "source_id": "2f2fb366-249f-49e3-b47d-a0bb39d9bc78", - "source_type": "enrichment_process", - "destination_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6", - "destination_type": "protocol" - }, - { - "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "source_type": "process", - "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "destination_type": "biomaterial" - }, - { - "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", - "source_type": "biomaterial", - "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "destination_type": "process" - }, - { - "source_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "source_type": "biomaterial", - "destination_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", - "destination_type": "enrichment_process" - }, - { - "source_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", - "source_type": "enrichment_process", - "destination_id": "603a818f-dbe7-466a-8241-58b9c1618846", - "destination_type": "biomaterial" - }, - { - "source_id": "a192f0d7-8e8e-48ae-b80d-3cb18acb3215", - "source_type": "enrichment_process", - "destination_id": "a1c80daf-58b0-4b7a-8e29-d0130493c8e6", - "destination_type": "protocol" - }, - { - "source_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "source_type": "process", - "destination_id": "4e41a067-dbb7-439f-b72f-80240ce858f6", - "destination_type": "biomaterial" - }, - { - "source_id": "bf8492ad-1d45-46aa-9fe9-67058b8c2410", - "source_type": "biomaterial", - "destination_id": "f03590d8-4e65-478e-bc67-a8c64d2c93e9", - "destination_type": "process" - }, - { - "source_id": "603a818f-dbe7-466a-8241-58b9c1618846", - "source_type": "biomaterial", - "destination_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", - "destination_type": "library_preparation_process" - }, - { - "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", - "source_type": "library_preparation_process", - "destination_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", - "destination_type": "file" - }, - { - "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", - "source_type": "library_preparation_process", - "destination_id": "aa662c76-d220-49f4-8316-f4af5820d60b", - "destination_type": "file" - }, - { - "source_id": "687065f3-c70f-46c3-8452-a5eead33a1bf", - "source_type": "library_preparation_process", - "destination_id": "52d79a89-4b49-4c1b-b857-5cc5da07f643", - "destination_type": "protocol" - }, - { - "source_id": "603a818f-dbe7-466a-8241-58b9c1618846", - "source_type": "biomaterial", - "destination_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", - "destination_type": "sequencing_process" - }, - { - "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", - "source_type": "sequencing_process", - "destination_id": "d2f32681-9c1a-4dfd-b506-c24327afb8d1", - "destination_type": "file" - }, - { - "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", - "source_type": "sequencing_process", - "destination_id": "aa662c76-d220-49f4-8316-f4af5820d60b", - "destination_type": "file" - }, - { - "source_id": "2580dcf9-3f7d-4421-b962-ab860e10d072", - "source_type": "sequencing_process", - "destination_id": "ca6096cf-13c1-4930-8308-6ab05865e2c9", - "destination_type": "protocol" - } - ], - "describedBy": "https://schema.humancellatlas.org/bundle/1.0.0/links", - "schema_version": "1.0.0", - "schema_type": "link_bundle" - } -} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439.2019-05-15T222432.561000Z.json b/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439.2019-05-15T222432.561000Z.json new file mode 100644 index 000000000..c50b63a0f --- /dev/null +++ b/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439.2019-05-15T222432.561000Z.json @@ -0,0 +1,425 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "0300a92e", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "4f3859e7778d1818bcf4120b76a1ffa6", + "sha1": "505038762f830ae810e7a63eea87ca72fc90196b", + "sha256": "4909898b1cbaea063ba589b146f7457c56928a6864546b4a465cde3d1b1d67f3", + "size": 850, + "uuid": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019", + "version": "2019-05-14T120006.941000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "7158fd43", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "676e573bec1eb8fe9d7b9888ece979e7", + "sha1": "04c71e27a86ea91ee260df9feab594517cf9c5cd", + "sha256": "37eb5a18c9be2be0c452aecbf2d7cf50ec9af68e0379f6647c7aedf5372b9833", + "size": 812, + "uuid": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf", + "version": "2019-05-14T114647.512000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "833cd7f3", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "15380716b8a9c7a78f33a6051a1a477d", + "sha1": "657c0e467fb61ee80819f31f86369c2227220307", + "sha256": "33e5ecaf9d039b5a41718eb2e38a0d66d15a701eaca7fdbebc9f2b5f46561ee1", + "size": 1749, + "uuid": "63818269-c4d9-429b-85a3-db39c0dd7fa0", + "version": "2019-05-14T112950.173000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "02c57821", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "608e74f1bf465c2d5e4951fab48b349b", + "sha1": "b885e81fd0ce11e170176535536a45299e1eed3a", + "sha256": "e497c5c87514a04bf398d95c60884bfdf10bc084c75d413ff2d308cb22326b94", + "size": 459, + "uuid": "61fd5348-92c5-446b-a57a-746330cebf76", + "version": "2019-05-14T112117.762000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "61502b5b", + "indexed": true, + "name": "supplementary_file_0.json", + "s3_etag": "b9789082b025294c44dce46ddd22b7aa", + "sha1": "daa76ae1d2af21871d8180006b066f56cdf7594f", + "sha256": "069391131baa61584a57a5fd9ec9633b6224722c783faf269db28d76d6133c79", + "size": 481, + "uuid": "e738a267-87fc-4070-abc7-b3be6442c6d0", + "version": "2019-05-14T110115.816000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "030e888d", + "indexed": true, + "name": "supplementary_file_1.json", + "s3_etag": "0dc591fd5db04fbb770de26ae5419037", + "sha1": "48b75f01afaee3ca9f04510725c4c3b0c536f8b0", + "sha256": "2a3940369dacfea767cc02b29b637d94f46fdffde6bc1b08c238f8b2850471de", + "size": 477, + "uuid": "01a1d04b-05d0-4904-b627-68b0dc02bc17", + "version": "2019-05-14T110109.564000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "ef3ef012", + "indexed": true, + "name": "project_0.json", + "s3_etag": "308189c7eab62a35a894125efbe76558", + "sha1": "9da3dba1ec159439071d6390a25ab9110be95f86", + "sha256": "2e2f330270644222106b2a8f648733cbd7609c283e29f1ee07363be32c223a9b", + "size": 8464, + "uuid": "8c3c290d-dfff-4553-8868-54ce45f4ba7f", + "version": "2019-05-14T112051.382000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "57699965", + "indexed": true, + "name": "process_0.json", + "s3_etag": "fdc514845934d034918521bb96f1ee24", + "sha1": "ba3c05024bdd18dd054ef07cbd2c6594fe64e168", + "sha256": "2ff1fab2dac6ac35b866a437f7bd720066212998432ab8eb05f6039b748c5225", + "size": 379, + "uuid": "91f475ec-be51-4f1e-a904-74b10b7259f1", + "version": "2019-05-14T121053.274000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "ad459007", + "indexed": true, + "name": "process_1.json", + "s3_etag": "b067d9b22cf3d999069bdc42a56fabbe", + "sha1": "23ed66f1f47ecb29cf5354d6fb675784804df817", + "sha256": "a3948a06685954b8f5d21113621e53cea384aea12aa07d9bb19796ccf4e7300d", + "size": 378, + "uuid": "e521d67d-c134-4dbd-9555-29e23f0463c5", + "version": "2019-05-14T122720.135000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "4352f3bf", + "indexed": true, + "name": "process_2.json", + "s3_etag": "f94d4ee8d194714e8db01f7f1d9ad66e", + "sha1": "db413a2532ec0d9d235aa56fd69ba27fc96bc70d", + "sha256": "cf1d4be9c9a62590b38014d092b67a981ec516013af924d30870a18cd6a060ed", + "size": 377, + "uuid": "453a352c-94fb-4d3b-b609-df1e7abf8c09", + "version": "2019-05-14T122652.545000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "2c25a3c2", + "indexed": true, + "name": "links.json", + "s3_etag": "1f7c2cbccc797da2d885bb52de52232d", + "sha1": "39ba144902ba5d1095af5b8d5dace8dd19a4b08d", + "sha256": "33052247612f39f6ea48568a12c761842af30030e1242943bb2c5eb238722488", + "size": 2083, + "uuid": "51168054-6dad-45aa-916a-ef71135651b2", + "version": "2019-05-16T015324.197421Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "86192092", + "indexed": false, + "name": "21784_6#51_1.fastq.gz", + "s3_etag": "8ef4064fd5c94502b0d42c0dbecc74ca", + "sha1": "0c0a36b8e8e8bf53db8e5eed5688546f0d23f863", + "sha256": "1975336c7071ac70caef3ff833089b0dc26962b4d6fc5159aece28eaa4324052", + "size": 7591723, + "uuid": "e4d9ebe5-2e62-47cf-bc35-1fb8ef7c1ef7", + "version": "2019-05-16T015324.490566Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "56a9e200", + "indexed": false, + "name": "21784_6#51_2.fastq.gz", + "s3_etag": "86b0f2604a0aa1dbe3bd72d316f077f3", + "sha1": "d138b7a22c6fd4834f03564921a6436ebed5076e", + "sha256": "6a95e7f0792fe70dfcf174ee585c6900f2ed5fb401c5c8d0d15bef5e95271726", + "size": 7553715, + "uuid": "60f17b79-74d9-49b5-a6da-48580a67f11f", + "version": "2019-05-16T015324.739985Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "847325b6", + "indexed": false, + "name": "TissueDissociationProtocol.pdf", + "s3_etag": "7e892bf8f6aa489ccb08a995c7f017e1", + "sha1": "f2237ad0a776fd7057eb3d3498114c85e2f521d7", + "sha256": "6929799f227ae5f0b3e0167a6cf2bd683db097848af6ccde6329185212598779", + "size": 32748, + "uuid": "6578c322-7060-4c82-8469-9e54100e6b44", + "version": "2019-05-16T015325.007527Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "b9364bfa", + "indexed": false, + "name": "SmartSeq2_RTPCR_protocol.pdf", + "s3_etag": "846fd9e6b98041df46a1ddb94e85b6b9", + "sha1": "89d9eb3f1b94f78a33d46c0288c2e81d4002049b", + "sha256": "2f6866c4ede92123f90dd15fb180fac56e33309b8fd3f4f52f263ed2f8af2f16", + "size": 29230, + "uuid": "cd8e02d1-d0f9-4094-9a31-329931df60dc", + "version": "2019-05-16T015325.251968Z" + }, + { + "content-type": "application/pdf; dcp-type=data", + "crc32c": "3658ec51", + "indexed": false, + "name": "SmartSeq2_sequencing_protocol.pdf", + "s3_etag": "2742e1e78f6d4663bf41d3080396695c", + "sha1": "9ec6ee2b6e2093681c1fed694b3a8c78a2aa3438", + "sha256": "9c93a354a8636c041a31ba6f3fb00ef20352e1b853d8080d63a654221cb35673", + "size": 61134, + "uuid": "bf92ef4a-c422-44fb-bfc1-c2f86528b86b", + "version": "2019-05-16T015325.498431Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/13.1.0/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "21784_6#51", + "ncbi_taxon_id": [ + 10090 + ] + }, + "provenance": { + "document_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019", + "submission_date": "2019-05-14T11:01:32.467Z", + "update_date": "2019-05-14T12:00:06.941Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.0/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1126_LN", + "ncbi_taxon_id": [ + 10090 + ] + }, + "organ": { + "text": "lymph node" + }, + "provenance": { + "document_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf", + "submission_date": "2019-05-14T11:01:26.115Z", + "update_date": "2019-05-14T11:46:47.512Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/15.3.0/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "1126", + "ncbi_taxon_id": [ + 10090 + ] + }, + "genus_species": [ + { + "text": "Mus musculus" + } + ], + "is_living": "no", + "sex": "female", + "development_stage": { + "text": "adult" + }, + "provenance": { + "document_id": "63818269-c4d9-429b-85a3-db39c0dd7fa0", + "submission_date": "2019-05-14T11:01:25.684Z", + "update_date": "2019-05-14T11:29:50.173Z" + } + }, + "sequence_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/9.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "21784_6#51_1.fastq.gz", + "format": "fastq.gz" + }, + "read_index": "read1", + "provenance": { + "document_id": "61fd5348-92c5-446b-a57a-746330cebf76", + "submission_date": "2019-05-14T10:52:59.245Z", + "update_date": "2019-05-14T11:21:17.762Z" + } + }, + "supplementary_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.0.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "TissueDissociationProtocol.pdf", + "format": "pdf" + }, + "provenance": { + "document_id": "e738a267-87fc-4070-abc7-b3be6442c6d0", + "submission_date": "2019-05-14T10:52:33.892Z", + "update_date": "2019-05-14T11:01:15.816Z" + } + }, + "supplementary_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/2.0.0/supplementary_file", + "schema_type": "file", + "file_core": { + "file_name": "SmartSeq2_RTPCR_protocol.pdf", + "format": "pdf" + }, + "provenance": { + "document_id": "01a1d04b-05d0-4904-b627-68b0dc02bc17", + "submission_date": "2019-05-14T10:52:33.898Z", + "update_date": "2019-05-14T11:01:09.564Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/project/14.0.0/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Mouse Melanoma", + "project_title": "Melanoma infiltration of stromal and immune cells", + "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications." + }, + "funders": [], + "provenance": { + "document_id": "8c3c290d-dfff-4553-8868-54ce45f4ba7f", + "submission_date": "2019-05-14T10:52:33.885Z", + "update_date": "2019-05-14T11:20:51.382Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "proc_21784_6#51" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", + "provenance": { + "document_id": "91f475ec-be51-4f1e-a904-74b10b7259f1", + "submission_date": "2019-05-14T11:06:54.971Z", + "update_date": "2019-05-14T12:10:53.274Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_366" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", + "provenance": { + "document_id": "e521d67d-c134-4dbd-9555-29e23f0463c5", + "submission_date": "2019-05-14T11:12:40.680Z", + "update_date": "2019-05-14T12:27:20.135Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_24" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", + "provenance": { + "document_id": "453a352c-94fb-4d3b-b609-df1e7abf8c09", + "submission_date": "2019-05-14T11:12:15.946Z", + "update_date": "2019-05-14T12:26:52.545Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/2.0.0/links", + "schema_type": "link_bundle", + "schema_version": "2.0.0", + "links": [ + { + "link_type": "process_link", + "process_id": "91f475ec-be51-4f1e-a904-74b10b7259f1", + "process_type": "process", + "inputs": [ + { + "input_type": "cell_suspension", + "input_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019" + } + ], + "outputs": [ + { + "output_type": "sequence_file", + "output_id": "61fd5348-92c5-446b-a57a-746330cebf76" + } + ], + "protocols": [] + }, + { + "link_type": "process_link", + "process_id": "e521d67d-c134-4dbd-9555-29e23f0463c5", + "process_type": "process", + "inputs": [ + { + "input_type": "specimen_from_organism", + "input_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf" + } + ], + "outputs": [ + { + "output_type": "cell_suspension", + "output_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019" + } + ], + "protocols": [] + }, + { + "link_type": "process_link", + "process_id": "453a352c-94fb-4d3b-b609-df1e7abf8c09", + "process_type": "process", + "inputs": [ + { + "input_type": "donor_organism", + "input_id": "63818269-c4d9-429b-85a3-db39c0dd7fa0" + } + ], + "outputs": [ + { + "output_type": "specimen_from_organism", + "output_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf" + } + ], + "protocols": [] + }, + { + "link_type": "supplementary_file_link", + "entity": { + "entity_type": "project", + "entity_id": "8c3c290d-dfff-4553-8868-54ce45f4ba7f" + }, + "files": [ + { + "file_id": "e738a267-87fc-4070-abc7-b3be6442c6d0", + "file_type": "supplementary_file" + }, + { + "file_id": "01a1d04b-05d0-4904-b627-68b0dc02bc17", + "file_type": "supplementary_file" + } + ] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/manifest.json b/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/manifest.json deleted file mode 100644 index 41ef55acc..000000000 --- a/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/manifest.json +++ /dev/null @@ -1,194 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "0300a92e", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "4f3859e7778d1818bcf4120b76a1ffa6", - "sha1": "505038762f830ae810e7a63eea87ca72fc90196b", - "sha256": "4909898b1cbaea063ba589b146f7457c56928a6864546b4a465cde3d1b1d67f3", - "size": 850, - "uuid": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019", - "version": "2019-05-14T120006.941000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "7158fd43", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "676e573bec1eb8fe9d7b9888ece979e7", - "sha1": "04c71e27a86ea91ee260df9feab594517cf9c5cd", - "sha256": "37eb5a18c9be2be0c452aecbf2d7cf50ec9af68e0379f6647c7aedf5372b9833", - "size": 812, - "uuid": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf", - "version": "2019-05-14T114647.512000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "833cd7f3", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "15380716b8a9c7a78f33a6051a1a477d", - "sha1": "657c0e467fb61ee80819f31f86369c2227220307", - "sha256": "33e5ecaf9d039b5a41718eb2e38a0d66d15a701eaca7fdbebc9f2b5f46561ee1", - "size": 1749, - "uuid": "63818269-c4d9-429b-85a3-db39c0dd7fa0", - "version": "2019-05-14T112950.173000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "02c57821", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "608e74f1bf465c2d5e4951fab48b349b", - "sha1": "b885e81fd0ce11e170176535536a45299e1eed3a", - "sha256": "e497c5c87514a04bf398d95c60884bfdf10bc084c75d413ff2d308cb22326b94", - "size": 459, - "uuid": "61fd5348-92c5-446b-a57a-746330cebf76", - "version": "2019-05-14T112117.762000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "61502b5b", - "indexed": true, - "name": "supplementary_file_0.json", - "s3_etag": "b9789082b025294c44dce46ddd22b7aa", - "sha1": "daa76ae1d2af21871d8180006b066f56cdf7594f", - "sha256": "069391131baa61584a57a5fd9ec9633b6224722c783faf269db28d76d6133c79", - "size": 481, - "uuid": "e738a267-87fc-4070-abc7-b3be6442c6d0", - "version": "2019-05-14T110115.816000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "030e888d", - "indexed": true, - "name": "supplementary_file_1.json", - "s3_etag": "0dc591fd5db04fbb770de26ae5419037", - "sha1": "48b75f01afaee3ca9f04510725c4c3b0c536f8b0", - "sha256": "2a3940369dacfea767cc02b29b637d94f46fdffde6bc1b08c238f8b2850471de", - "size": 477, - "uuid": "01a1d04b-05d0-4904-b627-68b0dc02bc17", - "version": "2019-05-14T110109.564000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "ef3ef012", - "indexed": true, - "name": "project_0.json", - "s3_etag": "308189c7eab62a35a894125efbe76558", - "sha1": "9da3dba1ec159439071d6390a25ab9110be95f86", - "sha256": "2e2f330270644222106b2a8f648733cbd7609c283e29f1ee07363be32c223a9b", - "size": 8464, - "uuid": "8c3c290d-dfff-4553-8868-54ce45f4ba7f", - "version": "2019-05-14T112051.382000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "57699965", - "indexed": true, - "name": "process_0.json", - "s3_etag": "fdc514845934d034918521bb96f1ee24", - "sha1": "ba3c05024bdd18dd054ef07cbd2c6594fe64e168", - "sha256": "2ff1fab2dac6ac35b866a437f7bd720066212998432ab8eb05f6039b748c5225", - "size": 379, - "uuid": "91f475ec-be51-4f1e-a904-74b10b7259f1", - "version": "2019-05-14T121053.274000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "ad459007", - "indexed": true, - "name": "process_1.json", - "s3_etag": "b067d9b22cf3d999069bdc42a56fabbe", - "sha1": "23ed66f1f47ecb29cf5354d6fb675784804df817", - "sha256": "a3948a06685954b8f5d21113621e53cea384aea12aa07d9bb19796ccf4e7300d", - "size": 378, - "uuid": "e521d67d-c134-4dbd-9555-29e23f0463c5", - "version": "2019-05-14T122720.135000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "4352f3bf", - "indexed": true, - "name": "process_2.json", - "s3_etag": "f94d4ee8d194714e8db01f7f1d9ad66e", - "sha1": "db413a2532ec0d9d235aa56fd69ba27fc96bc70d", - "sha256": "cf1d4be9c9a62590b38014d092b67a981ec516013af924d30870a18cd6a060ed", - "size": 377, - "uuid": "453a352c-94fb-4d3b-b609-df1e7abf8c09", - "version": "2019-05-14T122652.545000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "2c25a3c2", - "indexed": true, - "name": "links.json", - "s3_etag": "1f7c2cbccc797da2d885bb52de52232d", - "sha1": "39ba144902ba5d1095af5b8d5dace8dd19a4b08d", - "sha256": "33052247612f39f6ea48568a12c761842af30030e1242943bb2c5eb238722488", - "size": 2083, - "uuid": "51168054-6dad-45aa-916a-ef71135651b2", - "version": "2019-05-16T015324.197421Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "86192092", - "indexed": false, - "name": "21784_6#51_1.fastq.gz", - "s3_etag": "8ef4064fd5c94502b0d42c0dbecc74ca", - "sha1": "0c0a36b8e8e8bf53db8e5eed5688546f0d23f863", - "sha256": "1975336c7071ac70caef3ff833089b0dc26962b4d6fc5159aece28eaa4324052", - "size": 7591723, - "uuid": "e4d9ebe5-2e62-47cf-bc35-1fb8ef7c1ef7", - "version": "2019-05-16T015324.490566Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "56a9e200", - "indexed": false, - "name": "21784_6#51_2.fastq.gz", - "s3_etag": "86b0f2604a0aa1dbe3bd72d316f077f3", - "sha1": "d138b7a22c6fd4834f03564921a6436ebed5076e", - "sha256": "6a95e7f0792fe70dfcf174ee585c6900f2ed5fb401c5c8d0d15bef5e95271726", - "size": 7553715, - "uuid": "60f17b79-74d9-49b5-a6da-48580a67f11f", - "version": "2019-05-16T015324.739985Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "847325b6", - "indexed": false, - "name": "TissueDissociationProtocol.pdf", - "s3_etag": "7e892bf8f6aa489ccb08a995c7f017e1", - "sha1": "f2237ad0a776fd7057eb3d3498114c85e2f521d7", - "sha256": "6929799f227ae5f0b3e0167a6cf2bd683db097848af6ccde6329185212598779", - "size": 32748, - "uuid": "6578c322-7060-4c82-8469-9e54100e6b44", - "version": "2019-05-16T015325.007527Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "b9364bfa", - "indexed": false, - "name": "SmartSeq2_RTPCR_protocol.pdf", - "s3_etag": "846fd9e6b98041df46a1ddb94e85b6b9", - "sha1": "89d9eb3f1b94f78a33d46c0288c2e81d4002049b", - "sha256": "2f6866c4ede92123f90dd15fb180fac56e33309b8fd3f4f52f263ed2f8af2f16", - "size": 29230, - "uuid": "cd8e02d1-d0f9-4094-9a31-329931df60dc", - "version": "2019-05-16T015325.251968Z" - }, - { - "content-type": "application/pdf; dcp-type=data", - "crc32c": "3658ec51", - "indexed": false, - "name": "SmartSeq2_sequencing_protocol.pdf", - "s3_etag": "2742e1e78f6d4663bf41d3080396695c", - "sha1": "9ec6ee2b6e2093681c1fed694b3a8c78a2aa3438", - "sha256": "9c93a354a8636c041a31ba6f3fb00ef20352e1b853d8080d63a654221cb35673", - "size": 61134, - "uuid": "bf92ef4a-c422-44fb-bfc1-c2f86528b86b", - "version": "2019-05-16T015325.498431Z" - } -] diff --git a/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/metadata.json b/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/metadata.json deleted file mode 100644 index b7c2fea82..000000000 --- a/test/hca_metadata_api/cans/prod/cc0b5aa4-9f66-48d2-aa4f-ed019d1c9439/2019-05-15T222432.561000Z/metadata.json +++ /dev/null @@ -1,233 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/13.1.0/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "21784_6#51", - "ncbi_taxon_id": [ - 10090 - ] - }, - "provenance": { - "document_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019", - "submission_date": "2019-05-14T11:01:32.467Z", - "update_date": "2019-05-14T12:00:06.941Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/10.2.0/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1126_LN", - "ncbi_taxon_id": [ - 10090 - ] - }, - "organ": { - "text": "lymph node" - }, - "provenance": { - "document_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf", - "submission_date": "2019-05-14T11:01:26.115Z", - "update_date": "2019-05-14T11:46:47.512Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/15.3.0/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "1126", - "ncbi_taxon_id": [ - 10090 - ] - }, - "genus_species": [ - { - "text": "Mus musculus" - } - ], - "is_living": "no", - "sex": "female", - "development_stage": { - "text": "adult" - }, - "provenance": { - "document_id": "63818269-c4d9-429b-85a3-db39c0dd7fa0", - "submission_date": "2019-05-14T11:01:25.684Z", - "update_date": "2019-05-14T11:29:50.173Z" - } - }, - "sequence_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/9.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "21784_6#51_1.fastq.gz", - "format": "fastq.gz" - }, - "read_index": "read1", - "provenance": { - "document_id": "61fd5348-92c5-446b-a57a-746330cebf76", - "submission_date": "2019-05-14T10:52:59.245Z", - "update_date": "2019-05-14T11:21:17.762Z" - } - }, - "supplementary_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.0.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "TissueDissociationProtocol.pdf", - "format": "pdf" - }, - "provenance": { - "document_id": "e738a267-87fc-4070-abc7-b3be6442c6d0", - "submission_date": "2019-05-14T10:52:33.892Z", - "update_date": "2019-05-14T11:01:15.816Z" - } - }, - "supplementary_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/2.0.0/supplementary_file", - "schema_type": "file", - "file_core": { - "file_name": "SmartSeq2_RTPCR_protocol.pdf", - "format": "pdf" - }, - "provenance": { - "document_id": "01a1d04b-05d0-4904-b627-68b0dc02bc17", - "submission_date": "2019-05-14T10:52:33.898Z", - "update_date": "2019-05-14T11:01:09.564Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/project/14.0.0/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Mouse Melanoma", - "project_title": "Melanoma infiltration of stromal and immune cells", - "project_description": "The cancer microenvironment is a complex ecosystem characterized by dynamic interactions between diverse cell types, including malignant, immune and stromal cells. Here, we performed single-cell RNA sequencing on CD45+ and CD45- cells isolated from tumour and lymph nodes during a mouse model of melanoma. The transcriptional profiles of these individual cells taken at different time points coupled with assembled T cell receptor sequences, allowed us to identify distinct immune subpopulations and delineate their developmental trajectory. Our study provides insights into the complex interplay among cells within the tumour microenvironment and presents a valuable resource for future translational applications." - }, - "funders": [ - ], - "provenance": { - "document_id": "8c3c290d-dfff-4553-8868-54ce45f4ba7f", - "submission_date": "2019-05-14T10:52:33.885Z", - "update_date": "2019-05-14T11:20:51.382Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "proc_21784_6#51" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", - "provenance": { - "document_id": "91f475ec-be51-4f1e-a904-74b10b7259f1", - "submission_date": "2019-05-14T11:06:54.971Z", - "update_date": "2019-05-14T12:10:53.274Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_366" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", - "provenance": { - "document_id": "e521d67d-c134-4dbd-9555-29e23f0463c5", - "submission_date": "2019-05-14T11:12:40.680Z", - "update_date": "2019-05-14T12:27:20.135Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_24" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/9.0.0/process", - "provenance": { - "document_id": "453a352c-94fb-4d3b-b609-df1e7abf8c09", - "submission_date": "2019-05-14T11:12:15.946Z", - "update_date": "2019-05-14T12:26:52.545Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/2.0.0/links", - "schema_type": "link_bundle", - "schema_version": "2.0.0", - "links": [ - { - "link_type": "process_link", - "process_id": "91f475ec-be51-4f1e-a904-74b10b7259f1", - "process_type": "process", - "inputs": [ - { - "input_type": "cell_suspension", - "input_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019" - } - ], - "outputs": [ - { - "output_type": "sequence_file", - "output_id": "61fd5348-92c5-446b-a57a-746330cebf76" - } - ], - "protocols": [ - ] - }, - { - "link_type": "process_link", - "process_id": "e521d67d-c134-4dbd-9555-29e23f0463c5", - "process_type": "process", - "inputs": [ - { - "input_type": "specimen_from_organism", - "input_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf" - } - ], - "outputs": [ - { - "output_type": "cell_suspension", - "output_id": "01ba6be9-ed4b-4c6b-ae05-2e06aadc2019" - } - ], - "protocols": [ - ] - }, - { - "link_type": "process_link", - "process_id": "453a352c-94fb-4d3b-b609-df1e7abf8c09", - "process_type": "process", - "inputs": [ - { - "input_type": "donor_organism", - "input_id": "63818269-c4d9-429b-85a3-db39c0dd7fa0" - } - ], - "outputs": [ - { - "output_type": "specimen_from_organism", - "output_id": "74eb3cb5-918a-49fc-9e15-3ac49fd54caf" - } - ], - "protocols": [ - ] - }, - { - "link_type": "supplementary_file_link", - "entity": { - "entity_type": "project", - "entity_id": "8c3c290d-dfff-4553-8868-54ce45f4ba7f" - }, - "files": [ - { - "file_id": "e738a267-87fc-4070-abc7-b3be6442c6d0", - "file_type": "supplementary_file" - }, - { - "file_id": "01a1d04b-05d0-4904-b627-68b0dc02bc17", - "file_type": "supplementary_file" - } - ] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe.2019-04-17T175706.867000Z.json b/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe.2019-04-17T175706.867000Z.json new file mode 100644 index 000000000..dfb5dc797 --- /dev/null +++ b/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe.2019-04-17T175706.867000Z.json @@ -0,0 +1,933 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "31fb9874", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "d35373d17f0b8d6e0adbcf2635e90927", + "sha1": "542fb7cc2aa70950b6d0519ec72cb4a4fcfa0595", + "sha256": "6d123df0dc62444d9d1e7945c6285483b3e73f38d359bb811f2035c04ddffc5d", + "size": 1189, + "uuid": "e4c205cd-746f-4665-8c29-149c6e109e9d", + "version": "2019-04-17T165831.889000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "13330aa8", + "indexed": true, + "name": "cell_line_0.json", + "s3_etag": "4f6c406d38126638b2efe099e34e5132", + "sha1": "6fb2de1be0ccd64fed8dc3bf739d645dcd797b99", + "sha256": "afb44a026bc584d5901a9257010c7722599517719e361dd417e0c64aa824cb11", + "size": 2169, + "uuid": "961092cd-dcff-4b59-a0d2-ceeef0aece74", + "version": "2019-04-17T165709.605000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "87a10080", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "d44942d408351ec1a2eec5a908fc3978", + "sha1": "55a7dfa2d545c65419127276eb810812edb29883", + "sha256": "f0945852b9635aaee40b6b3afd42f91618f7e8345c75834bb078464c5d9bede6", + "size": 1210, + "uuid": "a72a2ac2-c91b-406a-968c-28c8e15a2eaf", + "version": "2019-04-17T165513.039000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "2055f28f", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "cf706b33e8e38dc192bec6b8feb4c64d", + "sha1": "91ab9faf48683e414b291c8007a9da3ff05e6e3b", + "sha256": "6df293d1672526cd59c8b61e93b4cddf556fe186ec0d92499afebd8663b4dea2", + "size": 1085, + "uuid": "6c6973d5-9b4a-426d-9d88-825b464500f8", + "version": "2019-04-17T165512.518000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "bdbe85cf", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "114003372a3fed68b887c22dd5177b44", + "sha1": "95e4b3ce1514b715662b02bf097d10e0a886a083", + "sha256": "92e5489e8f70036e9a8e146a3bfb380b9f692ac635874668f0f5c3f7bcf7fb88", + "size": 443, + "uuid": "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", + "version": "2019-04-17T172747.623000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "62bec389", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "707774c897974c0cfa870bfdc3d598c7", + "sha1": "9d53052507f196999b68af4395966266bd497990", + "sha256": "ca24c3513ffe9d8c70a0ff0b0fff137d55dfbb262052f3ea5d3a172043a3e31d", + "size": 443, + "uuid": "a2db643f-decd-426d-94db-13c3279ea80a", + "version": "2019-04-17T172746.767000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "8602077b", + "indexed": true, + "name": "project_0.json", + "s3_etag": "6aa786f7908881fb0701ed835f751a3d", + "sha1": "346aca51dc29e1f5b472cc484930c373c7403c75", + "sha256": "11623355930046c0f06c6654b8e366c503843cbcd58de4b29e81ab38a58f4998", + "size": 10546, + "uuid": "b6dc9b93-929a-45d0-beb2-5cf8e64872fe", + "version": "2019-04-17T165512.490000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "46d2028e", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "8cad7b7082191b96c773ea1583a9dd96", + "sha1": "e455fbd5a9ccdab87a0c731f15a232c4a4e27fd8", + "sha256": "dfeab0c917b6dcdf69573c4fa45a24e16f1edb7c16bb09c508780363728a2f74", + "size": 1472, + "uuid": "60085aee-e5a6-40ac-bda1-855c052550b5", + "version": "2019-04-17T165216.679000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "f807f58c", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "bc3691263c280e45fc928b49fcf67a05", + "sha1": "bff9c6d8a621aa6dd50f34601fe5a3b4b128f7ac", + "sha256": "b490ddfb2a22e5c022e5d7e007ca65fc36da6413144e0b2ddea6c80f01839134", + "size": 1081, + "uuid": "9ccabcf3-7203-4f07-837f-6dde903d4cec", + "version": "2019-04-17T165216.627000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "82a95038", + "indexed": true, + "name": "differentiation_protocol_0.json", + "s3_etag": "5e4f3feb3b7ba30579ebcb1b76d0c00f", + "sha1": "a0c737ad1c9b1e370a6fd6858da4b7c11da37328", + "sha256": "13abe058727b856ab001f64ebd5efcfa383c36c16a454b1508aed03f3026eca2", + "size": 1104, + "uuid": "348b04e9-d131-4d45-b198-0c75300ee4a3", + "version": "2019-04-17T165216.700000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "bb48168a", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "2ae5313e657058a1c3f9c49710f9c98f", + "sha1": "da6e31409943f151904e2b5dfff64370227d88d4", + "sha256": "3e0a21aee2833f42b26cabe78d6626ee3943aa0b0515114ac78c1a0da79b46ea", + "size": 1551, + "uuid": "31b89ceb-0625-4f88-9623-85a18bbb84ee", + "version": "2019-04-17T165216.668000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "cc1373d7", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "9946569b542b61802a615ee8478e709f", + "sha1": "9eee2e73dc4118c34b76d746707fb2fb6bd6d3cf", + "sha256": "6c71b70f8800205976c11891d1a36c3d542bd45cd295ea459478ec247259e2b0", + "size": 1301, + "uuid": "958d38c4-fd0a-4352-9b1d-d95e28e2085e", + "version": "2019-04-17T165216.605000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "1cc89bf5", + "indexed": true, + "name": "process_0.json", + "s3_etag": "b02ca14e2cb05eca02851ac75c375a42", + "sha1": "51d86aaa2854a8ac7321e3f11db1f2d185223710", + "sha256": "ea90ac5cf595ce7a6ac86543fb7ceaf6303ca7c050b2a25780b46378278d05c0", + "size": 374, + "uuid": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", + "version": "2019-04-17T170201.452000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "998473d3", + "indexed": true, + "name": "process_1.json", + "s3_etag": "5c1e83e8f110c27fa97831c4aced4360", + "sha1": "e7e98b4ede3583803a42c9b2d02c945820dbabac", + "sha256": "2ba45c985f6a3b03535337f194beac552ab1d06358430473ad353d14c8b33960", + "size": 378, + "uuid": "2fbc1012-55ae-4fde-9069-fbf5376ca535", + "version": "2019-04-17T170021.013000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "bffaddb0", + "indexed": true, + "name": "process_2.json", + "s3_etag": "1ab53e2f55e2f34891381a7307a8b699", + "sha1": "7e6b87d2304a281049419fcd9b70b1b2645bcef8", + "sha256": "13e838eecadc582c35626829d80b384898bd294964a015034aaca9a56f4cad8e", + "size": 376, + "uuid": "466050f5-213c-4554-939e-4bb8298130dd", + "version": "2019-04-17T165959.704000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "9bf878f6", + "indexed": true, + "name": "process_3.json", + "s3_etag": "4903518e020fd8fd89741550102489ea", + "sha1": "9356033ccaf8f5ec03f56d05cf4ea5ad82a53505", + "sha256": "51fc251dad72646c599bcc31fb9ed16e21eb689ce1581d5caed8431bf7969369", + "size": 376, + "uuid": "4276c1dd-50aa-4ffa-a618-dee757bff479", + "version": "2019-04-17T165959.680000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "4392f0e2", + "indexed": true, + "name": "links.json", + "s3_etag": "ddce74cad640a9a30b2b3b6ac6c4f0c8", + "sha1": "8e596d873bf15ebc9f1ff405e17ec633248ebe0a", + "sha256": "024b37f1635851b6100974e5318170fbbca1875a02a43c25ce65cb4ac0e5e1e9", + "size": 2643, + "uuid": "468bd567-e319-4dcc-a636-daf90a534f6d", + "version": "2019-04-17T185612.241223Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "9e612174", + "indexed": false, + "name": "SRR5174359_2.fastq.gz", + "s3_etag": "d36aaa593942b13a919531a1ee1a6821", + "sha1": "7309f2df68753bfbce40494e849409f2ed478025", + "sha256": "ee3460f575d22a5eb63adde61d676aeadacb3c1ea093c5d8c2642ff0dadc1240", + "size": 55845877, + "uuid": "a8cd43ba-07c4-41d4-864c-51bdd8414e2a", + "version": "2019-04-17T185612.704173Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "8178debb", + "indexed": false, + "name": "SRR5174359_1.fastq.gz", + "s3_etag": "de907bad7481f6ca8f15482361139457", + "sha1": "0ab50c453242cbe095a4e12255650e87ed942652", + "sha256": "4155d5635ada90888551db93ab76e4af10051bde815870f0ce6206a4c01e3226", + "size": 55064135, + "uuid": "13f3e771-f16b-4589-b317-ed88c817bb59", + "version": "2019-04-17T185613.009698Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/11.0.0/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "D54Dn15E01", + "biomaterial_name": "hESC-derived inhibitory interneurons", + "biomaterial_description": "hESC-derived inhibitory interneurons at day 54", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DCX-Citrine" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "selected_cell_type": [ + { + "text": "inhibitory interneurons", + "ontology": "CL:0000498", + "ontology_label": "inhibitory interneuron" + } + ], + "timecourse": { + "value": "54", + "unit": { + "text": "day", + "ontology_label": "day", + "ontology": "UO:0000627" + } + }, + "provenance": { + "document_id": "e4c205cd-746f-4665-8c29-149c6e109e9d", + "submission_date": "2019-04-17T16:51:39.733Z", + "update_date": "2019-04-17T16:58:31.889Z" + } + }, + "cell_line_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/11.0.0/cell_line", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "cell_line_at_day_54", + "biomaterial_name": "cell_line_at_day_54", + "biomaterial_description": "hESC-derived inhibitory interneurons at day 54", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DCX-Citrine" + }, + "cell_line_type": "stem cell-derived", + "cell_type": { + "text": "interneuron", + "ontology": "CL:0000099", + "ontology_label": "interneuron" + }, + "disease": { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "publication": { + "authors": [ + "Close JL", + "Yao Z", + "Levi BP", + "Miller JA", + "Bakken TE", + "Menon V", + "Ting JT", + "Wall A", + "Krostag AR", + "Thomsen ER", + "Nelson AM", + "Mich JK", + "Hodge RD", + "Shehata SI", + "Glass IA", + "Bort S", + "Shapovalova NV", + "Ngo NK", + "Grimley JS", + "Phillips JW", + "Thompson CL", + "Ramanathan S", + "Lein E" + ], + "publication_title": "Single-Cell Profiling of an In\u00a0Vitro Model of Human Interneuron Development Reveals Temporal Dynamics of Cell Type Production and Maturation.", + "doi": "10.1016/j.neuron.2017.02.014", + "pmid": 28279351, + "publication_url": "https://europepmc.org/abstract/MED/28279351" + }, + "model_organ": { + "text": "brain", + "ontology": "UBERON_0000955", + "ontology_label": "brain" + }, + "provenance": { + "document_id": "961092cd-dcff-4b59-a0d2-ceeef0aece74", + "submission_date": "2019-04-17T16:51:35.053Z", + "update_date": "2019-04-17T16:57:09.605Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.0/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "embryo_WAe001-A", + "biomaterial_name": "human embryo", + "biomaterial_description": "human embryo", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DCX-Citrine" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "embryo", + "ontology": "UBERON:0000922", + "ontology_label": "embryo" + }, + "organ_parts": [ + { + "text": "blastocyst", + "ontology": "UBERON:0000358", + "ontology_label": "blastocyst" + } + ], + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "provenance": { + "document_id": "a72a2ac2-c91b-406a-968c-28c8e15a2eaf", + "submission_date": "2019-04-17T16:51:35.037Z", + "update_date": "2019-04-17T16:55:13.039Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/14.0.7/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "donor_WAe001-A", + "biomaterial_name": "human embryo", + "biomaterial_description": "human embryo", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "development_stage": { + "text": "human embryonic stage", + "ontology": "HsapDv:0000002", + "ontology_label": "human embryonic stage" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "is_living": "yes", + "sex": "male", + "provenance": { + "document_id": "6c6973d5-9b4a-426d-9d88-825b464500f8", + "submission_date": "2019-04-17T16:51:35.032Z", + "update_date": "2019-04-17T16:55:12.518Z" + } + }, + "sequence_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/8.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR5174359_2.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read2", + "provenance": { + "document_id": "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", + "submission_date": "2019-04-17T16:53:04.375Z", + "update_date": "2019-04-17T17:27:47.623Z" + } + }, + "sequence_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/8.0.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR5174359_1.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "provenance": { + "document_id": "a2db643f-decd-426d-94db-13c3279ea80a", + "submission_date": "2019-04-17T16:53:04.385Z", + "update_date": "2019-04-17T17:27:46.767Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/project/11.1.0/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Single cell RNAseq characterization of cell types produced over time in an in vitro model of human inhibitory interneuron differentiation.", + "project_title": "Single-cell RNA-seq analysis throughout a 125-day differentiation protocol that converted H1 human embryonic stem cells to a variety of ventrally-derived cell types.", + "project_description": "Diverse cell types are produced from dorsal and ventral regions of the developing neural tube. In this study we describe a system for generating human inhibitory interneurons by ventralizing human embryonic stem cells in vitro and characterizing the gene expression of the cell types produced over time. We engineered a DCX-Citrine/Y hESC line to sort and characterize progenitor and neuron transcriptomics separately at both the subpopulation and single cell level. The cells generated in vitro were compared to similar populations present in human fetal brain samples by mapping gene expression data from human fetal cells onto the principal component analysis (PCA) space of in vitro-derived populations. Weighted gene co-expression network analysis (WGCNA) was used to determine the discreet cell types present at D24, D54, D100 and D125 of culture, and describe the gene expression changes that occur in progenitor and neuron populations over time. Immature lateral ganglionic eminence and medial ganglionic eminence cells are present at early timepoints, along with MGE-like and dorsal pallium-like neuronal progenitors. At later timepoints we observe the emergence of SST-expressing interneurons, as well as oligodendrocyte and astrocyte progenitors. We also identified genes that were upregulated in somatostatin-expressing interneurons as they mature. The transcriptomes of 1732 ventralized single cells were profiled by SmartSeq2 at different timepoints throughout a 125-day differentiation protocol that converted H1 human embryonic stem cells to a variety of ventrally-derived cell types." + }, + "insdc_project_accessions": [ + "SRP096727" + ], + "geo_series_accessions": [ + "GSE93593" + ], + "insdc_study_accessions": [ + "PRJNA361254" + ], + "supplementary_links": [ + "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-93593/Results" + ], + "array_express_accessions": [ + "E-GEOD-93593" + ], + "contributors": [ + { + "contact_name": "Jennie,,Close", + "email": "jenniec@alleninstitute.org", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Zizhen,,Yao", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Boaz,,Levi", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Jeremy,,Miller", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Trygve,,Bakken", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Vilas,,Menon", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Jonathan,,Ting", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Abigail,,Wall", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Anne-Rachel,,Krogstag", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Elliot,,Thomsen", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Angel,,Nelson", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "John,,Mich", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Rebecca,,Hodge", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Soraya,,Shehata", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Ian,,Glass", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Susan,,Bort", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Nadiya,,Shapovalova", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Olivia,,Fong", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Kiet,,Ngo", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Joshua,,Grimley", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "John,,Phillips", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Carol,,Thompson", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Sharad,,Ramanathan", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Ed,,Lein", + "institution": "The Allen Institute for Brain Science", + "address": "615 Westlake Ave N, Seattle, WA", + "country": "USA" + }, + { + "contact_name": "Laura,,Huerta", + "email": "lauhuema@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Molecular Atlas", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8748-599X", + "corresponding_contributor": false + }, + { + "contact_name": "Matthew,,Green", + "email": "hewgreen@ebi.ac.uk", + "phone": "(+44) 122-349-4444", + "institution": "EMBL-EBI European Bioinformatics Institute", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2771-9894", + "corresponding_contributor": false + } + ], + "funders": [ + { + "grant_title": "Directors Pioneer Award", + "grant_id": "5DP1MH099906-03", + "organization": "National Institute of Health" + }, + { + "grant_title": "National Science Foundation grant", + "grant_id": "PHY-0952766", + "organization": "National Science Foundation" + } + ], + "publications": [ + { + "authors": [ + "Close JL", + "Yao Z", + "Levi BP", + "Miller JA", + "Bakken TE", + "Menon V", + "Ting JT", + "Wall A", + "Krostag AR", + "Thomsen ER", + "Nelson AM", + "Mich JK", + "Hodge RD", + "Shehata SI", + "Glass IA", + "Bort S", + "Shapovalova NV", + "Ngo NK", + "Grimley JS", + "Phillips JW", + "Thompson CL", + "Ramanathan S", + "Lein E" + ], + "publication_title": "Single-Cell Profiling of an In\u00a0Vitro Model of Human Interneuron Development Reveals Temporal Dynamics of Cell Type Production and Maturation.", + "doi": "10.1016/j.neuron.2017.02.014", + "pmid": 28279351, + "publication_url": "https://europepmc.org/abstract/MED/28279351" + } + ], + "provenance": { + "document_id": "b6dc9b93-929a-45d0-beb2-5cf8e64872fe", + "submission_date": "2019-04-17T16:51:35.026Z", + "update_date": "2019-04-17T16:55:12.490Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/6.0.0/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "P-GSE93593-3", + "protocol_name": "single cell library construction protocol", + "protocol_description": "Cells were prepared for single-cell transcriptomics using SmartSeq2 (Picelli et al., 2014). After reverse transcription and template switching, we amplified cDNA with KAPA HotStart HIFI 2\u00d7 ReadyMix (Kapa Biosystems) for 22 cycles for RNA from single primary cortical cells. We purified PCR products using Ampure XP beads (Beckman Coulter). We quantified cDNA using a High Sensitivity DNA Chip (Agilent) on a Bioanalyzer 2100 or with the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher) on an Enspire plate reader (PerkinElmer)." + }, + "nucleic_acid_source": "single cell", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869", + "ontology_label": "polyA RNA" + }, + "library_construction_method": { + "text": "Smart-seq2", + "ontology": "EFO:0008931", + "ontology_label": "Smart-seq2" + }, + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "provenance": { + "document_id": "60085aee-e5a6-40ac-bda1-855c052550b5", + "submission_date": "2019-04-17T16:52:10.952Z", + "update_date": "2019-04-17T16:52:16.679Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/10.0.0/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "P-GSE93593-4", + "protocol_name": "single cell sequencing protocol", + "protocol_description": "We used 1 ng of cDNA to generate RNA-Seq libraries using the Nextera XT library prep system (Illumina). We carried out sequencing of human cortical cells the on Illumina HiSeq using 50 base paired-end reads" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565", + "ontology_label": "Illumina HiSeq 2500" + }, + "paired_end": true, + "method": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441", + "ontology_label": "full length single cell RNA sequencing" + }, + "provenance": { + "document_id": "9ccabcf3-7203-4f07-837f-6dde903d4cec", + "submission_date": "2019-04-17T16:52:11.186Z", + "update_date": "2019-04-17T16:52:16.627Z" + } + }, + "differentiation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/1.3.3/differentiation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "P-GSE93593-1", + "protocol_name": "growth protocol", + "protocol_description": "We constructed an hESC line with Citrine (Cit) fused to the endogenous copy of the DCX gene in the H1 parent line (WAe001-A RRID:CVCL_9771) to allow us to profile neurons (Cit+) and progenitors (Cit\u2212) (Yao et al., 2017). hESCs were seeded for a 10-day cortical induction phase in NIMX media with SMAD inhibitors; reseeded for the ventralization phase at D10 in culture media containing Shh and purmorphamine, and finally at D24 for neural differentiation with neurogenic/neurotrophic factors BDNF, GDNF, NT3, and cAMP. The protocol was ended at D125." + }, + "differentiation_method": "cell suspension", + "provenance": { + "document_id": "348b04e9-d131-4d45-b198-0c75300ee4a3", + "submission_date": "2019-04-17T16:52:10.815Z", + "update_date": "2019-04-17T16:52:16.700Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/6.0.0/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "P-GSE93593-2", + "protocol_name": "single cell isolation protocol", + "protocol_description": "To generate single cell suspensions, hESC-derived cultures were dissociated from plates using Accutase (ThermoFisher) at 37C. Light trituration using a P1000 pipette was done every 5 min until nearly all clumps had been dissociated (up to 1 h). Cell suspension was washed and filtered through a 40 um cell strainer. Cells were washed in PBS with 1% FBS and stained with 0.5-1 ug/mL DAPI. Single-cell suspensions were loaded onto a FACSAria II SORP (Becton Dickinson) and sorted directly into PCR strip tubes or plates held in chilled aluminium blocks. Doublets and dead cells were excluded based on forward scatter, side scatter and DAPI fluorescence. Sorting was done using the 130 um nozzle with the sort mode set to single cell. Accuracy of single-cell sorts was confirmed by sorting DAPI-stained fixed cells onto a dry well of a 96-well plate and analyzing by fluorescence microscopy." + }, + "method": { + "text": "enzymatic dissociation", + "ontology": "EFO:0009128", + "ontology_label": "enzymatic dissociation" + }, + "provenance": { + "document_id": "31b89ceb-0625-4f88-9623-85a18bbb84ee", + "submission_date": "2019-04-17T16:52:10.865Z", + "update_date": "2019-04-17T16:52:16.668Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.9/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "FACS_enrichment_protocol", + "protocol_name": "FACS enrichment for single, live cells.", + "protocol_description": "Single-cell suspensions were loaded onto a FACSAria II SORP (Becton Dickinson) and sorted directly into PCR strip tubes or plates held in chilled aluminum blocks. Doublets and dead cells were excluded based on forward scatter, side scatter and DAPI fluorescence. Sorting was done using the 130 \u03bcm nozzle with the sort mode set to single cell. Accuracy of single-cell sorts was confirmed by sorting DAPI-stained fixed cells onto a dry well of a 96-well plate and analyzing by fluorescence microscopy." + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "DAPI", + "provenance": { + "document_id": "958d38c4-fd0a-4352-9b1d-d95e28e2085e", + "submission_date": "2019-04-17T16:52:10.900Z", + "update_date": "2019-04-17T16:52:16.605Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "D54Dn15E01" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", + "submission_date": "2019-04-17T16:54:54.638Z", + "update_date": "2019-04-17T17:02:01.452Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_601" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "2fbc1012-55ae-4fde-9069-fbf5376ca535", + "submission_date": "2019-04-17T16:53:46.016Z", + "update_date": "2019-04-17T17:00:21.013Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_4" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "466050f5-213c-4554-939e-4bb8298130dd", + "submission_date": "2019-04-17T16:53:30.594Z", + "update_date": "2019-04-17T16:59:59.704Z" + } + }, + "process_3.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "4276c1dd-50aa-4ffa-a618-dee757bff479", + "submission_date": "2019-04-17T16:53:30.570Z", + "update_date": "2019-04-17T16:59:59.680Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.5/links", + "schema_type": "link_bundle", + "schema_version": "1.1.5", + "links": [ + { + "process": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", + "inputs": [ + "e4c205cd-746f-4665-8c29-149c6e109e9d" + ], + "input_type": "biomaterial", + "outputs": [ + "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", + "a2db643f-decd-426d-94db-13c3279ea80a" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "60085aee-e5a6-40ac-bda1-855c052550b5" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "9ccabcf3-7203-4f07-837f-6dde903d4cec" + } + ] + }, + { + "process": "2fbc1012-55ae-4fde-9069-fbf5376ca535", + "inputs": [ + "961092cd-dcff-4b59-a0d2-ceeef0aece74" + ], + "input_type": "biomaterial", + "outputs": [ + "e4c205cd-746f-4665-8c29-149c6e109e9d" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "differentiation_protocol", + "protocol_id": "348b04e9-d131-4d45-b198-0c75300ee4a3" + }, + { + "protocol_type": "dissociation_protocol", + "protocol_id": "31b89ceb-0625-4f88-9623-85a18bbb84ee" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "958d38c4-fd0a-4352-9b1d-d95e28e2085e" + } + ] + }, + { + "process": "466050f5-213c-4554-939e-4bb8298130dd", + "inputs": [ + "a72a2ac2-c91b-406a-968c-28c8e15a2eaf" + ], + "input_type": "biomaterial", + "outputs": [ + "961092cd-dcff-4b59-a0d2-ceeef0aece74" + ], + "output_type": "biomaterial", + "protocols": [] + }, + { + "process": "4276c1dd-50aa-4ffa-a618-dee757bff479", + "inputs": [ + "6c6973d5-9b4a-426d-9d88-825b464500f8" + ], + "input_type": "biomaterial", + "outputs": [ + "a72a2ac2-c91b-406a-968c-28c8e15a2eaf" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/manifest.json b/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/manifest.json deleted file mode 100644 index 7406d4ba5..000000000 --- a/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/manifest.json +++ /dev/null @@ -1,230 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "31fb9874", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "d35373d17f0b8d6e0adbcf2635e90927", - "sha1": "542fb7cc2aa70950b6d0519ec72cb4a4fcfa0595", - "sha256": "6d123df0dc62444d9d1e7945c6285483b3e73f38d359bb811f2035c04ddffc5d", - "size": 1189, - "uuid": "e4c205cd-746f-4665-8c29-149c6e109e9d", - "version": "2019-04-17T165831.889000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "13330aa8", - "indexed": true, - "name": "cell_line_0.json", - "s3_etag": "4f6c406d38126638b2efe099e34e5132", - "sha1": "6fb2de1be0ccd64fed8dc3bf739d645dcd797b99", - "sha256": "afb44a026bc584d5901a9257010c7722599517719e361dd417e0c64aa824cb11", - "size": 2169, - "uuid": "961092cd-dcff-4b59-a0d2-ceeef0aece74", - "version": "2019-04-17T165709.605000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "87a10080", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "d44942d408351ec1a2eec5a908fc3978", - "sha1": "55a7dfa2d545c65419127276eb810812edb29883", - "sha256": "f0945852b9635aaee40b6b3afd42f91618f7e8345c75834bb078464c5d9bede6", - "size": 1210, - "uuid": "a72a2ac2-c91b-406a-968c-28c8e15a2eaf", - "version": "2019-04-17T165513.039000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "2055f28f", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "cf706b33e8e38dc192bec6b8feb4c64d", - "sha1": "91ab9faf48683e414b291c8007a9da3ff05e6e3b", - "sha256": "6df293d1672526cd59c8b61e93b4cddf556fe186ec0d92499afebd8663b4dea2", - "size": 1085, - "uuid": "6c6973d5-9b4a-426d-9d88-825b464500f8", - "version": "2019-04-17T165512.518000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "bdbe85cf", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "114003372a3fed68b887c22dd5177b44", - "sha1": "95e4b3ce1514b715662b02bf097d10e0a886a083", - "sha256": "92e5489e8f70036e9a8e146a3bfb380b9f692ac635874668f0f5c3f7bcf7fb88", - "size": 443, - "uuid": "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", - "version": "2019-04-17T172747.623000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "62bec389", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "707774c897974c0cfa870bfdc3d598c7", - "sha1": "9d53052507f196999b68af4395966266bd497990", - "sha256": "ca24c3513ffe9d8c70a0ff0b0fff137d55dfbb262052f3ea5d3a172043a3e31d", - "size": 443, - "uuid": "a2db643f-decd-426d-94db-13c3279ea80a", - "version": "2019-04-17T172746.767000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "8602077b", - "indexed": true, - "name": "project_0.json", - "s3_etag": "6aa786f7908881fb0701ed835f751a3d", - "sha1": "346aca51dc29e1f5b472cc484930c373c7403c75", - "sha256": "11623355930046c0f06c6654b8e366c503843cbcd58de4b29e81ab38a58f4998", - "size": 10546, - "uuid": "b6dc9b93-929a-45d0-beb2-5cf8e64872fe", - "version": "2019-04-17T165512.490000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "46d2028e", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "8cad7b7082191b96c773ea1583a9dd96", - "sha1": "e455fbd5a9ccdab87a0c731f15a232c4a4e27fd8", - "sha256": "dfeab0c917b6dcdf69573c4fa45a24e16f1edb7c16bb09c508780363728a2f74", - "size": 1472, - "uuid": "60085aee-e5a6-40ac-bda1-855c052550b5", - "version": "2019-04-17T165216.679000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "f807f58c", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "bc3691263c280e45fc928b49fcf67a05", - "sha1": "bff9c6d8a621aa6dd50f34601fe5a3b4b128f7ac", - "sha256": "b490ddfb2a22e5c022e5d7e007ca65fc36da6413144e0b2ddea6c80f01839134", - "size": 1081, - "uuid": "9ccabcf3-7203-4f07-837f-6dde903d4cec", - "version": "2019-04-17T165216.627000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "82a95038", - "indexed": true, - "name": "differentiation_protocol_0.json", - "s3_etag": "5e4f3feb3b7ba30579ebcb1b76d0c00f", - "sha1": "a0c737ad1c9b1e370a6fd6858da4b7c11da37328", - "sha256": "13abe058727b856ab001f64ebd5efcfa383c36c16a454b1508aed03f3026eca2", - "size": 1104, - "uuid": "348b04e9-d131-4d45-b198-0c75300ee4a3", - "version": "2019-04-17T165216.700000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "bb48168a", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "2ae5313e657058a1c3f9c49710f9c98f", - "sha1": "da6e31409943f151904e2b5dfff64370227d88d4", - "sha256": "3e0a21aee2833f42b26cabe78d6626ee3943aa0b0515114ac78c1a0da79b46ea", - "size": 1551, - "uuid": "31b89ceb-0625-4f88-9623-85a18bbb84ee", - "version": "2019-04-17T165216.668000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "cc1373d7", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "9946569b542b61802a615ee8478e709f", - "sha1": "9eee2e73dc4118c34b76d746707fb2fb6bd6d3cf", - "sha256": "6c71b70f8800205976c11891d1a36c3d542bd45cd295ea459478ec247259e2b0", - "size": 1301, - "uuid": "958d38c4-fd0a-4352-9b1d-d95e28e2085e", - "version": "2019-04-17T165216.605000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "1cc89bf5", - "indexed": true, - "name": "process_0.json", - "s3_etag": "b02ca14e2cb05eca02851ac75c375a42", - "sha1": "51d86aaa2854a8ac7321e3f11db1f2d185223710", - "sha256": "ea90ac5cf595ce7a6ac86543fb7ceaf6303ca7c050b2a25780b46378278d05c0", - "size": 374, - "uuid": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", - "version": "2019-04-17T170201.452000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "998473d3", - "indexed": true, - "name": "process_1.json", - "s3_etag": "5c1e83e8f110c27fa97831c4aced4360", - "sha1": "e7e98b4ede3583803a42c9b2d02c945820dbabac", - "sha256": "2ba45c985f6a3b03535337f194beac552ab1d06358430473ad353d14c8b33960", - "size": 378, - "uuid": "2fbc1012-55ae-4fde-9069-fbf5376ca535", - "version": "2019-04-17T170021.013000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "bffaddb0", - "indexed": true, - "name": "process_2.json", - "s3_etag": "1ab53e2f55e2f34891381a7307a8b699", - "sha1": "7e6b87d2304a281049419fcd9b70b1b2645bcef8", - "sha256": "13e838eecadc582c35626829d80b384898bd294964a015034aaca9a56f4cad8e", - "size": 376, - "uuid": "466050f5-213c-4554-939e-4bb8298130dd", - "version": "2019-04-17T165959.704000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "9bf878f6", - "indexed": true, - "name": "process_3.json", - "s3_etag": "4903518e020fd8fd89741550102489ea", - "sha1": "9356033ccaf8f5ec03f56d05cf4ea5ad82a53505", - "sha256": "51fc251dad72646c599bcc31fb9ed16e21eb689ce1581d5caed8431bf7969369", - "size": 376, - "uuid": "4276c1dd-50aa-4ffa-a618-dee757bff479", - "version": "2019-04-17T165959.680000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "4392f0e2", - "indexed": true, - "name": "links.json", - "s3_etag": "ddce74cad640a9a30b2b3b6ac6c4f0c8", - "sha1": "8e596d873bf15ebc9f1ff405e17ec633248ebe0a", - "sha256": "024b37f1635851b6100974e5318170fbbca1875a02a43c25ce65cb4ac0e5e1e9", - "size": 2643, - "uuid": "468bd567-e319-4dcc-a636-daf90a534f6d", - "version": "2019-04-17T185612.241223Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "9e612174", - "indexed": false, - "name": "SRR5174359_2.fastq.gz", - "s3_etag": "d36aaa593942b13a919531a1ee1a6821", - "sha1": "7309f2df68753bfbce40494e849409f2ed478025", - "sha256": "ee3460f575d22a5eb63adde61d676aeadacb3c1ea093c5d8c2642ff0dadc1240", - "size": 55845877, - "uuid": "a8cd43ba-07c4-41d4-864c-51bdd8414e2a", - "version": "2019-04-17T185612.704173Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "8178debb", - "indexed": false, - "name": "SRR5174359_1.fastq.gz", - "s3_etag": "de907bad7481f6ca8f15482361139457", - "sha1": "0ab50c453242cbe095a4e12255650e87ed942652", - "sha256": "4155d5635ada90888551db93ab76e4af10051bde815870f0ce6206a4c01e3226", - "size": 55064135, - "uuid": "13f3e771-f16b-4589-b317-ed88c817bb59", - "version": "2019-04-17T185613.009698Z" - } -] \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/metadata.json b/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/metadata.json deleted file mode 100644 index 77de5eeec..000000000 --- a/test/hca_metadata_api/cans/prod/ffee3a9b-14de-4dda-980f-c08092b2dabe/2019-04-17T175706.867000Z/metadata.json +++ /dev/null @@ -1,701 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/11.0.0/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "D54Dn15E01", - "biomaterial_name": "hESC-derived inhibitory interneurons", - "biomaterial_description": "hESC-derived inhibitory interneurons at day 54", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DCX-Citrine" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "selected_cell_type": [ - { - "text": "inhibitory interneurons", - "ontology": "CL:0000498", - "ontology_label": "inhibitory interneuron" - } - ], - "timecourse": { - "value": "54", - "unit": { - "text": "day", - "ontology_label": "day", - "ontology": "UO:0000627" - } - }, - "provenance": { - "document_id": "e4c205cd-746f-4665-8c29-149c6e109e9d", - "submission_date": "2019-04-17T16:51:39.733Z", - "update_date": "2019-04-17T16:58:31.889Z" - } - }, - "cell_line_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/11.0.0/cell_line", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "cell_line_at_day_54", - "biomaterial_name": "cell_line_at_day_54", - "biomaterial_description": "hESC-derived inhibitory interneurons at day 54", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DCX-Citrine" - }, - "cell_line_type": "stem cell-derived", - "cell_type": { - "text": "interneuron", - "ontology": "CL:0000099", - "ontology_label": "interneuron" - }, - "disease": { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "publication": { - "authors": [ - "Close JL", - "Yao Z", - "Levi BP", - "Miller JA", - "Bakken TE", - "Menon V", - "Ting JT", - "Wall A", - "Krostag AR", - "Thomsen ER", - "Nelson AM", - "Mich JK", - "Hodge RD", - "Shehata SI", - "Glass IA", - "Bort S", - "Shapovalova NV", - "Ngo NK", - "Grimley JS", - "Phillips JW", - "Thompson CL", - "Ramanathan S", - "Lein E" - ], - "publication_title": "Single-Cell Profiling of an In\u00a0Vitro Model of Human Interneuron Development Reveals Temporal Dynamics of Cell Type Production and Maturation.", - "doi": "10.1016/j.neuron.2017.02.014", - "pmid": 28279351, - "publication_url": "https://europepmc.org/abstract/MED/28279351" - }, - "model_organ": { - "text": "brain", - "ontology": "UBERON_0000955", - "ontology_label": "brain" - }, - "provenance": { - "document_id": "961092cd-dcff-4b59-a0d2-ceeef0aece74", - "submission_date": "2019-04-17T16:51:35.053Z", - "update_date": "2019-04-17T16:57:09.605Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/9.0.0/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "embryo_WAe001-A", - "biomaterial_name": "human embryo", - "biomaterial_description": "human embryo", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DCX-Citrine" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "embryo", - "ontology": "UBERON:0000922", - "ontology_label": "embryo" - }, - "organ_parts": [ - { - "text": "blastocyst", - "ontology": "UBERON:0000358", - "ontology_label": "blastocyst" - } - ], - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "provenance": { - "document_id": "a72a2ac2-c91b-406a-968c-28c8e15a2eaf", - "submission_date": "2019-04-17T16:51:35.037Z", - "update_date": "2019-04-17T16:55:13.039Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/14.0.7/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "donor_WAe001-A", - "biomaterial_name": "human embryo", - "biomaterial_description": "human embryo", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "development_stage": { - "text": "human embryonic stage", - "ontology": "HsapDv:0000002", - "ontology_label": "human embryonic stage" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "is_living": "yes", - "sex": "male", - "provenance": { - "document_id": "6c6973d5-9b4a-426d-9d88-825b464500f8", - "submission_date": "2019-04-17T16:51:35.032Z", - "update_date": "2019-04-17T16:55:12.518Z" - } - }, - "sequence_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/8.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR5174359_2.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read2", - "provenance": { - "document_id": "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", - "submission_date": "2019-04-17T16:53:04.375Z", - "update_date": "2019-04-17T17:27:47.623Z" - } - }, - "sequence_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/8.0.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR5174359_1.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "provenance": { - "document_id": "a2db643f-decd-426d-94db-13c3279ea80a", - "submission_date": "2019-04-17T16:53:04.385Z", - "update_date": "2019-04-17T17:27:46.767Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/project/11.1.0/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Single cell RNAseq characterization of cell types produced over time in an in vitro model of human inhibitory interneuron differentiation.", - "project_title": "Single-cell RNA-seq analysis throughout a 125-day differentiation protocol that converted H1 human embryonic stem cells to a variety of ventrally-derived cell types.", - "project_description": "Diverse cell types are produced from dorsal and ventral regions of the developing neural tube. In this study we describe a system for generating human inhibitory interneurons by ventralizing human embryonic stem cells in vitro and characterizing the gene expression of the cell types produced over time. We engineered a DCX-Citrine/Y hESC line to sort and characterize progenitor and neuron transcriptomics separately at both the subpopulation and single cell level. The cells generated in vitro were compared to similar populations present in human fetal brain samples by mapping gene expression data from human fetal cells onto the principal component analysis (PCA) space of in vitro-derived populations. Weighted gene co-expression network analysis (WGCNA) was used to determine the discreet cell types present at D24, D54, D100 and D125 of culture, and describe the gene expression changes that occur in progenitor and neuron populations over time. Immature lateral ganglionic eminence and medial ganglionic eminence cells are present at early timepoints, along with MGE-like and dorsal pallium-like neuronal progenitors. At later timepoints we observe the emergence of SST-expressing interneurons, as well as oligodendrocyte and astrocyte progenitors. We also identified genes that were upregulated in somatostatin-expressing interneurons as they mature. The transcriptomes of 1732 ventralized single cells were profiled by SmartSeq2 at different timepoints throughout a 125-day differentiation protocol that converted H1 human embryonic stem cells to a variety of ventrally-derived cell types." - }, - "insdc_project_accessions": [ - "SRP096727" - ], - "geo_series_accessions": [ - "GSE93593" - ], - "insdc_study_accessions": [ - "PRJNA361254" - ], - "supplementary_links": [ - "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-93593/Results" - ], - "array_express_accessions": [ - "E-GEOD-93593" - ], - "contributors": [ - { - "contact_name": "Jennie,,Close", - "email": "jenniec@alleninstitute.org", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Zizhen,,Yao", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Boaz,,Levi", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Jeremy,,Miller", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Trygve,,Bakken", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Vilas,,Menon", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Jonathan,,Ting", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Abigail,,Wall", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Anne-Rachel,,Krogstag", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Elliot,,Thomsen", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Angel,,Nelson", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "John,,Mich", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Rebecca,,Hodge", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Soraya,,Shehata", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Ian,,Glass", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Susan,,Bort", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Nadiya,,Shapovalova", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Olivia,,Fong", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Kiet,,Ngo", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Joshua,,Grimley", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "John,,Phillips", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Carol,,Thompson", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Sharad,,Ramanathan", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Ed,,Lein", - "institution": "The Allen Institute for Brain Science", - "address": "615 Westlake Ave N, Seattle, WA", - "country": "USA" - }, - { - "contact_name": "Laura,,Huerta", - "email": "lauhuema@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Molecular Atlas", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8748-599X", - "corresponding_contributor": false - }, - { - "contact_name": "Matthew,,Green", - "email": "hewgreen@ebi.ac.uk", - "phone": "(+44) 122-349-4444", - "institution": "EMBL-EBI European Bioinformatics Institute", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2771-9894", - "corresponding_contributor": false - } - ], - "funders": [ - { - "grant_title": "Directors Pioneer Award", - "grant_id": "5DP1MH099906-03", - "organization": "National Institute of Health" - }, - { - "grant_title": "National Science Foundation grant", - "grant_id": "PHY-0952766", - "organization": "National Science Foundation" - } - ], - "publications": [ - { - "authors": [ - "Close JL", - "Yao Z", - "Levi BP", - "Miller JA", - "Bakken TE", - "Menon V", - "Ting JT", - "Wall A", - "Krostag AR", - "Thomsen ER", - "Nelson AM", - "Mich JK", - "Hodge RD", - "Shehata SI", - "Glass IA", - "Bort S", - "Shapovalova NV", - "Ngo NK", - "Grimley JS", - "Phillips JW", - "Thompson CL", - "Ramanathan S", - "Lein E" - ], - "publication_title": "Single-Cell Profiling of an In\u00a0Vitro Model of Human Interneuron Development Reveals Temporal Dynamics of Cell Type Production and Maturation.", - "doi": "10.1016/j.neuron.2017.02.014", - "pmid": 28279351, - "publication_url": "https://europepmc.org/abstract/MED/28279351" - } - ], - "provenance": { - "document_id": "b6dc9b93-929a-45d0-beb2-5cf8e64872fe", - "submission_date": "2019-04-17T16:51:35.026Z", - "update_date": "2019-04-17T16:55:12.490Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/6.0.0/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "P-GSE93593-3", - "protocol_name": "single cell library construction protocol", - "protocol_description": "Cells were prepared for single-cell transcriptomics using SmartSeq2 (Picelli et al., 2014). After reverse transcription and template switching, we amplified cDNA with KAPA HotStart HIFI 2\u00d7 ReadyMix (Kapa Biosystems) for 22 cycles for RNA from single primary cortical cells. We purified PCR products using Ampure XP beads (Beckman Coulter). We quantified cDNA using a High Sensitivity DNA Chip (Agilent) on a Bioanalyzer 2100 or with the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher) on an Enspire plate reader (PerkinElmer)." - }, - "nucleic_acid_source": "single cell", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869", - "ontology_label": "polyA RNA" - }, - "library_construction_method": { - "text": "Smart-seq2", - "ontology": "EFO:0008931", - "ontology_label": "Smart-seq2" - }, - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "provenance": { - "document_id": "60085aee-e5a6-40ac-bda1-855c052550b5", - "submission_date": "2019-04-17T16:52:10.952Z", - "update_date": "2019-04-17T16:52:16.679Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/10.0.0/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "P-GSE93593-4", - "protocol_name": "single cell sequencing protocol", - "protocol_description": "We used 1 ng of cDNA to generate RNA-Seq libraries using the Nextera XT library prep system (Illumina). We carried out sequencing of human cortical cells the on Illumina HiSeq using 50 base paired-end reads" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565", - "ontology_label": "Illumina HiSeq 2500" - }, - "paired_end": true, - "method": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441", - "ontology_label": "full length single cell RNA sequencing" - }, - "provenance": { - "document_id": "9ccabcf3-7203-4f07-837f-6dde903d4cec", - "submission_date": "2019-04-17T16:52:11.186Z", - "update_date": "2019-04-17T16:52:16.627Z" - } - }, - "differentiation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/1.3.3/differentiation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "P-GSE93593-1", - "protocol_name": "growth protocol", - "protocol_description": "We constructed an hESC line with Citrine (Cit) fused to the endogenous copy of the DCX gene in the H1 parent line (WAe001-A RRID:CVCL_9771) to allow us to profile neurons (Cit+) and progenitors (Cit\u2212) (Yao et al., 2017). hESCs were seeded for a 10-day cortical induction phase in NIMX media with SMAD inhibitors; reseeded for the ventralization phase at D10 in culture media containing Shh and purmorphamine, and finally at D24 for neural differentiation with neurogenic/neurotrophic factors BDNF, GDNF, NT3, and cAMP. The protocol was ended at D125." - }, - "differentiation_method": "cell suspension", - "provenance": { - "document_id": "348b04e9-d131-4d45-b198-0c75300ee4a3", - "submission_date": "2019-04-17T16:52:10.815Z", - "update_date": "2019-04-17T16:52:16.700Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/6.0.0/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "P-GSE93593-2", - "protocol_name": "single cell isolation protocol", - "protocol_description": "To generate single cell suspensions, hESC-derived cultures were dissociated from plates using Accutase (ThermoFisher) at 37C. Light trituration using a P1000 pipette was done every 5 min until nearly all clumps had been dissociated (up to 1 h). Cell suspension was washed and filtered through a 40 um cell strainer. Cells were washed in PBS with 1% FBS and stained with 0.5-1 ug/mL DAPI. Single-cell suspensions were loaded onto a FACSAria II SORP (Becton Dickinson) and sorted directly into PCR strip tubes or plates held in chilled aluminium blocks. Doublets and dead cells were excluded based on forward scatter, side scatter and DAPI fluorescence. Sorting was done using the 130 um nozzle with the sort mode set to single cell. Accuracy of single-cell sorts was confirmed by sorting DAPI-stained fixed cells onto a dry well of a 96-well plate and analyzing by fluorescence microscopy." - }, - "method": { - "text": "enzymatic dissociation", - "ontology": "EFO:0009128", - "ontology_label": "enzymatic dissociation" - }, - "provenance": { - "document_id": "31b89ceb-0625-4f88-9623-85a18bbb84ee", - "submission_date": "2019-04-17T16:52:10.865Z", - "update_date": "2019-04-17T16:52:16.668Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.9/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "FACS_enrichment_protocol", - "protocol_name": "FACS enrichment for single, live cells.", - "protocol_description": "Single-cell suspensions were loaded onto a FACSAria II SORP (Becton Dickinson) and sorted directly into PCR strip tubes or plates held in chilled aluminum blocks. Doublets and dead cells were excluded based on forward scatter, side scatter and DAPI fluorescence. Sorting was done using the 130 \u03bcm nozzle with the sort mode set to single cell. Accuracy of single-cell sorts was confirmed by sorting DAPI-stained fixed cells onto a dry well of a 96-well plate and analyzing by fluorescence microscopy." - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "DAPI", - "provenance": { - "document_id": "958d38c4-fd0a-4352-9b1d-d95e28e2085e", - "submission_date": "2019-04-17T16:52:10.900Z", - "update_date": "2019-04-17T16:52:16.605Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "D54Dn15E01" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", - "submission_date": "2019-04-17T16:54:54.638Z", - "update_date": "2019-04-17T17:02:01.452Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_601" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "2fbc1012-55ae-4fde-9069-fbf5376ca535", - "submission_date": "2019-04-17T16:53:46.016Z", - "update_date": "2019-04-17T17:00:21.013Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_4" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "466050f5-213c-4554-939e-4bb8298130dd", - "submission_date": "2019-04-17T16:53:30.594Z", - "update_date": "2019-04-17T16:59:59.704Z" - } - }, - "process_3.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "4276c1dd-50aa-4ffa-a618-dee757bff479", - "submission_date": "2019-04-17T16:53:30.570Z", - "update_date": "2019-04-17T16:59:59.680Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.5/links", - "schema_type": "link_bundle", - "schema_version": "1.1.5", - "links": [ - { - "process": "3d88118e-44df-4c1a-a364-bf92ff2ca0e6", - "inputs": [ - "e4c205cd-746f-4665-8c29-149c6e109e9d" - ], - "input_type": "biomaterial", - "outputs": [ - "a31d51c9-7354-4c8c-91e6-a9d2a2e10616", - "a2db643f-decd-426d-94db-13c3279ea80a" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "60085aee-e5a6-40ac-bda1-855c052550b5" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "9ccabcf3-7203-4f07-837f-6dde903d4cec" - } - ] - }, - { - "process": "2fbc1012-55ae-4fde-9069-fbf5376ca535", - "inputs": [ - "961092cd-dcff-4b59-a0d2-ceeef0aece74" - ], - "input_type": "biomaterial", - "outputs": [ - "e4c205cd-746f-4665-8c29-149c6e109e9d" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "differentiation_protocol", - "protocol_id": "348b04e9-d131-4d45-b198-0c75300ee4a3" - }, - { - "protocol_type": "dissociation_protocol", - "protocol_id": "31b89ceb-0625-4f88-9623-85a18bbb84ee" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "958d38c4-fd0a-4352-9b1d-d95e28e2085e" - } - ] - }, - { - "process": "466050f5-213c-4554-939e-4bb8298130dd", - "inputs": [ - "a72a2ac2-c91b-406a-968c-28c8e15a2eaf" - ], - "input_type": "biomaterial", - "outputs": [ - "961092cd-dcff-4b59-a0d2-ceeef0aece74" - ], - "output_type": "biomaterial", - "protocols": [] - }, - { - "process": "4276c1dd-50aa-4ffa-a618-dee757bff479", - "inputs": [ - "6c6973d5-9b4a-426d-9d88-825b464500f8" - ], - "input_type": "biomaterial", - "outputs": [ - "a72a2ac2-c91b-406a-968c-28c8e15a2eaf" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - } -} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e.2019-02-02T065454.662896Z.json b/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e.2019-02-02T065454.662896Z.json new file mode 100644 index 000000000..b1eeeff62 --- /dev/null +++ b/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e.2019-02-02T065454.662896Z.json @@ -0,0 +1,2704 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "a3819d97", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "9eb9b583cc0632a1c3bb8361cec98265", + "sha1": "32466a72fafb78ddb4b0dc460ccb9f34f671f642", + "sha256": "d55ea6bdacfa2fa1048fbdc84a180744e5ddd953ccb15fbcc5aa5a342f6645bf", + "size": 1071, + "uuid": "9ea49dd1-7511-48f8-be12-237e3d0690c0", + "version": "2019-01-23T110124.376000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "395b270f", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "9ce845764eade1bba05960e960702af4", + "sha1": "165fcda6a5633c42c9501c687c71aacfdcabd20e", + "sha256": "0d708f8d888e952a2ce0a7f1b08c83e2b4614a8712c792fb2a7f53d9fa52ca96", + "size": 1137, + "uuid": "e7049663-aa57-4001-8bb4-870e341b4f0b", + "version": "2019-01-23T105557.143000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "c72cf496", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "7c211658b06ab28a84fb002c343fefb0", + "sha1": "40d7d6817fe781b0bd0d7443a43890d120c83e3e", + "sha256": "0a8c089566f7416e06465a1f11a819c7a6b1af85ce6306fcae70712366314d00", + "size": 1051, + "uuid": "a879fffa-3b98-4204-ae5a-603180007ca0", + "version": "2019-01-23T104040.695000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "bc395265", + "indexed": true, + "name": "analysis_file_0.json", + "s3_etag": "52496571a574b30bd7bd87139c38891c", + "sha1": "8c35a49b5873ef29fee2037e38871f09a321654d", + "sha256": "48d46c5d1c970fef0da0db25b570e3e0bf61f6adf3f37b6339f21469d79aced8", + "size": 459, + "uuid": "b91aca7b-e71b-4014-ab09-5d87e52bc305", + "version": "2019-02-02T064943.861000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b2177c37", + "indexed": true, + "name": "analysis_file_1.json", + "s3_etag": "c25537e11b224072d5715789b641aaaf", + "sha1": "77d3839cfd011df3c32b33c618a077bdb6698f4d", + "sha256": "ba8af5feaa7df65888217075a28ca8ae2fb0c461884e702e372fdb3828e8b992", + "size": 453, + "uuid": "34e92010-0e2d-49af-b4b7-bed7a2c9e490", + "version": "2019-02-02T064937.893000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f1394c2a", + "indexed": true, + "name": "analysis_file_2.json", + "s3_etag": "c0a50c85be4703b87dc27f1371181357", + "sha1": "90e53ac2b72fc81209f1dbe3d0c46a49219f8735", + "sha256": "b68ae96e3a720bfdba71f582bf97ed1a7234002cd0e3246a089e51c339ce27e0", + "size": 458, + "uuid": "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", + "version": "2019-02-02T064940.900000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "38b1a4e6", + "indexed": true, + "name": "analysis_file_3.json", + "s3_etag": "1138a7d15193df533a90bd5deea240b8", + "sha1": "ad91b6433f58af4394f5f6426fed043d1f2cf70b", + "sha256": "fbca67752a46a05c9ae6089bc2e353be21fde20869d2b1bc39911120d5a96c82", + "size": 462, + "uuid": "ed37a61e-4449-4bce-a774-7cbd732781c8", + "version": "2019-02-02T064940.853000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "03b2e611", + "indexed": true, + "name": "analysis_file_4.json", + "s3_etag": "70f98fc26dd58f48d674b54e31d517d2", + "sha1": "8dc4af5f6df1e99ead04a86b4e0775aa4a633b4e", + "sha256": "92569f3b3515572e01f0910de734e30f8cb55b2ca889dc5df3b7c5325f98397e", + "size": 445, + "uuid": "b70e4907-383c-4466-a244-3e7ce9890dae", + "version": "2019-02-02T064943.860000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4fdadc86", + "indexed": true, + "name": "analysis_file_5.json", + "s3_etag": "f48d69f901e4260fc02541c84102c023", + "sha1": "118fa8e480fb6a308ef60b2d2daeeee9fd4adabb", + "sha256": "f63ef428ee00e02a616b0afd64176652f8a8a2ff9a4d3b72999b9ecedce17c3b", + "size": 434, + "uuid": "7ee496ab-286c-4962-919a-70244090e315", + "version": "2019-02-02T064953.070000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "76a1daf4", + "indexed": true, + "name": "analysis_file_6.json", + "s3_etag": "5dedb94f6133e591bdcf521db62f7eef", + "sha1": "4756e99410180394cb06c4f337d375d4d32c3b18", + "sha256": "a8dd1e31b002e28c5cd1afeea3fe1dc01e57cf0ed03ceb68112623ec2b637f33", + "size": 455, + "uuid": "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", + "version": "2019-02-02T064953.044000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3abc51c0", + "indexed": true, + "name": "analysis_file_7.json", + "s3_etag": "e182f0bd3f5c4e9a0563278f9a8b31d5", + "sha1": "660370e293005962950d8b839e02d9e080c30afb", + "sha256": "ef9582c1ceac7d6735a8da56ea328bce6797353046d23e223b9389e74acd79ab", + "size": 465, + "uuid": "b11e96c4-2472-4317-b45b-5bc1c9b55704", + "version": "2019-02-02T064955.885000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0ff3f1ab", + "indexed": true, + "name": "analysis_file_8.json", + "s3_etag": "4bf4ca2e240bcd5091468dc23d69ce22", + "sha1": "91a48830166d9f518de9a0e82a14918ffdded0b0", + "sha256": "6c2d9f34ed55c50d095386527f6b4bb71cda7a1e40dc178fd127fa30e255c3d2", + "size": 452, + "uuid": "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", + "version": "2019-02-02T064955.882000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "037756ba", + "indexed": true, + "name": "analysis_file_9.json", + "s3_etag": "84c2ad5a6dc914645dbd264ccb9f4ee1", + "sha1": "79a5de0d9e96d3a63c2ffbf6956c5ee829c8a59d", + "sha256": "e1b165d5a8b52036cb78409747ae15194da5cfac0959fc4035a35d062edf6a82", + "size": 438, + "uuid": "6804b943-fda7-4e8f-bfba-23e368843e63", + "version": "2019-02-02T064958.883000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cf5bbfc5", + "indexed": true, + "name": "analysis_file_10.json", + "s3_etag": "4d6da02ada316c4e11945d31476e7914", + "sha1": "74db46f550327773995c4c3aed6732a2543458f3", + "sha256": "3c0bd41c8fa7e902d9e97ff8d0860617ae9ee6b8e46eb574368833a5d11353fd", + "size": 457, + "uuid": "aeb5aebe-9e45-4c9d-931a-883f8fa71225", + "version": "2019-02-02T064958.860000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4b441c95", + "indexed": true, + "name": "analysis_file_11.json", + "s3_etag": "365981c99107dc8319fc1abb9d97d0d2", + "sha1": "2febd634c0a7a49436840eee717f83acce06814e", + "sha256": "d44d55c19b88d32809c86e8faf4f7e5399a713cba8a727282d60247ed3117b66", + "size": 458, + "uuid": "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", + "version": "2019-02-02T065001.875000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "236f7a69", + "indexed": true, + "name": "analysis_file_12.json", + "s3_etag": "6f4b59049874ede9bf48f6504727a032", + "sha1": "c99b6560d13966841bf5f7f8908ede3f2c0e9392", + "sha256": "101aad3b3daf7d2d54d41b21930bd7e94edb22c8c30217e1b918651d7f5c696c", + "size": 433, + "uuid": "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", + "version": "2019-02-02T064934.958000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3e5260d4", + "indexed": true, + "name": "analysis_file_13.json", + "s3_etag": "364fdd97b9e6bb88f388fa9c58916d87", + "sha1": "49ce25a90f622416a014e310210f22fc028d8a08", + "sha256": "3783553d7130ed10ca185f7d19331482280c9058f60ccbd527a02bf9a29e851b", + "size": 437, + "uuid": "0aa4b2f3-b969-40d7-97f9-f33af0088915", + "version": "2019-02-02T064937.919000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cf24bab2", + "indexed": true, + "name": "analysis_file_14.json", + "s3_etag": "82de07ca68194dfbb797ff7f7fad97d0", + "sha1": "e3904d0496636de8657bd07c732f3a64fe8145e1", + "sha256": "6e8ff4592c76a2358592b7a5aa16a6f1da7b66824ab1b73db1a39f8cddc8403c", + "size": 435, + "uuid": "697a869d-079b-48d4-9a7d-c04cf05dd0a9", + "version": "2019-02-02T064946.903000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "af3a3c91", + "indexed": true, + "name": "analysis_file_15.json", + "s3_etag": "d68980db49a6ba21512783608c3b2dc0", + "sha1": "c0e2f3fe1cfa5a3fb8e97a20bc117660efd95353", + "sha256": "2a33e2ae55922c7cfda58f015e864c0891a6c6ed4a3ae905d32f6ec5bc2d4a02", + "size": 449, + "uuid": "6d928f58-2e83-46a0-84a2-d08744a42abd", + "version": "2019-02-02T064949.891000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4d09e274", + "indexed": true, + "name": "analysis_file_16.json", + "s3_etag": "8c9cf6529b0a9807206daeb9d9ebd072", + "sha1": "76334f81fc9f5c20bc3ce91eb1cfe814e9da135c", + "sha256": "4ae559a179948e068408fea724bf0a3a24b7e8853ae0e5cef4400c99898f6a66", + "size": 452, + "uuid": "cc958050-fd69-4919-8529-6f91552ce0ea", + "version": "2019-02-02T064953.098000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b82f0247", + "indexed": true, + "name": "analysis_file_17.json", + "s3_etag": "2f5b37d84ddb860a3118249f03dcd84a", + "sha1": "12c2bc992c13da21b69bfb1a75520399c7770fab", + "sha256": "da7bb8e6170b30da29dfce59c18aabc36a2677850dae7ec20b54b6260b8a29cf", + "size": 442, + "uuid": "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", + "version": "2019-02-02T065001.882000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6bf29ff1", + "indexed": true, + "name": "analysis_file_18.json", + "s3_etag": "8c40d296bfaca764290cbb3b904af5fc", + "sha1": "6567cf3eca5ef58155b7ad9e9d861668018d71a9", + "sha256": "0215e805d1e18ea9f8756b33333bc70d372d04d2a9c7664c55b44e93ef2cbb51", + "size": 443, + "uuid": "42fffad8-d47d-4da5-8318-45b0f5577c08", + "version": "2019-02-02T065004.892000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "12dae6b5", + "indexed": true, + "name": "analysis_file_19.json", + "s3_etag": "b98f30ab9af7b7ced9dd195156ef7c39", + "sha1": "6a0c2b6bce49e5c7432ae9402042f74596ebbf44", + "sha256": "e8115aa0951af7c98b6a60983a0f24373f9af0b03f26a4d949bab704a9a0e319", + "size": 451, + "uuid": "2842a995-c205-4d80-959f-fcb9ff8719ee", + "version": "2019-02-02T065004.900000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "350a731c", + "indexed": true, + "name": "analysis_file_20.json", + "s3_etag": "d2041a30b2688db4ce59d73f8c1f3a1c", + "sha1": "b741d010949d869aeea007a01ba3a1e0501736e3", + "sha256": "72e8920fae48546f62ea226afdacb7f7c10f8ae7e45b146e2154dcd0f3a07d6e", + "size": 445, + "uuid": "90d148ed-a6eb-44c3-a398-df29459943ff", + "version": "2019-02-02T065007.892000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0ed9b8bc", + "indexed": true, + "name": "analysis_file_21.json", + "s3_etag": "8039e1b5af75e2905a64f622746b5f33", + "sha1": "53e716cb052e11b6cda4fdff6689c13aecfb6b8d", + "sha256": "022e0691aa1856ae1847ffadb37a38ad469235d59b2a4da52dfbfc4e5abd08e5", + "size": 465, + "uuid": "269a143b-a2c2-40cd-9394-41a13321581d", + "version": "2019-02-02T065010.886000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "96a5433b", + "indexed": true, + "name": "analysis_file_22.json", + "s3_etag": "fa25ddbe4b2e6c93c8f8dea29c361e0d", + "sha1": "fede9a66cb12355935dad3db00bb5e8ad101f2f6", + "sha256": "a5a171b94db562ab0353f410141bedc0689e0ef9d23a9ace1b8e336344ea28d2", + "size": 461, + "uuid": "1dda8255-de1c-4bfa-aa79-dbc501d3a112", + "version": "2019-02-02T065010.905000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4f9f10b2", + "indexed": true, + "name": "analysis_file_23.json", + "s3_etag": "7b313a86018a8f1f6e7c993c0c72e53b", + "sha1": "5162419845e7fa35ef60423f7d62bf3f54b7ac96", + "sha256": "f6c90fa707ffc3542feefd9d94a88bbebeebcfa790f51a5683b3c4fc9e6bdbd9", + "size": 470, + "uuid": "d76f404c-d294-49f2-bfd5-d475e08fa783", + "version": "2019-02-02T065013.892000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "14340be8", + "indexed": true, + "name": "analysis_file_24.json", + "s3_etag": "5b43e9b27f75806e386a23b55d3e8b63", + "sha1": "866d9b961676a59cf3ffa9c3502600a1fc25dd41", + "sha256": "ea95c87ff0738970db41902cc309075e0f18877437f8515a7358b90cb73ecbee", + "size": 464, + "uuid": "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", + "version": "2019-02-02T065013.961000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "41e1342d", + "indexed": true, + "name": "analysis_file_25.json", + "s3_etag": "861a7fc48e68c9f390d5f350b2a29243", + "sha1": "9d251b8a608b49682f05e034aa95938b09c5af7f", + "sha256": "ed351ffc3a69e4b92fe9f6b5ab47bd0937ac0d8a9c14ad6038e8da788c0ebc93", + "size": 464, + "uuid": "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", + "version": "2019-02-02T065013.945000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ba033df6", + "indexed": true, + "name": "analysis_file_26.json", + "s3_etag": "1eb07bfe5ba35747be58eeac2691a119", + "sha1": "d4d467428994d09be1e47eac6c5edc12d799cd44", + "sha256": "a27f36585b981435d90d007a04fdf98c39acb7783b5e34e7a234cef182c629ea", + "size": 460, + "uuid": "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", + "version": "2019-02-02T065016.898000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9f6d143a", + "indexed": true, + "name": "analysis_file_27.json", + "s3_etag": "588bc7b16726f1527f03cc4f11918e63", + "sha1": "783a6a16ee541a5b7ca71f2e323881ed631d42b9", + "sha256": "6985ffc978e34a8b7684335617f48dbaf03316331fc85d4020e3bec3f0bc55b1", + "size": 469, + "uuid": "3fe1e9e8-1b0f-4683-a402-ae970b33f144", + "version": "2019-02-02T065016.905000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "385654c2", + "indexed": true, + "name": "analysis_file_28.json", + "s3_etag": "2fbfc5679ea7cb29d99c96da000f68ab", + "sha1": "5b783bec69e1f85b538f0a4968f77fe162c1373c", + "sha256": "530f2a84137d682ff4e5950935df8ec9f5c73cb22ea878115f4eabedebee9963", + "size": 463, + "uuid": "e53c14f5-1a4f-44d6-9773-53faac32233b", + "version": "2019-02-02T065019.912000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "11d0e3ab", + "indexed": true, + "name": "analysis_file_29.json", + "s3_etag": "6c9751b1c5ca8f1b09c27c0d1cd47877", + "sha1": "edac632f2b83832a8b94480616570122426f1c94", + "sha256": "d7771dd0d29d5e06d8e6821be50c0856a46b94a11b98b6edb3ed4f862a39e36e", + "size": 454, + "uuid": "7a26e63d-fcf2-419a-a945-bca9e539480f", + "version": "2019-02-02T065019.912000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8164e610", + "indexed": true, + "name": "analysis_file_30.json", + "s3_etag": "b5bf1408c9b8b3be5ea4ff6cc87bbb75", + "sha1": "dce9c8400e3249754ad6ff5a79dc4365e553085a", + "sha256": "c8e92cf9c5ee981c82e03d103b8ea890d15385c6d802ec28d79647b3708b41c8", + "size": 450, + "uuid": "644b261b-450e-453c-bb5e-0498a1cf5804", + "version": "2019-02-02T065022.891000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "59874ff8", + "indexed": true, + "name": "analysis_file_31.json", + "s3_etag": "cac647f16ea0183682639e9e452dacce", + "sha1": "8cdd89167973eb0bfba0426fa31959d4548582c0", + "sha256": "11b3d7fce0ae93efd90043e0f6ed26ec1b880811b874bd29a321d7bc56fe9a92", + "size": 451, + "uuid": "b367129a-e83f-4a2b-9278-b5f7930ad457", + "version": "2019-02-02T065022.873000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "fb34829f", + "indexed": true, + "name": "analysis_file_32.json", + "s3_etag": "95588969b428b662f817f3ebec62bfc5", + "sha1": "70211286bef32477fb13f286874fdb1cb6d36fcc", + "sha256": "0f3202e34e1d4e56bff744d82367f5ff9a724b6be80d8aeb06cdd061cf0b8f3b", + "size": 445, + "uuid": "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39", + "version": "2019-02-02T065025.954000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c8eb3f7e", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "b495ed7eee91479800dfe8a894529f3f", + "sha1": "4dca6690919161379ccdb6d5a83e38e89db5ac5c", + "sha256": "9697a197dde4edff941c224084b298d73c8f20d215a0113744c70459e19304c4", + "size": 513, + "uuid": "c15ee840-4702-45f7-bb19-693de19a742a", + "version": "2019-01-23T162056.497000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "dfef7c11", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "290ee5323b5f864f7dde26fe5f9b1ad0", + "sha1": "204ec93a54e6381374aece99975ea57dcabd70bf", + "sha256": "c9a66cdd9b01ec1c9a040d02a82a9d8247514611a68ac4fccf6233a14342c1ba", + "size": 513, + "uuid": "5f5d9c84-3565-4398-886c-2e50ad4c3964", + "version": "2019-01-23T162053.469000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "264ea6b9", + "indexed": true, + "name": "project_0.json", + "s3_etag": "8d25849d6e32f3d16cfd4fccf29cfa41", + "sha1": "2d85765711d8a891fb704b9942023a7c54fe827d", + "sha256": "8efcdde66c4328b4e69449cb24cfc0f5132558035293726b74936d1646e4478e", + "size": 9083, + "uuid": "aabbec1a-1215-43e1-8e42-6489af25c12c", + "version": "2019-01-23T104040.301000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "6c12ffc4", + "indexed": true, + "name": "analysis_protocol_0.json", + "s3_etag": "ed5b733af027e4fd5cca9353d86cfa70", + "sha1": "af7366a1d5c157518fe47ae574662f301ec732de", + "sha256": "6cbc322574bebcb7dc06b0ae040292159a00c91118a7c1397c8d53b9a0bddd83", + "size": 511, + "uuid": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7", + "version": "2019-02-02T064504.641000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "c2e6b11a", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "0f4ce0e27ac75f6d89bdd790ab775f0f", + "sha1": "6e8aa5763dfccc9d0f742c4142fc851831047a73", + "sha256": "99c7c45fd1e5ea8aaad83b8f5969e0ef12dfb39cb349ed9453a59fb4f509594e", + "size": 1245, + "uuid": "edda2708-1172-47f0-9c8b-b6771f463db1", + "version": "2019-01-23T103405.563000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "75172e85", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "f3e7227b51e943d1ba81d38b7e50303a", + "sha1": "c7dac303d1a7ba5ea392905cf97e205d18afc35e", + "sha256": "72151bc3cea8ae71445a1134ba2f5273677912ae91348acd0c7781cadb5b4fc4", + "size": 991, + "uuid": "46f58d61-c784-47fb-9c75-7af37871810e", + "version": "2019-01-23T103405.670000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "e4f889fb", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "111e188f00e3ec78d04b374d5a99e011", + "sha1": "91b86232e419129f7e176fb0b4f1a74f2f641e63", + "sha256": "b2f1665229a223822d4886c08ee66686e025066e3e8c606d5bce724e882b8fbc", + "size": 1216, + "uuid": "dcfe8429-af02-491e-96e9-4ac0569cd5d1", + "version": "2019-01-23T103405.632000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "9133cf8a", + "indexed": true, + "name": "enrichment_protocol_1.json", + "s3_etag": "544865c5779b1535bcd702078b64d7b6", + "sha1": "e8c66b59e6854422c9b81f3ba7d757355fdc8079", + "sha256": "91a8c4f046772d7e11b5a3e74e655c5a30581b62b2149f6d38d569973dfde8d9", + "size": 874, + "uuid": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253", + "version": "2019-01-23T103406.540000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "25cf44c5", + "indexed": true, + "name": "enrichment_protocol_2.json", + "s3_etag": "46e0c0bcefe50ddea008b3512fb6f4a2", + "sha1": "9853c55419e54a579269f39e0033f6a0f34b553f", + "sha256": "63fc6ba91d548a681ac1e961f6bafab2fa9ecc4aea2eccb89e0a31e1fae6fd8b", + "size": 830, + "uuid": "3d2707fa-83ad-472b-8282-7b6191f96bc2", + "version": "2019-01-23T103405.715000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "8240542c", + "indexed": true, + "name": "enrichment_protocol_3.json", + "s3_etag": "c0d8ecc3b6b771d7b1ca33952b4b26e7", + "sha1": "32a595dbf142548ab88c35203493abadbaaa89ad", + "sha256": "a84170550ce4f6e7ab2c79bad3b5f5da0aac27e53756e897e9eb170922349d90", + "size": 1014, + "uuid": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca", + "version": "2019-01-23T103405.783000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "21fee7d5", + "indexed": true, + "name": "collection_protocol_0.json", + "s3_etag": "d4330f0bb7d95cd8d2a444f0065fb36d", + "sha1": "ec3bf0b6f7511a0391007ce21c298838cf6408f4", + "sha256": "1bc702b9ab04ae501b9ff4a86044159954a66c5b60d2961624d8746a6e353dfd", + "size": 695, + "uuid": "477b201f-67f0-4f97-86d5-de32a7afc267", + "version": "2019-01-23T103405.575000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "d3312332", + "indexed": true, + "name": "analysis_process_0.json", + "s3_etag": "ea9dc38661a0466ba91b00c250428359", + "sha1": "9f274839fa5692ea948e0486d2af5f6b4c3ebcc5", + "sha256": "4fd5bf622aa251977a4f1c160dc26c0738cd84c35f43bc30d225cad8011b66cb", + "size": 21349, + "uuid": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", + "version": "2019-02-02T064504.794000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "b7a99f89", + "indexed": true, + "name": "process_0.json", + "s3_etag": "300d06178a3e001e8c20a047b272b8ed", + "sha1": "1df0c61ff540a492c40b80a1981837f84e7b8f72", + "sha256": "6598198ea82e34b5f17624000715e537b6137fa811f6af72dcb7c7771873ab9c", + "size": 448, + "uuid": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", + "version": "2019-01-23T111916.982000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "8039afe1", + "indexed": true, + "name": "process_1.json", + "s3_etag": "e0e61dc77c59e2b453cc9b5310678773", + "sha1": "59edde10823bf455894cc401ba3243167c898791", + "sha256": "1d3e16cd80c8ce5199e8cd1e70cfe49f81e91f0b771d538828a9fc7441a54d5c", + "size": 379, + "uuid": "e84cac5b-1467-4055-a029-48d67a5505d6", + "version": "2019-01-23T111057.210000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "74161a4b", + "indexed": true, + "name": "process_2.json", + "s3_etag": "3dfc9dafaf92ef792e3928b00bc9ada4", + "sha1": "1ae1be143104ef657e9e7ec42e0d21e0e91013d8", + "sha256": "61db95bde13c920f5ff735d5c6c1e90f6bd376dadeb51ae11c03ef8b0ab563a3", + "size": 377, + "uuid": "832b39e3-ebba-4686-a724-52babb96056f", + "version": "2019-01-23T110544.002000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "290d41eb", + "indexed": true, + "name": "links.json", + "s3_etag": "0d6d83e234cf9a884a96403bbfc56d67", + "sha1": "3fee9537a1391d0ba0060e53d42e0a2186f6344d", + "sha256": "792cc5459ebf45cef1ef1fb5f62f44fbd79e6f73281d1f4622bb2b1b35abcca3", + "size": 7448, + "uuid": "700f28bc-8f57-4276-9fce-6b7774bf5210", + "version": "2019-02-02T065434.323908Z" + }, + { + "content-type": "text/plain; dcp-type=data", + "crc32c": "82ad16f4", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt", + "s3_etag": "fc1f00e6397632b1ffadc1d64098ad60", + "sha1": "38bf9ba607420a68f610fc98d6feb934098538e9", + "sha256": "c70b134256247d3390920199f55b6482e6fd093a17232b2a50e94165eba01441", + "size": 2714, + "uuid": "17da1d2f-8da0-4b77-ae99-257399a88f75", + "version": "2019-02-02T065434.636713Z" + }, + { + "content-type": "text/plain; dcp-type=data", + "crc32c": "cc0c1472", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt", + "s3_etag": "c83b2f6f3a9f8dba2f4e65b8fc6050e7", + "sha1": "df8795b1fef98ff636bd99a00417f41d626e157c", + "sha256": "69aad2469e18731b0e5b20c0af6fde89c3234aa3e9c2154a9578cffbaa7a0b1d", + "size": 11322, + "uuid": "435d0d63-4d37-47b6-85f4-09d66d5ac287", + "version": "2019-02-02T065434.962270Z" + }, + { + "content-type": "text/plain; dcp-type=data", + "crc32c": "d7ba769f", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt", + "s3_etag": "c349ab1622333e96a23e01ef20413f01", + "sha1": "87c99d534d93d5e00e303d7ffe682f4eb0960db1", + "sha256": "4b3fcb075200d267daacc8fc669dc4cf3afd50b9fcbe2c5d2e45a0c2fe320604", + "size": 3207, + "uuid": "c113f2cd-2f99-4db0-bdeb-f9d91ffb0bc6", + "version": "2019-02-02T065435.361197Z" + }, + { + "content-type": "text/plain; dcp-type=data", + "crc32c": "d5ece005", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt", + "s3_etag": "f205b9d30fb741ad9d61a2829cd04944", + "sha1": "deba445fa19e291bc2892caabdde94bfb4fed562", + "sha256": "80924dbbb9cb751c2de39bfcc1753d71ed525f147c47f16b45b1268f6bf9d84f", + "size": 1282, + "uuid": "4a020965-bc91-4c57-b277-86a161712dab", + "version": "2019-02-02T065435.661240Z" + }, + { + "content-type": "text/plain; dcp-type=data", + "crc32c": "3abf5428", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt", + "s3_etag": "d2d0c27a7db0897a18310242fa230fa3", + "sha1": "b1e9c0a4048903b4396a7a26c3282e0a6d823b54", + "sha256": "f0486dea7e64c2211a3ec7866bec3597829275ab77f6448be852a268c2869b3a", + "size": 3238, + "uuid": "614368df-6a91-41cd-9301-db259e303e38", + "version": "2019-02-02T065435.993593Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "7dc7d4d1", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv", + "s3_etag": "774fcabfad9067f60be364bca855f348", + "sha1": "30185e7092bd70d0415d23418ff9b29235483105", + "sha256": "951c31a3edd597d5d467cf695d74dc462c71eaa4a526987ecca96b2d0260cc3f", + "size": 8080, + "uuid": "78e49bf5-c92b-4663-bc12-6e838ad63040", + "version": "2019-02-02T065436.433736Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "65ded069", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv", + "s3_etag": "4ba621a399463d20987ee63db7951f08", + "sha1": "43eaa11ab0933eafc501fbe5ef953e0b5050909c", + "sha256": "90631bb7a429d94593795d11235fb21b6bb51e1f701ceaee98ff498dfa322193", + "size": 32302, + "uuid": "7a08e477-1b95-4667-a443-4257ff879e3a", + "version": "2019-02-02T065436.875303Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "202ef83a", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv", + "s3_etag": "81e3739416359684aa5395d556d66396", + "sha1": "c19c4c171e729d95641c33e746a102ad3200831f", + "sha256": "d6e968105c89f2aa69e8453111b1f5a2f99477203c1067fd79a43d583afb9708", + "size": 13102, + "uuid": "b263ebdf-6585-473a-a3eb-a19588b43e35", + "version": "2019-02-02T065437.247604Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "0e0c45c6", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv", + "s3_etag": "0c35947b7e49e3d13481a3dff35d4d69", + "sha1": "04797ec54ebdd12e545dae01e111b30d3e02760b", + "sha256": "b504b34d564eccfbf7cdbd401c8a32b92688c0067338b37e79bc53d978cea080", + "size": 486, + "uuid": "8fdc9b77-6b95-4149-91b6-1ed529eb75af", + "version": "2019-02-02T065437.646451Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "cd082d61", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv", + "s3_etag": "9b3a9b4731020def0434f01ab8fe2ad0", + "sha1": "35b199ffc788c97dfbd26fdda3a2b1fa4ba06268", + "sha256": "44660c52ac7c76df7dac98728936a7c95f69e0444263b8a85b12c7de1c17df76", + "size": 9075, + "uuid": "a08fbac2-47d0-426d-9b62-94f60792c554", + "version": "2019-02-02T065438.217456Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "4bb6bdc9", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv", + "s3_etag": "d0a5bec0bb91ccc17f5e344afca145e4", + "sha1": "a5a76fb326fbeae150f7f06ec98f99fbf232c904", + "sha256": "cf4deb16fb90ad4f62814f52929cabbcf030559ee1d7df0c30b34a77f2766290", + "size": 28752, + "uuid": "e274aff4-2348-4d25-a69f-aa5e30f50529", + "version": "2019-02-02T065438.572940Z" + }, + { + "content-type": "text/csv; dcp-type=data", + "crc32c": "99822758", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv", + "s3_etag": "d67ee0d3a4bc2c81373dbc668901f830", + "sha1": "364b21bbe2267dd859dc061d118ec324252b1fd5", + "sha256": "d596efc8207919d017bc8c935e1fee46b588938b5678da960595f3d312523264", + "size": 1894, + "uuid": "b426e03c-0f98-4b9e-838b-b6fe67e35a0a", + "version": "2019-02-02T065439.061311Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "d9e787ec", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam", + "s3_etag": "4d946798c0e62a4a9c82f8fddd0a385a", + "sha1": "e0e0577f8534c767702feb4492ea2592cc403edb", + "sha256": "d45f25d38c2506f4867c49869e610b37ce47a508d194fb923c350a6f39fac976", + "size": 35906509, + "uuid": "f467b2b5-d0d5-4c2c-a253-1f9f64629e3b", + "version": "2019-02-02T065439.579077Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "01716cae", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai", + "s3_etag": "f80304dbe6c2a8eb74e1c3232177396b", + "sha1": "030bc99c64f21915c9294d7b648c1a0360d39258", + "sha256": "997d2f8aa3871e63f3f6c6f8d27e57741433db6fedeb08375f092ec5998fddd8", + "size": 1835672, + "uuid": "70d8b64f-a333-4ac3-8b63-17ba0fb8ef64", + "version": "2019-02-02T065440.809043Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "c2d024b3", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam", + "s3_etag": "b07fa5f2d2ce1a088de1ab0a62b06200", + "sha1": "0ca398a8971ef854218ebd3e6cb95bb7cf004019", + "sha256": "a61415e45c58208d977185c528209be0b2c9d738fa7a6331f45d026c4aa26dbb", + "size": 36324944, + "uuid": "28d29046-bdb9-4b70-bb18-f4e8e577e26c", + "version": "2019-02-02T065441.191549Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "0d996a3f", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results", + "s3_etag": "60bee9ca3703d79fd356799aaeb8e9c7", + "sha1": "baf9b8d27b56525dfc579c545f2d17addf065170", + "sha256": "0c4920803f5ba726234b84c423af625330a8b773982a67e3d2a4676dbc4c8386", + "size": 7608598, + "uuid": "4bf077f4-ca44-48db-a1ec-fe8ee8a78ba6", + "version": "2019-02-02T065442.065089Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "c9e4f397", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results", + "s3_etag": "f4f372f63b6792d0ceedbfd24e598f36", + "sha1": "500321a1bcd226b21e905e04bb85b8830f21e4f7", + "sha256": "a776734581c06c3abba47d1c970e24fea4ae75bf6ee3c7f9c2d5025bf59fd831", + "size": 18886665, + "uuid": "ee682f7d-5153-4383-8820-7c382fea111a", + "version": "2019-02-02T065442.936752Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "f8813cc8", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs", + "s3_etag": "154c7026c73c9d1f3c36f5743dde7756", + "sha1": "b1e5bd4702e9c3c18f810160b5f09e55de714388", + "sha256": "655382d01214d1ac3a58deabea0463f58e1afead12cf581da5e447a4d77733da", + "size": 148, + "uuid": "1ac59e2e-ac4c-4bc0-a88a-fcfa8ff9e554", + "version": "2019-02-02T065443.721413Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "444a7707", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup", + "s3_etag": "e20297935e73dd0154104d4ea53040ab", + "sha1": "63b0fcd7748c79d0de97705fb1b8ed5fcc5ac788", + "sha256": "2383746e67b4bcc2762b3f100f06c3fa2d5f149ab5a8e5da5d33521464a01959", + "size": 24, + "uuid": "c736ed67-6c4e-4a9c-a4e0-42e1bb8e0fa7", + "version": "2019-02-02T065444.065526Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "f35d7e55", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray", + "s3_etag": "adf52f6446cf3395b891614c2cf2372a", + "sha1": "9fd2e280f325ed95273798729cf3129d5f31a55d", + "sha256": "2fa6969421abba6ad8f00f603ec90614fddf2fdea2fbe05def7e279ccc753b94", + "size": 311, + "uuid": "f1db2924-0210-4e97-9a24-302c61ad237f", + "version": "2019-02-02T065444.301965Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "067c801b", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0", + "s3_etag": "0f2eabc7960e1bf6985fa4c7a26d022c", + "sha1": "3f0b780c8a510d3863258e003a54b0c06901e7ee", + "sha256": "b0a1f538d7bd282b07f4b8d936fca4990a41efa3f196145e0b1394e83c66f86b", + "size": 146, + "uuid": "271f3b5a-549a-41dc-be0f-31b024f8be2b", + "version": "2019-02-02T065444.467750Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "88068bce", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray", + "s3_etag": "143c99e56f6dbf5df7db5f13b4bfcff4", + "sha1": "a7612dc1d58458f975ffd26d2bd8b5ce49a811b6", + "sha256": "95979e9877f4a2e5973967ed1e5cb4e3b894742696df8e4189f4fe3c42be6966", + "size": 337, + "uuid": "25122289-69e6-49ec-b2f7-34f8f0197fe1", + "version": "2019-02-02T065444.766955Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "5825e083", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0", + "s3_etag": "1b8f8382f047ed7e121020567f992bdb", + "sha1": "9eb85dfe145c3f226c454d6b2907a27c53ab0772", + "sha256": "a73160b367086d9b4a011b2431e53562488cd61ef022680902b2763fde90a04f", + "size": 620, + "uuid": "45cc3e84-7d4f-4fdc-b3f1-4fe5f3913c81", + "version": "2019-02-02T065444.968166Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "38a3821e", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray", + "s3_etag": "6cd55b5c19627b1221e44c0b623f6a7a", + "sha1": "379887b0c96e35f627437c9bd02884aee0a469ec", + "sha256": "1d678d0e30a79f5625ce9dcbfc0a16a755887c41c0c542896c9147c61d78dfc5", + "size": 315, + "uuid": "d8146b44-678e-4954-8a88-c796b21ff424", + "version": "2019-02-02T065445.333721Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "afce17ed", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0", + "s3_etag": "40a03beade9cbe20471da510719e87ee", + "sha1": "07067e1916a1f326c6039c1135cc365d8157e250", + "sha256": "109b07d4cac30dc70dbab56f630a100ba7edf46ced95eaaa60bbd1b642c8695e", + "size": 3920, + "uuid": "f4bb3e61-373c-4266-a55b-3c212a75d660", + "version": "2019-02-02T065445.564680Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "c6565f75", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray", + "s3_etag": "a191a4cbbc03d856923e37be13612e94", + "sha1": "967aa8a1960dd44731fc73e97bd31f9d31a1ac28", + "sha256": "bdfbef7a1f7947596fcc1e176471ce97e895f58970e8e2289d73343ccc60bc7e", + "size": 333, + "uuid": "9f9fd74e-59e3-4f7b-be1a-13ab4fef6bfd", + "version": "2019-02-02T065445.798613Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "c0b4fc1c", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0", + "s3_etag": "8e35dfc78f4530c7cc629e722e41c14a", + "sha1": "8f2698a020fa520b3619c7f24a016a0ebc7c52e8", + "sha256": "910c28ef76e19d3c845e7918df9fec4a45bf28aa349ad3b9d68bc765d7be5015", + "size": 104, + "uuid": "69635c16-9520-440e-a38e-3f618b1697d8", + "version": "2019-02-02T065446.025189Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "80af448b", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray", + "s3_etag": "d70cdb9540920623d2b47a915c218930", + "sha1": "34b30d940aedf75dd406119b8044ba1f0d718392", + "sha256": "ec2f2606d246f1ff4b76c00a5c38fc6298435762df413f88690e44abb5447075", + "size": 311, + "uuid": "e0130298-cda9-412e-9c80-aad41273e0aa", + "version": "2019-02-02T065446.267656Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "f282f971", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0", + "s3_etag": "a9f7d989dc368de1512249f67ae71b01", + "sha1": "823ae16a87d600986573fe05f5f03f30008c7fa3", + "sha256": "62248abc08d4717360bbcb7fea1aea23260ee6fa4c9bcdc207bffdcba17aedd2", + "size": 172, + "uuid": "1b685fee-669b-4f9d-b2d5-2f193e24fb29", + "version": "2019-02-02T065446.482201Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "b89e6723", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray", + "s3_etag": "1cc8c5a815470108493b451c5a974fd3", + "sha1": "b62a2d173d1b4fa4f35817a5eefa525a7b126691", + "sha256": "31f6f311ce1934669c993d3ae909f89084d605554312bc34262340e3f37005ca", + "size": 341, + "uuid": "247a7408-946c-4d2e-bbda-e79f27541347", + "version": "2019-02-02T065446.804119Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "38f2e38c", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0", + "s3_etag": "359eccbee3435e935ee6c9e106a07ca2", + "sha1": "3547f51280955e61de2cfac8a8fb0940cafe3ab5", + "sha256": "93bbe150426cc65d22c6185d6e63976cbdb7487585bdcb6ecf8b44a57fd39488", + "size": 45059, + "uuid": "133e7526-bc1e-4731-b304-942b2302b260", + "version": "2019-02-02T065447.022845Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "88035931", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray", + "s3_etag": "12f1697e02f5dc989975f3a4e2ac3f98", + "sha1": "fffcd7c2eda62aac81a0c656ae034a4271256cee", + "sha256": "fc15b29aeda7d465c6d39028fd015c7ec5e364129721154547d245107758cc4a", + "size": 319, + "uuid": "30d5a0b7-f83c-4834-a708-bfa5f33a1e79", + "version": "2019-02-02T065447.365605Z" + }, + { + "content-type": "application/octet-stream; dcp-type=data", + "crc32c": "d3733841", + "indexed": false, + "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0", + "s3_etag": "b1340be37e97bfa77eea653ed55df86e", + "sha1": "edd20a8ccf3894e957f42913a8afb8d438569e13", + "sha256": "6934073545ed7cdc70acc7ec765929125452b2753510fdcb682a19e8d8fde970", + "size": 192191, + "uuid": "e0c065fb-3297-44e8-ab6b-cb6aa461bedc", + "version": "2019-02-02T065447.635894Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "4df5f693", + "indexed": false, + "name": "ERR2462443_1.fastq.gz", + "s3_etag": "50ea47ab9850309a470ce78b38f77c9a", + "sha1": "88ade3d68a3a835bcd4d4a5434e7ca0f27da7cea", + "sha256": "a8ba89633116043dcc81c4e79bb8794e8fabb45107cb1ae6aac50b425ea9951c", + "size": 11869523, + "uuid": "e3a876c0-814d-48d0-ab33-5de0ca400125", + "version": "2019-02-01T115352.287395Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "aa8d705d", + "indexed": false, + "name": "ERR2462443_2.fastq.gz", + "s3_etag": "eef771438861eb1181c0a42e707ce313", + "sha1": "13d71b1e22c7f000d4e95109757386214078ab13", + "sha256": "af1307de700fc3aa828fc08c1a6b0ebe7df3f168878e42f8ee597ec61d7cee5d", + "size": 11778346, + "uuid": "54d7fff5-6a9e-44c9-b515-ea28a9b1940f", + "version": "2019-02-01T115352.858162Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.6.6/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "24088_4_92", + "biomaterial_name": "T cell from blood", + "biomaterial_description": "=", + "ncbi_taxon_id": [ + 9606 + ], + "insdc_biomaterial": "ERS2335002", + "biosd_biomaterial": "SAMEA1015535" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "selected_cell_type": [ + { + "text": "T cell", + "ontology": "CL:0000084", + "ontology_label": "T cell" + } + ], + "total_estimated_cells": 1, + "plate_based_sequencing": { + "plate_id": "not provided" + }, + "provenance": { + "document_id": "9ea49dd1-7511-48f8-be12-237e3d0690c0", + "submission_date": "2019-01-23T10:27:50.080Z", + "update_date": "2019-01-23T11:01:24.376Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.8/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "blood_from_donor_D4", + "biomaterial_name": "Peripheral blood sample 1", + "biomaterial_description": "Blood from early pregnancy (6- 14 weeks gestation)", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "blood", + "ontology": "UBERON:0000178", + "ontology_label": "blood" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "preservation_storage": { + "preservation_method": "fresh" + }, + "provenance": { + "document_id": "e7049663-aa57-4001-8bb4-870e341b4f0b", + "submission_date": "2019-01-23T10:25:32.280Z", + "update_date": "2019-01-23T10:55:57.143Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/biomaterial/12.0.5/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "D4", + "biomaterial_name": "Donor 4", + "biomaterial_description": "Donor 4, 6-14 weeks pregnant", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "is_living": "yes", + "sex": "female", + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461", + "ontology_label": "normal" + } + ], + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272", + "ontology_label": "adult" + }, + "provenance": { + "document_id": "a879fffa-3b98-4204-ae5a-603180007ca0", + "submission_date": "2019-01-23T10:25:32.001Z", + "update_date": "2019-01-23T10:40:40.695Z" + } + }, + "analysis_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt", + "file_format": "txt" + }, + "provenance": { + "document_id": "b91aca7b-e71b-4014-ab09-5d87e52bc305", + "submission_date": "2019-02-02T06:45:00.418Z", + "update_date": "2019-02-02T06:49:43.861Z" + } + }, + "analysis_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt", + "file_format": "txt" + }, + "provenance": { + "document_id": "34e92010-0e2d-49af-b4b7-bed7a2c9e490", + "submission_date": "2019-02-02T06:45:00.594Z", + "update_date": "2019-02-02T06:49:37.893Z" + } + }, + "analysis_file_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt", + "file_format": "txt" + }, + "provenance": { + "document_id": "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", + "submission_date": "2019-02-02T06:45:00.770Z", + "update_date": "2019-02-02T06:49:40.900Z" + } + }, + "analysis_file_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt", + "file_format": "txt" + }, + "provenance": { + "document_id": "ed37a61e-4449-4bce-a774-7cbd732781c8", + "submission_date": "2019-02-02T06:45:00.949Z", + "update_date": "2019-02-02T06:49:40.853Z" + } + }, + "analysis_file_4.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt", + "file_format": "txt" + }, + "provenance": { + "document_id": "b70e4907-383c-4466-a244-3e7ce9890dae", + "submission_date": "2019-02-02T06:45:01.127Z", + "update_date": "2019-02-02T06:49:43.860Z" + } + }, + "analysis_file_5.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "7ee496ab-286c-4962-919a-70244090e315", + "submission_date": "2019-02-02T06:45:01.306Z", + "update_date": "2019-02-02T06:49:53.070Z" + } + }, + "analysis_file_6.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", + "submission_date": "2019-02-02T06:45:01.483Z", + "update_date": "2019-02-02T06:49:53.044Z" + } + }, + "analysis_file_7.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "b11e96c4-2472-4317-b45b-5bc1c9b55704", + "submission_date": "2019-02-02T06:45:01.662Z", + "update_date": "2019-02-02T06:49:55.885Z" + } + }, + "analysis_file_8.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", + "submission_date": "2019-02-02T06:45:01.843Z", + "update_date": "2019-02-02T06:49:55.882Z" + } + }, + "analysis_file_9.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "6804b943-fda7-4e8f-bfba-23e368843e63", + "submission_date": "2019-02-02T06:45:02.034Z", + "update_date": "2019-02-02T06:49:58.883Z" + } + }, + "analysis_file_10.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "aeb5aebe-9e45-4c9d-931a-883f8fa71225", + "submission_date": "2019-02-02T06:45:02.212Z", + "update_date": "2019-02-02T06:49:58.860Z" + } + }, + "analysis_file_11.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv", + "file_format": "csv" + }, + "provenance": { + "document_id": "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", + "submission_date": "2019-02-02T06:45:02.394Z", + "update_date": "2019-02-02T06:50:01.875Z" + } + }, + "analysis_file_12.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam", + "file_format": "bam" + }, + "provenance": { + "document_id": "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", + "submission_date": "2019-02-02T06:45:02.573Z", + "update_date": "2019-02-02T06:49:34.958Z" + } + }, + "analysis_file_13.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai", + "file_format": "bai" + }, + "provenance": { + "document_id": "0aa4b2f3-b969-40d7-97f9-f33af0088915", + "submission_date": "2019-02-02T06:45:02.767Z", + "update_date": "2019-02-02T06:49:37.919Z" + } + }, + "analysis_file_14.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam", + "file_format": "bam" + }, + "provenance": { + "document_id": "697a869d-079b-48d4-9a7d-c04cf05dd0a9", + "submission_date": "2019-02-02T06:45:02.955Z", + "update_date": "2019-02-02T06:49:46.903Z" + } + }, + "analysis_file_15.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results", + "file_format": "results" + }, + "provenance": { + "document_id": "6d928f58-2e83-46a0-84a2-d08744a42abd", + "submission_date": "2019-02-02T06:45:03.146Z", + "update_date": "2019-02-02T06:49:49.891Z" + } + }, + "analysis_file_16.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results", + "file_format": "results" + }, + "provenance": { + "document_id": "cc958050-fd69-4919-8529-6f91552ce0ea", + "submission_date": "2019-02-02T06:45:03.325Z", + "update_date": "2019-02-02T06:49:53.098Z" + } + }, + "analysis_file_17.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs", + "file_format": "matrix" + }, + "provenance": { + "document_id": "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", + "submission_date": "2019-02-02T06:45:03.500Z", + "update_date": "2019-02-02T06:50:01.882Z" + } + }, + "analysis_file_18.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup", + "file_format": "unknown" + }, + "provenance": { + "document_id": "42fffad8-d47d-4da5-8318-45b0f5577c08", + "submission_date": "2019-02-02T06:45:03.681Z", + "update_date": "2019-02-02T06:50:04.892Z" + } + }, + "analysis_file_19.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "2842a995-c205-4d80-959f-fcb9ff8719ee", + "submission_date": "2019-02-02T06:45:03.862Z", + "update_date": "2019-02-02T06:50:04.900Z" + } + }, + "analysis_file_20.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "90d148ed-a6eb-44c3-a398-df29459943ff", + "submission_date": "2019-02-02T06:45:04.048Z", + "update_date": "2019-02-02T06:50:07.892Z" + } + }, + "analysis_file_21.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "269a143b-a2c2-40cd-9394-41a13321581d", + "submission_date": "2019-02-02T06:45:04.228Z", + "update_date": "2019-02-02T06:50:10.886Z" + } + }, + "analysis_file_22.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "1dda8255-de1c-4bfa-aa79-dbc501d3a112", + "submission_date": "2019-02-02T06:45:04.425Z", + "update_date": "2019-02-02T06:50:10.905Z" + } + }, + "analysis_file_23.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "d76f404c-d294-49f2-bfd5-d475e08fa783", + "submission_date": "2019-02-02T06:45:04.602Z", + "update_date": "2019-02-02T06:50:13.892Z" + } + }, + "analysis_file_24.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", + "submission_date": "2019-02-02T06:45:04.791Z", + "update_date": "2019-02-02T06:50:13.961Z" + } + }, + "analysis_file_25.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", + "submission_date": "2019-02-02T06:45:04.980Z", + "update_date": "2019-02-02T06:50:13.945Z" + } + }, + "analysis_file_26.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", + "submission_date": "2019-02-02T06:45:05.160Z", + "update_date": "2019-02-02T06:50:16.898Z" + } + }, + "analysis_file_27.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "3fe1e9e8-1b0f-4683-a402-ae970b33f144", + "submission_date": "2019-02-02T06:45:05.347Z", + "update_date": "2019-02-02T06:50:16.905Z" + } + }, + "analysis_file_28.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "e53c14f5-1a4f-44d6-9773-53faac32233b", + "submission_date": "2019-02-02T06:45:05.539Z", + "update_date": "2019-02-02T06:50:19.912Z" + } + }, + "analysis_file_29.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "7a26e63d-fcf2-419a-a945-bca9e539480f", + "submission_date": "2019-02-02T06:45:05.734Z", + "update_date": "2019-02-02T06:50:19.912Z" + } + }, + "analysis_file_30.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "644b261b-450e-453c-bb5e-0498a1cf5804", + "submission_date": "2019-02-02T06:45:05.915Z", + "update_date": "2019-02-02T06:50:22.891Z" + } + }, + "analysis_file_31.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray", + "file_format": "unknown" + }, + "provenance": { + "document_id": "b367129a-e83f-4a2b-9278-b5f7930ad457", + "submission_date": "2019-02-02T06:45:06.096Z", + "update_date": "2019-02-02T06:50:22.873Z" + } + }, + "analysis_file_32.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "schema_type": "file", + "file_core": { + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0", + "file_format": "unknown" + }, + "provenance": { + "document_id": "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39", + "submission_date": "2019-02-02T06:45:06.274Z", + "update_date": "2019-02-02T06:50:25.954Z" + } + }, + "sequence_file_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/7.0.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "ERR2462443_1.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "read_length": 75, + "insdc_run": [ + "ERR2462443" + ], + "provenance": { + "document_id": "c15ee840-4702-45f7-bb19-693de19a742a", + "submission_date": "2019-01-23T10:32:54.467Z", + "update_date": "2019-01-23T16:20:56.497Z" + } + }, + "sequence_file_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/file/7.0.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "ERR2462443_2.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read2", + "read_length": 75, + "insdc_run": [ + "ERR2462443" + ], + "provenance": { + "document_id": "5f5d9c84-3565-4398-886c-2e50ad4c3964", + "submission_date": "2019-01-23T10:32:54.477Z", + "update_date": "2019-01-23T16:20:53.469Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/project/9.0.8/project", + "schema_type": "project", + "project_core": { + "project_short_name": "Fetal/Maternal Interface", + "project_title": "Reconstructing the human first trimester fetal-maternal interface using single cell transcriptomics", + "project_description": "During early human pregnancy the uterine mucosa transforms into the decidua, into which the fetal placenta implants and where placental trophoblast cells intermingle and communicate with maternal cells. Trophoblast\u2013decidual interactions underlie common diseases of pregnancy, including pre-eclampsia and stillbirth. Here we profile the transcriptomes of about 70,000 single cells from first-trimester placentas with matched maternal blood and decidual cells. The cellular composition of human decidua reveals subsets of perivascular and stromal cells that are located in distinct decidual layers. There are three major subsets of decidual natural killer cells that have distinctive immunomodulatory and chemokine profiles. We develop a repository of ligand\u2013receptor complexes and a statistical tool to predict the cell-type specificity of cell\u2013cell communication via these molecular interactions. Our data identify many regulatory interactions that prevent harmful innate or adaptive immune responses in this environment. Our single-cell atlas of the maternal\u2013fetal interface reveals the cellular organization of the decidua and placenta, and the interactions that are critical for placentation and reproductive success." + }, + "insdc_project": "ERP107748", + "array_express_investigation": "E-MTAB-6678", + "insdc_study": "PRJEB25794", + "supplementary_links": [ + "https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6678/", + "https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6701/", + "https://www.ebi.ac.uk/ena/data/view/PRJEB25794", + "https://www.ebi.ac.uk/ena/data/view/PRJEB28266" + ], + "contributors": [ + { + "contact_name": "Johan,,Henriksson", + "email": "mahogny@areta.org", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "corresponding_contributor": false + }, + { + "contact_name": "Mirjana,,Efremova", + "email": "me5@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Roser,,Vento-Tormo", + "email": "rv4@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Muzlifah,,Haniffa", + "email": "m.a.haniffa@ncl.ac.uk", + "institution": "Newcastle University", + "laboratory": "Institute of Cellular Medicine", + "address": "Newcastle upon Tyne, NE2 4HH", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Ashley,,Moffett", + "email": "am485@cam.ac.uk", + "institution": "University of Cambridge", + "laboratory": "Centre for Trophoblast Research", + "address": "Cambridge, CB2 3EG", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Sarah,A,Teichmann", + "email": "st9@sanger.ac.uk", + "institution": "Wellcome Trust Sanger Institute", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "corresponding_contributor": true + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Zinaida, A, Perova", + "email": "zina@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0001-9913-3249", + "corresponding_contributor": false + }, + { + "contact_name": "Anja,,Fullgrabe", + "email": "anjaf@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "ArrayExpress ", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8674-0039", + "corresponding_contributor": false + } + ], + "funders": [ + { + "funder_name": "Swedish Research Council" + }, + { + "grant_id": "099175/Z/12/Z", + "funder_name": "Medical Research Council / Wellcome Trust" + }, + { + "grant_id": "WT107931/Z/15/Z", + "funder_name": "Wellcome Trust" + }, + { + "funder_name": "EMBO Long-Term Fellowship" + }, + { + "funder_name": "Human Frontier Science Program Long-Term Fellowship" + }, + { + "funder_name": "Royal Society Dorothy Hodgkin Fellowship" + }, + { + "funder_name": "The Lister Institute for Preventive Medicine" + }, + { + "funder_name": "National Institute for Health Research" + }, + { + "funder_name": "Newcastle Biomedical Research Centre" + }, + { + "grant_id": "ThDEFINE, ThSWITCH", + "funder_name": "ERC" + }, + { + "grant_id": "MRG-GRAMMAR no. 664918", + "funder_name": "EU FET-OPEN" + }, + { + "grant_id": "Investigator award", + "funder_name": "Wellcome Trust" + }, + { + "grant_id": "WT206194", + "funder_name": "Wellcome Sanger core funding" + } + ], + "publications": [ + { + "authors": [ + "Vento-Tormo R", + "Efremova M", + "Botting RA", + "Turco MY", + "Vento-Tormo M", + "Meyer KB", + "Park J", + "Stephenson E", + "Polanski K", + "Payne RP", + "Goncalves A", + "Zou A", + "Henriksson J", + "Wood L", + "Lisgo S", + "Filby A", + "Wright GJ", + "Stubbington MJ", + "Haniffa M", + "Moffett A", + "Teichmann SA" + ], + "publication_title": "Reconstructing the human first trimester fetal-maternal interface using single cell transcriptomics", + "doi": "10.1101/429589", + "publication_url": "https://www.biorxiv.org/content/early/2018/09/29/429589" + }, + { + "authors": [ + "Vento-Tormo R", + "Efremova M", + "Botting RA", + "Turco MY", + "Vento-Tormo M", + "Meyer KB", + "Park J", + "Stephenson E", + "Polanski K", + "Goncalves A", + "Gardner L", + "Holmqvist S", + "Henriksson J", + "Zou A", + "Sharkey A", + "Millar B", + "Innes B", + "Wood L", + "Wilbrey-Clark A", + "Payne RP", + "Ivarsson M", + "Lisgo S", + "Filby A", + "Rowitch D", + "Bulmer J", + "Wright GJ", + "Stubbington MJ", + "Haniffa M", + "Moffett A", + "Teichmann SA" + ], + "publication_title": "Single-cell reconstruction of the early maternal\u2013fetal interface in humans", + "doi": "10.1038/s41586-018-0698-6", + "pmid": 30429548, + "publication_url": "https://www.nature.com/articles/s41586-018-0698-6#Sec35" + } + ], + "provenance": { + "document_id": "aabbec1a-1215-43e1-8e42-6489af25c12c", + "submission_date": "2019-01-23T10:25:31.744Z", + "update_date": "2019-01-23T10:40:40.301Z" + } + }, + "analysis_protocol_0.json": { + "computational_method": "SmartSeq2SingleCell", + "describedBy": "https://schema.humancellatlas.org/type/protocol/analysis/8.0.3/analysis_protocol", + "protocol_core": { + "protocol_id": "smartseq2_v2.2.0" + }, + "protocol_type": { + "text": "analysis" + }, + "schema_type": "protocol", + "provenance": { + "document_id": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7", + "submission_date": "2019-02-02T06:44:58.913Z", + "update_date": "2019-02-02T06:45:04.641Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/4.4.4/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", + "protocol_description": "The SmartSeq2 protocol was performed on single-cells as described in 10.1038/nprot.2014.006, with some modifications.", + "publication_doi": "10.1038/nprot.2014.006" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931", + "ontology_label": "Smart-seq2" + }, + "nucleic_acid_source": "single cell", + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869", + "ontology_label": "polyA RNA" + }, + "library_construction_kit": { + "retail_name": "Nextera XT library preparation kit" + }, + "provenance": { + "document_id": "edda2708-1172-47f0-9c8b-b6771f463db1", + "submission_date": "2019-01-23T10:33:59.845Z", + "update_date": "2019-01-23T10:34:05.563Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/9.0.8/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "SmartSeq2 single cell sequencing", + "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2000 platform to obtain 75-bp paired-end reads." + }, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441", + "ontology_label": "full length single cell RNA sequencing" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2000", + "ontology": "EFO:0004203", + "ontology_label": "Illumina HiSeq 2000" + }, + "paired_end": true, + "provenance": { + "document_id": "46f58d61-c784-47fb-9c75-7af37871810e", + "submission_date": "2019-01-23T10:33:59.865Z", + "update_date": "2019-01-23T10:34:05.670Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_3", + "protocol_name": "Isolation (enrichment) of PBMCs from blood", + "protocol_description": "Blood samples were carefully layered onto a Ficoll-paque gradient and centrifuged at 2,000 rpm for 30 min without brakes. Peripheral blood mononuclear cells (PBMCs) from the interface between the plasma and the Ficoll\u2013 Paque gradient were collected and washed in ice-cold phosphate-buffered saline (PBS), followed by centrifugation at 2000r.p.m. for 5 min. The pellet was resuspended in 5ml of red blood cell lysis buffer (Invitrogen, 00-4300) for 10min.", + "publication_doi": "10.1038/s41586-018-0698-6" + }, + "enrichment_method": { + "text": "Ficoll-paque gradient", + "ontology": "EFO:0009112", + "ontology_label": "density gradient centrifugation" + }, + "provenance": { + "document_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1", + "submission_date": "2019-01-23T10:33:59.669Z", + "update_date": "2019-01-23T10:34:05.632Z" + } + }, + "enrichment_protocol_1.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_10", + "protocol_name": "FACS sorting to enrich for live cells (DAPI+)", + "protocol_description": "Cells were stained for DAPI and only viable (DAPI+) cells were sorted. ", + "publication_doi": "10.1038/s41586-018-0698-6" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "DAPI+", + "provenance": { + "document_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253", + "submission_date": "2019-01-23T10:33:59.759Z", + "update_date": "2019-01-23T10:34:06.540Z" + } + }, + "enrichment_protocol_2.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_11", + "protocol_name": "FACS sorting to deplete B cells", + "protocol_description": "FACS was used with CD19- and CD20-", + "publication_doi": "10.1038/s41586-018-0698-6" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "CD19- CD20-", + "provenance": { + "document_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2", + "submission_date": "2019-01-23T10:33:59.768Z", + "update_date": "2019-01-23T10:34:05.715Z" + } + }, + "enrichment_protocol_3.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_5", + "protocol_name": "FACS sorting to enrich for T cells for SS2", + "protocol_description": "FACS was used with gates CD45+HLADR\u2212CD56\u2212CD3+CD4+CD8\u2212; CD45+HLA-DR\u2212CD56\u2212CD3+CD8+; CD45+HLA-DR\u2212CD56\u2212CD3+CD4\u2212CD8\u2212", + "publication_doi": "10.1038/s41586-018-0698-6" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "CD45+ HLA-DR\u2212 CD56\u2212 CD3+ CD4+ CD8\u2212 CD8+ CD4\u2212", + "provenance": { + "document_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca", + "submission_date": "2019-01-23T10:33:59.686Z", + "update_date": "2019-01-23T10:34:05.783Z" + } + }, + "collection_protocol_0.json": { + "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/8.2.10/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "blood_draw_1", + "protocol_name": "blood draw", + "protocol_description": "blood draw", + "publication_doi": "10.1038/s41586-018-0698-6" + }, + "collection_method": { + "text": "blood draw", + "ontology": "EFO:0009121", + "ontology_label": "blood draw" + }, + "provenance": { + "document_id": "477b201f-67f0-4f97-86d5-de32a7afc267", + "submission_date": "2019-01-23T10:33:59.629Z", + "update_date": "2019-01-23T10:34:05.575Z" + } + }, + "analysis_process_0.json": { + "analysis_run_type": "run", + "describedBy": "https://schema.humancellatlas.org/type/process/analysis/8.0.3/analysis_process", + "input_bundles": [ + "8324dd3f-ddaf-42aa-9b3f-aef342229028" + ], + "inputs": [ + { + "parameter_name": "fastq1", + "parameter_value": "gs://org-hca-dss-checkout-prod/bundles/8324dd3f-ddaf-42aa-9b3f-aef342229028.2019-02-01T115354.796712Z/ERR2462443_1.fastq.gz" + }, + { + "parameter_name": "fastq2", + "parameter_value": "gs://org-hca-dss-checkout-prod/bundles/8324dd3f-ddaf-42aa-9b3f-aef342229028.2019-02-01T115354.796712Z/ERR2462443_2.fastq.gz" + }, + { + "parameter_name": "sample_name", + "parameter_value": "9ea49dd1-7511-48f8-be12-237e3d0690c0" + }, + { + "parameter_name": "output_name", + "parameter_value": "9ea49dd1-7511-48f8-be12-237e3d0690c0" + }, + { + "parameter_name": "gtf_file", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode.v27.primary_assembly.annotation.gtf" + }, + { + "parameter_name": "genome_ref_fasta", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/GRCh38.primary_assembly.genome.fa" + }, + { + "parameter_name": "rrna_intervals", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode.v27.rRNA.interval_list" + }, + { + "parameter_name": "gene_ref_flat", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/GRCh38_gencode.v27.refFlat.txt" + }, + { + "parameter_name": "hisat2_ref_index", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/HISAT2/genome_snp_tran.tar.gz" + }, + { + "parameter_name": "hisat2_ref_trans_name", + "parameter_value": "gencode_v27_trans_rsem" + }, + { + "parameter_name": "rsem_ref_index", + "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode_v27_primary.tar" + }, + { + "parameter_name": "hisat2_ref_name", + "parameter_value": "genome_snp_tran" + }, + { + "parameter_name": "hisat2_ref_trans_name", + "parameter_value": "gencode_v27_trans_rsem" + }, + { + "parameter_name": "stranded", + "parameter_value": "NONE" + } + ], + "outputs": [ + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "txt", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "txt", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "txt", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "txt", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "txt", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "csv", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "bam", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "bai", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "bam", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "results", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "results", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "matrix", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray" + }, + "schema_type": "file" + }, + { + "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", + "file_core": { + "file_format": "unknown", + "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0" + }, + "schema_type": "file" + } + ], + "process_core": { + "process_id": "1a5b6337-c719-4dc7-9014-e7cb7f739e22" + }, + "process_type": { + "text": "analysis" + }, + "reference_bundle": "bf51d668-3e14-4843-9bc7-5d676fdf0e01", + "schema_type": "process", + "tasks": [ + { + "cpus": 2, + "disk_size": "local-disk 11 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectDuplicationMetrics/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectDuplicationMetrics/stdout", + "memory": "7.5 GB", + "start_time": "2019-02-02T06:17:07.504Z", + "stop_time": "2019-02-02T06:20:06.008Z", + "task_name": "CollectDuplicationMetrics", + "zone": "us-central1-b" + }, + { + "cpus": 1, + "disk_size": "local-disk 14 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectMultipleMetrics/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectMultipleMetrics/stdout", + "memory": "7.5 GB", + "start_time": "2019-02-02T06:17:07.504Z", + "stop_time": "2019-02-02T06:26:15.019Z", + "task_name": "CollectMultipleMetrics", + "zone": "us-central1-b" + }, + { + "cpus": 1, + "disk_size": "local-disk 11 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectRnaMetrics/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectRnaMetrics/stdout", + "memory": "3.5 GB", + "start_time": "2019-02-02T06:17:07.504Z", + "stop_time": "2019-02-02T06:30:57.010Z", + "task_name": "CollectRnaMetrics", + "zone": "us-central1-b" + }, + { + "cpus": 1, + "disk_size": "local-disk 20 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-sctools:v0.3.0", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-GroupQCOutputs/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-GroupQCOutputs/stdout", + "memory": "2 GB", + "start_time": "2019-02-02T06:30:58.954Z", + "stop_time": "2019-02-02T06:36:21.014Z", + "task_name": "GroupQCOutputs", + "zone": "us-central1-b" + }, + { + "cpus": 4, + "disk_size": "local-disk 23 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-hisat2:v0.2.2-2-2.1.0", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2PairedEnd/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2PairedEnd/stdout", + "memory": "15 GB", + "start_time": "2019-02-02T06:09:49.934Z", + "stop_time": "2019-02-02T06:17:06.009Z", + "task_name": "HISAT2PairedEnd", + "zone": "us-central1-b" + }, + { + "cpus": 4, + "disk_size": "local-disk 14 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-hisat2:v0.2.2-2-2.1.0", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2Transcriptome/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2Transcriptome/stdout", + "memory": "15 GB", + "start_time": "2019-02-02T06:09:49.935Z", + "stop_time": "2019-02-02T06:13:12.013Z", + "task_name": "HISAT2Transcriptome", + "zone": "us-central1-b" + }, + { + "cpus": 4, + "disk_size": "local-disk 22 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-rsem:v0.2.2-1.3.0", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-RSEMExpression/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-RSEMExpression/stdout", + "memory": "3.5 GB", + "start_time": "2019-02-02T06:13:13.934Z", + "stop_time": "2019-02-02T06:18:24.008Z", + "task_name": "RSEMExpression", + "zone": "us-central1-b" + }, + { + "cpus": 4, + "disk_size": "local-disk 100 HDD", + "docker_image": "quay.io/humancellatlas/secondary-analysis-python3-scientific:0.1.7", + "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-SmartSeq2ZarrConversion/stderr", + "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-SmartSeq2ZarrConversion/stdout", + "memory": "16 GB", + "start_time": "2019-02-02T06:36:22.504Z", + "stop_time": "2019-02-02T06:39:18.012Z", + "task_name": "SmartSeq2ZarrConversion", + "zone": "us-central1-b" + } + ], + "timestamp_start_utc": "2019-02-02T06:09:46.854Z", + "timestamp_stop_utc": "2019-02-02T06:39:21.010Z", + "provenance": { + "document_id": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", + "submission_date": "2019-02-02T06:44:59.796Z", + "update_date": "2019-02-02T06:45:04.794Z" + } + }, + "process_0.json": { + "insdc_experiment": { + "insdc_experiment": "ERX2481489" + }, + "process_core": { + "process_id": "24088_4_92" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", + "provenance": { + "document_id": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", + "submission_date": "2019-01-23T10:40:00.000Z", + "update_date": "2019-01-23T11:19:16.982Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_5845" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", + "provenance": { + "document_id": "e84cac5b-1467-4055-a029-48d67a5505d6", + "submission_date": "2019-01-23T10:36:29.102Z", + "update_date": "2019-01-23T11:10:57.210Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_21" + }, + "schema_type": "process", + "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", + "provenance": { + "document_id": "832b39e3-ebba-4686-a724-52babb96056f", + "submission_date": "2019-01-23T10:34:00.619Z", + "update_date": "2019-01-23T11:05:44.002Z" + } + }, + "links.json": { + "describedBy": "https://schema.humancellatlas.org/system/1.1.4/links", + "schema_type": "link_bundle", + "schema_version": "1.1.4", + "links": [ + { + "process": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", + "inputs": [ + "c15ee840-4702-45f7-bb19-693de19a742a", + "5f5d9c84-3565-4398-886c-2e50ad4c3964" + ], + "input_type": "file", + "outputs": [ + "b91aca7b-e71b-4014-ab09-5d87e52bc305", + "34e92010-0e2d-49af-b4b7-bed7a2c9e490", + "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", + "ed37a61e-4449-4bce-a774-7cbd732781c8", + "b70e4907-383c-4466-a244-3e7ce9890dae", + "7ee496ab-286c-4962-919a-70244090e315", + "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", + "b11e96c4-2472-4317-b45b-5bc1c9b55704", + "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", + "6804b943-fda7-4e8f-bfba-23e368843e63", + "aeb5aebe-9e45-4c9d-931a-883f8fa71225", + "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", + "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", + "0aa4b2f3-b969-40d7-97f9-f33af0088915", + "697a869d-079b-48d4-9a7d-c04cf05dd0a9", + "6d928f58-2e83-46a0-84a2-d08744a42abd", + "cc958050-fd69-4919-8529-6f91552ce0ea", + "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", + "42fffad8-d47d-4da5-8318-45b0f5577c08", + "2842a995-c205-4d80-959f-fcb9ff8719ee", + "90d148ed-a6eb-44c3-a398-df29459943ff", + "269a143b-a2c2-40cd-9394-41a13321581d", + "1dda8255-de1c-4bfa-aa79-dbc501d3a112", + "d76f404c-d294-49f2-bfd5-d475e08fa783", + "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", + "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", + "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", + "3fe1e9e8-1b0f-4683-a402-ae970b33f144", + "e53c14f5-1a4f-44d6-9773-53faac32233b", + "7a26e63d-fcf2-419a-a945-bca9e539480f", + "644b261b-450e-453c-bb5e-0498a1cf5804", + "b367129a-e83f-4a2b-9278-b5f7930ad457", + "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "analysis_protocol", + "protocol_id": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7" + } + ] + }, + { + "process": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", + "inputs": [ + "9ea49dd1-7511-48f8-be12-237e3d0690c0" + ], + "input_type": "biomaterial", + "outputs": [ + "c15ee840-4702-45f7-bb19-693de19a742a", + "5f5d9c84-3565-4398-886c-2e50ad4c3964" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "edda2708-1172-47f0-9c8b-b6771f463db1" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "46f58d61-c784-47fb-9c75-7af37871810e" + } + ] + }, + { + "process": "e84cac5b-1467-4055-a029-48d67a5505d6", + "inputs": [ + "e7049663-aa57-4001-8bb4-870e341b4f0b" + ], + "input_type": "biomaterial", + "outputs": [ + "9ea49dd1-7511-48f8-be12-237e3d0690c0" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "enrichment_protocol", + "protocol_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca" + } + ] + }, + { + "process": "832b39e3-ebba-4686-a724-52babb96056f", + "inputs": [ + "a879fffa-3b98-4204-ae5a-603180007ca0" + ], + "input_type": "biomaterial", + "outputs": [ + "e7049663-aa57-4001-8bb4-870e341b4f0b" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "477b201f-67f0-4f97-86d5-de32a7afc267" + } + ] + }, + { + "process": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", + "inputs": [ + "9ea49dd1-7511-48f8-be12-237e3d0690c0" + ], + "input_type": "biomaterial", + "outputs": [ + "c15ee840-4702-45f7-bb19-693de19a742a", + "5f5d9c84-3565-4398-886c-2e50ad4c3964" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "edda2708-1172-47f0-9c8b-b6771f463db1" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "46f58d61-c784-47fb-9c75-7af37871810e" + } + ] + }, + { + "process": "e84cac5b-1467-4055-a029-48d67a5505d6", + "inputs": [ + "e7049663-aa57-4001-8bb4-870e341b4f0b" + ], + "input_type": "biomaterial", + "outputs": [ + "9ea49dd1-7511-48f8-be12-237e3d0690c0" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "enrichment_protocol", + "protocol_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca" + } + ] + }, + { + "process": "832b39e3-ebba-4686-a724-52babb96056f", + "inputs": [ + "a879fffa-3b98-4204-ae5a-603180007ca0" + ], + "input_type": "biomaterial", + "outputs": [ + "e7049663-aa57-4001-8bb4-870e341b4f0b" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "477b201f-67f0-4f97-86d5-de32a7afc267" + } + ] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/manifest.json b/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/manifest.json deleted file mode 100644 index 53e464737..000000000 --- a/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/manifest.json +++ /dev/null @@ -1,1046 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "a3819d97", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "9eb9b583cc0632a1c3bb8361cec98265", - "sha1": "32466a72fafb78ddb4b0dc460ccb9f34f671f642", - "sha256": "d55ea6bdacfa2fa1048fbdc84a180744e5ddd953ccb15fbcc5aa5a342f6645bf", - "size": 1071, - "uuid": "9ea49dd1-7511-48f8-be12-237e3d0690c0", - "version": "2019-01-23T110124.376000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "395b270f", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "9ce845764eade1bba05960e960702af4", - "sha1": "165fcda6a5633c42c9501c687c71aacfdcabd20e", - "sha256": "0d708f8d888e952a2ce0a7f1b08c83e2b4614a8712c792fb2a7f53d9fa52ca96", - "size": 1137, - "uuid": "e7049663-aa57-4001-8bb4-870e341b4f0b", - "version": "2019-01-23T105557.143000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "c72cf496", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "7c211658b06ab28a84fb002c343fefb0", - "sha1": "40d7d6817fe781b0bd0d7443a43890d120c83e3e", - "sha256": "0a8c089566f7416e06465a1f11a819c7a6b1af85ce6306fcae70712366314d00", - "size": 1051, - "uuid": "a879fffa-3b98-4204-ae5a-603180007ca0", - "version": "2019-01-23T104040.695000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "bc395265", - "indexed": true, - "name": "analysis_file_0.json", - "s3_etag": "52496571a574b30bd7bd87139c38891c", - "sha1": "8c35a49b5873ef29fee2037e38871f09a321654d", - "sha256": "48d46c5d1c970fef0da0db25b570e3e0bf61f6adf3f37b6339f21469d79aced8", - "size": 459, - "uuid": "b91aca7b-e71b-4014-ab09-5d87e52bc305", - "version": "2019-02-02T064943.861000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b2177c37", - "indexed": true, - "name": "analysis_file_1.json", - "s3_etag": "c25537e11b224072d5715789b641aaaf", - "sha1": "77d3839cfd011df3c32b33c618a077bdb6698f4d", - "sha256": "ba8af5feaa7df65888217075a28ca8ae2fb0c461884e702e372fdb3828e8b992", - "size": 453, - "uuid": "34e92010-0e2d-49af-b4b7-bed7a2c9e490", - "version": "2019-02-02T064937.893000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f1394c2a", - "indexed": true, - "name": "analysis_file_2.json", - "s3_etag": "c0a50c85be4703b87dc27f1371181357", - "sha1": "90e53ac2b72fc81209f1dbe3d0c46a49219f8735", - "sha256": "b68ae96e3a720bfdba71f582bf97ed1a7234002cd0e3246a089e51c339ce27e0", - "size": 458, - "uuid": "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", - "version": "2019-02-02T064940.900000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "38b1a4e6", - "indexed": true, - "name": "analysis_file_3.json", - "s3_etag": "1138a7d15193df533a90bd5deea240b8", - "sha1": "ad91b6433f58af4394f5f6426fed043d1f2cf70b", - "sha256": "fbca67752a46a05c9ae6089bc2e353be21fde20869d2b1bc39911120d5a96c82", - "size": 462, - "uuid": "ed37a61e-4449-4bce-a774-7cbd732781c8", - "version": "2019-02-02T064940.853000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "03b2e611", - "indexed": true, - "name": "analysis_file_4.json", - "s3_etag": "70f98fc26dd58f48d674b54e31d517d2", - "sha1": "8dc4af5f6df1e99ead04a86b4e0775aa4a633b4e", - "sha256": "92569f3b3515572e01f0910de734e30f8cb55b2ca889dc5df3b7c5325f98397e", - "size": 445, - "uuid": "b70e4907-383c-4466-a244-3e7ce9890dae", - "version": "2019-02-02T064943.860000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4fdadc86", - "indexed": true, - "name": "analysis_file_5.json", - "s3_etag": "f48d69f901e4260fc02541c84102c023", - "sha1": "118fa8e480fb6a308ef60b2d2daeeee9fd4adabb", - "sha256": "f63ef428ee00e02a616b0afd64176652f8a8a2ff9a4d3b72999b9ecedce17c3b", - "size": 434, - "uuid": "7ee496ab-286c-4962-919a-70244090e315", - "version": "2019-02-02T064953.070000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "76a1daf4", - "indexed": true, - "name": "analysis_file_6.json", - "s3_etag": "5dedb94f6133e591bdcf521db62f7eef", - "sha1": "4756e99410180394cb06c4f337d375d4d32c3b18", - "sha256": "a8dd1e31b002e28c5cd1afeea3fe1dc01e57cf0ed03ceb68112623ec2b637f33", - "size": 455, - "uuid": "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", - "version": "2019-02-02T064953.044000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3abc51c0", - "indexed": true, - "name": "analysis_file_7.json", - "s3_etag": "e182f0bd3f5c4e9a0563278f9a8b31d5", - "sha1": "660370e293005962950d8b839e02d9e080c30afb", - "sha256": "ef9582c1ceac7d6735a8da56ea328bce6797353046d23e223b9389e74acd79ab", - "size": 465, - "uuid": "b11e96c4-2472-4317-b45b-5bc1c9b55704", - "version": "2019-02-02T064955.885000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0ff3f1ab", - "indexed": true, - "name": "analysis_file_8.json", - "s3_etag": "4bf4ca2e240bcd5091468dc23d69ce22", - "sha1": "91a48830166d9f518de9a0e82a14918ffdded0b0", - "sha256": "6c2d9f34ed55c50d095386527f6b4bb71cda7a1e40dc178fd127fa30e255c3d2", - "size": 452, - "uuid": "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", - "version": "2019-02-02T064955.882000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "037756ba", - "indexed": true, - "name": "analysis_file_9.json", - "s3_etag": "84c2ad5a6dc914645dbd264ccb9f4ee1", - "sha1": "79a5de0d9e96d3a63c2ffbf6956c5ee829c8a59d", - "sha256": "e1b165d5a8b52036cb78409747ae15194da5cfac0959fc4035a35d062edf6a82", - "size": 438, - "uuid": "6804b943-fda7-4e8f-bfba-23e368843e63", - "version": "2019-02-02T064958.883000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cf5bbfc5", - "indexed": true, - "name": "analysis_file_10.json", - "s3_etag": "4d6da02ada316c4e11945d31476e7914", - "sha1": "74db46f550327773995c4c3aed6732a2543458f3", - "sha256": "3c0bd41c8fa7e902d9e97ff8d0860617ae9ee6b8e46eb574368833a5d11353fd", - "size": 457, - "uuid": "aeb5aebe-9e45-4c9d-931a-883f8fa71225", - "version": "2019-02-02T064958.860000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4b441c95", - "indexed": true, - "name": "analysis_file_11.json", - "s3_etag": "365981c99107dc8319fc1abb9d97d0d2", - "sha1": "2febd634c0a7a49436840eee717f83acce06814e", - "sha256": "d44d55c19b88d32809c86e8faf4f7e5399a713cba8a727282d60247ed3117b66", - "size": 458, - "uuid": "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", - "version": "2019-02-02T065001.875000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "236f7a69", - "indexed": true, - "name": "analysis_file_12.json", - "s3_etag": "6f4b59049874ede9bf48f6504727a032", - "sha1": "c99b6560d13966841bf5f7f8908ede3f2c0e9392", - "sha256": "101aad3b3daf7d2d54d41b21930bd7e94edb22c8c30217e1b918651d7f5c696c", - "size": 433, - "uuid": "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", - "version": "2019-02-02T064934.958000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3e5260d4", - "indexed": true, - "name": "analysis_file_13.json", - "s3_etag": "364fdd97b9e6bb88f388fa9c58916d87", - "sha1": "49ce25a90f622416a014e310210f22fc028d8a08", - "sha256": "3783553d7130ed10ca185f7d19331482280c9058f60ccbd527a02bf9a29e851b", - "size": 437, - "uuid": "0aa4b2f3-b969-40d7-97f9-f33af0088915", - "version": "2019-02-02T064937.919000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cf24bab2", - "indexed": true, - "name": "analysis_file_14.json", - "s3_etag": "82de07ca68194dfbb797ff7f7fad97d0", - "sha1": "e3904d0496636de8657bd07c732f3a64fe8145e1", - "sha256": "6e8ff4592c76a2358592b7a5aa16a6f1da7b66824ab1b73db1a39f8cddc8403c", - "size": 435, - "uuid": "697a869d-079b-48d4-9a7d-c04cf05dd0a9", - "version": "2019-02-02T064946.903000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "af3a3c91", - "indexed": true, - "name": "analysis_file_15.json", - "s3_etag": "d68980db49a6ba21512783608c3b2dc0", - "sha1": "c0e2f3fe1cfa5a3fb8e97a20bc117660efd95353", - "sha256": "2a33e2ae55922c7cfda58f015e864c0891a6c6ed4a3ae905d32f6ec5bc2d4a02", - "size": 449, - "uuid": "6d928f58-2e83-46a0-84a2-d08744a42abd", - "version": "2019-02-02T064949.891000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4d09e274", - "indexed": true, - "name": "analysis_file_16.json", - "s3_etag": "8c9cf6529b0a9807206daeb9d9ebd072", - "sha1": "76334f81fc9f5c20bc3ce91eb1cfe814e9da135c", - "sha256": "4ae559a179948e068408fea724bf0a3a24b7e8853ae0e5cef4400c99898f6a66", - "size": 452, - "uuid": "cc958050-fd69-4919-8529-6f91552ce0ea", - "version": "2019-02-02T064953.098000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b82f0247", - "indexed": true, - "name": "analysis_file_17.json", - "s3_etag": "2f5b37d84ddb860a3118249f03dcd84a", - "sha1": "12c2bc992c13da21b69bfb1a75520399c7770fab", - "sha256": "da7bb8e6170b30da29dfce59c18aabc36a2677850dae7ec20b54b6260b8a29cf", - "size": 442, - "uuid": "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", - "version": "2019-02-02T065001.882000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6bf29ff1", - "indexed": true, - "name": "analysis_file_18.json", - "s3_etag": "8c40d296bfaca764290cbb3b904af5fc", - "sha1": "6567cf3eca5ef58155b7ad9e9d861668018d71a9", - "sha256": "0215e805d1e18ea9f8756b33333bc70d372d04d2a9c7664c55b44e93ef2cbb51", - "size": 443, - "uuid": "42fffad8-d47d-4da5-8318-45b0f5577c08", - "version": "2019-02-02T065004.892000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "12dae6b5", - "indexed": true, - "name": "analysis_file_19.json", - "s3_etag": "b98f30ab9af7b7ced9dd195156ef7c39", - "sha1": "6a0c2b6bce49e5c7432ae9402042f74596ebbf44", - "sha256": "e8115aa0951af7c98b6a60983a0f24373f9af0b03f26a4d949bab704a9a0e319", - "size": 451, - "uuid": "2842a995-c205-4d80-959f-fcb9ff8719ee", - "version": "2019-02-02T065004.900000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "350a731c", - "indexed": true, - "name": "analysis_file_20.json", - "s3_etag": "d2041a30b2688db4ce59d73f8c1f3a1c", - "sha1": "b741d010949d869aeea007a01ba3a1e0501736e3", - "sha256": "72e8920fae48546f62ea226afdacb7f7c10f8ae7e45b146e2154dcd0f3a07d6e", - "size": 445, - "uuid": "90d148ed-a6eb-44c3-a398-df29459943ff", - "version": "2019-02-02T065007.892000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0ed9b8bc", - "indexed": true, - "name": "analysis_file_21.json", - "s3_etag": "8039e1b5af75e2905a64f622746b5f33", - "sha1": "53e716cb052e11b6cda4fdff6689c13aecfb6b8d", - "sha256": "022e0691aa1856ae1847ffadb37a38ad469235d59b2a4da52dfbfc4e5abd08e5", - "size": 465, - "uuid": "269a143b-a2c2-40cd-9394-41a13321581d", - "version": "2019-02-02T065010.886000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "96a5433b", - "indexed": true, - "name": "analysis_file_22.json", - "s3_etag": "fa25ddbe4b2e6c93c8f8dea29c361e0d", - "sha1": "fede9a66cb12355935dad3db00bb5e8ad101f2f6", - "sha256": "a5a171b94db562ab0353f410141bedc0689e0ef9d23a9ace1b8e336344ea28d2", - "size": 461, - "uuid": "1dda8255-de1c-4bfa-aa79-dbc501d3a112", - "version": "2019-02-02T065010.905000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4f9f10b2", - "indexed": true, - "name": "analysis_file_23.json", - "s3_etag": "7b313a86018a8f1f6e7c993c0c72e53b", - "sha1": "5162419845e7fa35ef60423f7d62bf3f54b7ac96", - "sha256": "f6c90fa707ffc3542feefd9d94a88bbebeebcfa790f51a5683b3c4fc9e6bdbd9", - "size": 470, - "uuid": "d76f404c-d294-49f2-bfd5-d475e08fa783", - "version": "2019-02-02T065013.892000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "14340be8", - "indexed": true, - "name": "analysis_file_24.json", - "s3_etag": "5b43e9b27f75806e386a23b55d3e8b63", - "sha1": "866d9b961676a59cf3ffa9c3502600a1fc25dd41", - "sha256": "ea95c87ff0738970db41902cc309075e0f18877437f8515a7358b90cb73ecbee", - "size": 464, - "uuid": "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", - "version": "2019-02-02T065013.961000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "41e1342d", - "indexed": true, - "name": "analysis_file_25.json", - "s3_etag": "861a7fc48e68c9f390d5f350b2a29243", - "sha1": "9d251b8a608b49682f05e034aa95938b09c5af7f", - "sha256": "ed351ffc3a69e4b92fe9f6b5ab47bd0937ac0d8a9c14ad6038e8da788c0ebc93", - "size": 464, - "uuid": "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", - "version": "2019-02-02T065013.945000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ba033df6", - "indexed": true, - "name": "analysis_file_26.json", - "s3_etag": "1eb07bfe5ba35747be58eeac2691a119", - "sha1": "d4d467428994d09be1e47eac6c5edc12d799cd44", - "sha256": "a27f36585b981435d90d007a04fdf98c39acb7783b5e34e7a234cef182c629ea", - "size": 460, - "uuid": "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", - "version": "2019-02-02T065016.898000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9f6d143a", - "indexed": true, - "name": "analysis_file_27.json", - "s3_etag": "588bc7b16726f1527f03cc4f11918e63", - "sha1": "783a6a16ee541a5b7ca71f2e323881ed631d42b9", - "sha256": "6985ffc978e34a8b7684335617f48dbaf03316331fc85d4020e3bec3f0bc55b1", - "size": 469, - "uuid": "3fe1e9e8-1b0f-4683-a402-ae970b33f144", - "version": "2019-02-02T065016.905000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "385654c2", - "indexed": true, - "name": "analysis_file_28.json", - "s3_etag": "2fbfc5679ea7cb29d99c96da000f68ab", - "sha1": "5b783bec69e1f85b538f0a4968f77fe162c1373c", - "sha256": "530f2a84137d682ff4e5950935df8ec9f5c73cb22ea878115f4eabedebee9963", - "size": 463, - "uuid": "e53c14f5-1a4f-44d6-9773-53faac32233b", - "version": "2019-02-02T065019.912000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "11d0e3ab", - "indexed": true, - "name": "analysis_file_29.json", - "s3_etag": "6c9751b1c5ca8f1b09c27c0d1cd47877", - "sha1": "edac632f2b83832a8b94480616570122426f1c94", - "sha256": "d7771dd0d29d5e06d8e6821be50c0856a46b94a11b98b6edb3ed4f862a39e36e", - "size": 454, - "uuid": "7a26e63d-fcf2-419a-a945-bca9e539480f", - "version": "2019-02-02T065019.912000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8164e610", - "indexed": true, - "name": "analysis_file_30.json", - "s3_etag": "b5bf1408c9b8b3be5ea4ff6cc87bbb75", - "sha1": "dce9c8400e3249754ad6ff5a79dc4365e553085a", - "sha256": "c8e92cf9c5ee981c82e03d103b8ea890d15385c6d802ec28d79647b3708b41c8", - "size": 450, - "uuid": "644b261b-450e-453c-bb5e-0498a1cf5804", - "version": "2019-02-02T065022.891000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "59874ff8", - "indexed": true, - "name": "analysis_file_31.json", - "s3_etag": "cac647f16ea0183682639e9e452dacce", - "sha1": "8cdd89167973eb0bfba0426fa31959d4548582c0", - "sha256": "11b3d7fce0ae93efd90043e0f6ed26ec1b880811b874bd29a321d7bc56fe9a92", - "size": 451, - "uuid": "b367129a-e83f-4a2b-9278-b5f7930ad457", - "version": "2019-02-02T065022.873000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "fb34829f", - "indexed": true, - "name": "analysis_file_32.json", - "s3_etag": "95588969b428b662f817f3ebec62bfc5", - "sha1": "70211286bef32477fb13f286874fdb1cb6d36fcc", - "sha256": "0f3202e34e1d4e56bff744d82367f5ff9a724b6be80d8aeb06cdd061cf0b8f3b", - "size": 445, - "uuid": "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39", - "version": "2019-02-02T065025.954000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c8eb3f7e", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "b495ed7eee91479800dfe8a894529f3f", - "sha1": "4dca6690919161379ccdb6d5a83e38e89db5ac5c", - "sha256": "9697a197dde4edff941c224084b298d73c8f20d215a0113744c70459e19304c4", - "size": 513, - "uuid": "c15ee840-4702-45f7-bb19-693de19a742a", - "version": "2019-01-23T162056.497000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "dfef7c11", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "290ee5323b5f864f7dde26fe5f9b1ad0", - "sha1": "204ec93a54e6381374aece99975ea57dcabd70bf", - "sha256": "c9a66cdd9b01ec1c9a040d02a82a9d8247514611a68ac4fccf6233a14342c1ba", - "size": 513, - "uuid": "5f5d9c84-3565-4398-886c-2e50ad4c3964", - "version": "2019-01-23T162053.469000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "264ea6b9", - "indexed": true, - "name": "project_0.json", - "s3_etag": "8d25849d6e32f3d16cfd4fccf29cfa41", - "sha1": "2d85765711d8a891fb704b9942023a7c54fe827d", - "sha256": "8efcdde66c4328b4e69449cb24cfc0f5132558035293726b74936d1646e4478e", - "size": 9083, - "uuid": "aabbec1a-1215-43e1-8e42-6489af25c12c", - "version": "2019-01-23T104040.301000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "6c12ffc4", - "indexed": true, - "name": "analysis_protocol_0.json", - "s3_etag": "ed5b733af027e4fd5cca9353d86cfa70", - "sha1": "af7366a1d5c157518fe47ae574662f301ec732de", - "sha256": "6cbc322574bebcb7dc06b0ae040292159a00c91118a7c1397c8d53b9a0bddd83", - "size": 511, - "uuid": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7", - "version": "2019-02-02T064504.641000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "c2e6b11a", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "0f4ce0e27ac75f6d89bdd790ab775f0f", - "sha1": "6e8aa5763dfccc9d0f742c4142fc851831047a73", - "sha256": "99c7c45fd1e5ea8aaad83b8f5969e0ef12dfb39cb349ed9453a59fb4f509594e", - "size": 1245, - "uuid": "edda2708-1172-47f0-9c8b-b6771f463db1", - "version": "2019-01-23T103405.563000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "75172e85", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "f3e7227b51e943d1ba81d38b7e50303a", - "sha1": "c7dac303d1a7ba5ea392905cf97e205d18afc35e", - "sha256": "72151bc3cea8ae71445a1134ba2f5273677912ae91348acd0c7781cadb5b4fc4", - "size": 991, - "uuid": "46f58d61-c784-47fb-9c75-7af37871810e", - "version": "2019-01-23T103405.670000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "e4f889fb", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "111e188f00e3ec78d04b374d5a99e011", - "sha1": "91b86232e419129f7e176fb0b4f1a74f2f641e63", - "sha256": "b2f1665229a223822d4886c08ee66686e025066e3e8c606d5bce724e882b8fbc", - "size": 1216, - "uuid": "dcfe8429-af02-491e-96e9-4ac0569cd5d1", - "version": "2019-01-23T103405.632000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "9133cf8a", - "indexed": true, - "name": "enrichment_protocol_1.json", - "s3_etag": "544865c5779b1535bcd702078b64d7b6", - "sha1": "e8c66b59e6854422c9b81f3ba7d757355fdc8079", - "sha256": "91a8c4f046772d7e11b5a3e74e655c5a30581b62b2149f6d38d569973dfde8d9", - "size": 874, - "uuid": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253", - "version": "2019-01-23T103406.540000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "25cf44c5", - "indexed": true, - "name": "enrichment_protocol_2.json", - "s3_etag": "46e0c0bcefe50ddea008b3512fb6f4a2", - "sha1": "9853c55419e54a579269f39e0033f6a0f34b553f", - "sha256": "63fc6ba91d548a681ac1e961f6bafab2fa9ecc4aea2eccb89e0a31e1fae6fd8b", - "size": 830, - "uuid": "3d2707fa-83ad-472b-8282-7b6191f96bc2", - "version": "2019-01-23T103405.715000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "8240542c", - "indexed": true, - "name": "enrichment_protocol_3.json", - "s3_etag": "c0d8ecc3b6b771d7b1ca33952b4b26e7", - "sha1": "32a595dbf142548ab88c35203493abadbaaa89ad", - "sha256": "a84170550ce4f6e7ab2c79bad3b5f5da0aac27e53756e897e9eb170922349d90", - "size": 1014, - "uuid": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca", - "version": "2019-01-23T103405.783000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "21fee7d5", - "indexed": true, - "name": "collection_protocol_0.json", - "s3_etag": "d4330f0bb7d95cd8d2a444f0065fb36d", - "sha1": "ec3bf0b6f7511a0391007ce21c298838cf6408f4", - "sha256": "1bc702b9ab04ae501b9ff4a86044159954a66c5b60d2961624d8746a6e353dfd", - "size": 695, - "uuid": "477b201f-67f0-4f97-86d5-de32a7afc267", - "version": "2019-01-23T103405.575000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "d3312332", - "indexed": true, - "name": "analysis_process_0.json", - "s3_etag": "ea9dc38661a0466ba91b00c250428359", - "sha1": "9f274839fa5692ea948e0486d2af5f6b4c3ebcc5", - "sha256": "4fd5bf622aa251977a4f1c160dc26c0738cd84c35f43bc30d225cad8011b66cb", - "size": 21349, - "uuid": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", - "version": "2019-02-02T064504.794000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "b7a99f89", - "indexed": true, - "name": "process_0.json", - "s3_etag": "300d06178a3e001e8c20a047b272b8ed", - "sha1": "1df0c61ff540a492c40b80a1981837f84e7b8f72", - "sha256": "6598198ea82e34b5f17624000715e537b6137fa811f6af72dcb7c7771873ab9c", - "size": 448, - "uuid": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", - "version": "2019-01-23T111916.982000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "8039afe1", - "indexed": true, - "name": "process_1.json", - "s3_etag": "e0e61dc77c59e2b453cc9b5310678773", - "sha1": "59edde10823bf455894cc401ba3243167c898791", - "sha256": "1d3e16cd80c8ce5199e8cd1e70cfe49f81e91f0b771d538828a9fc7441a54d5c", - "size": 379, - "uuid": "e84cac5b-1467-4055-a029-48d67a5505d6", - "version": "2019-01-23T111057.210000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "74161a4b", - "indexed": true, - "name": "process_2.json", - "s3_etag": "3dfc9dafaf92ef792e3928b00bc9ada4", - "sha1": "1ae1be143104ef657e9e7ec42e0d21e0e91013d8", - "sha256": "61db95bde13c920f5ff735d5c6c1e90f6bd376dadeb51ae11c03ef8b0ab563a3", - "size": 377, - "uuid": "832b39e3-ebba-4686-a724-52babb96056f", - "version": "2019-01-23T110544.002000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "290d41eb", - "indexed": true, - "name": "links.json", - "s3_etag": "0d6d83e234cf9a884a96403bbfc56d67", - "sha1": "3fee9537a1391d0ba0060e53d42e0a2186f6344d", - "sha256": "792cc5459ebf45cef1ef1fb5f62f44fbd79e6f73281d1f4622bb2b1b35abcca3", - "size": 7448, - "uuid": "700f28bc-8f57-4276-9fce-6b7774bf5210", - "version": "2019-02-02T065434.323908Z" - }, - { - "content-type": "text/plain; dcp-type=data", - "crc32c": "82ad16f4", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt", - "s3_etag": "fc1f00e6397632b1ffadc1d64098ad60", - "sha1": "38bf9ba607420a68f610fc98d6feb934098538e9", - "sha256": "c70b134256247d3390920199f55b6482e6fd093a17232b2a50e94165eba01441", - "size": 2714, - "uuid": "17da1d2f-8da0-4b77-ae99-257399a88f75", - "version": "2019-02-02T065434.636713Z" - }, - { - "content-type": "text/plain; dcp-type=data", - "crc32c": "cc0c1472", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt", - "s3_etag": "c83b2f6f3a9f8dba2f4e65b8fc6050e7", - "sha1": "df8795b1fef98ff636bd99a00417f41d626e157c", - "sha256": "69aad2469e18731b0e5b20c0af6fde89c3234aa3e9c2154a9578cffbaa7a0b1d", - "size": 11322, - "uuid": "435d0d63-4d37-47b6-85f4-09d66d5ac287", - "version": "2019-02-02T065434.962270Z" - }, - { - "content-type": "text/plain; dcp-type=data", - "crc32c": "d7ba769f", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt", - "s3_etag": "c349ab1622333e96a23e01ef20413f01", - "sha1": "87c99d534d93d5e00e303d7ffe682f4eb0960db1", - "sha256": "4b3fcb075200d267daacc8fc669dc4cf3afd50b9fcbe2c5d2e45a0c2fe320604", - "size": 3207, - "uuid": "c113f2cd-2f99-4db0-bdeb-f9d91ffb0bc6", - "version": "2019-02-02T065435.361197Z" - }, - { - "content-type": "text/plain; dcp-type=data", - "crc32c": "d5ece005", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt", - "s3_etag": "f205b9d30fb741ad9d61a2829cd04944", - "sha1": "deba445fa19e291bc2892caabdde94bfb4fed562", - "sha256": "80924dbbb9cb751c2de39bfcc1753d71ed525f147c47f16b45b1268f6bf9d84f", - "size": 1282, - "uuid": "4a020965-bc91-4c57-b277-86a161712dab", - "version": "2019-02-02T065435.661240Z" - }, - { - "content-type": "text/plain; dcp-type=data", - "crc32c": "3abf5428", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt", - "s3_etag": "d2d0c27a7db0897a18310242fa230fa3", - "sha1": "b1e9c0a4048903b4396a7a26c3282e0a6d823b54", - "sha256": "f0486dea7e64c2211a3ec7866bec3597829275ab77f6448be852a268c2869b3a", - "size": 3238, - "uuid": "614368df-6a91-41cd-9301-db259e303e38", - "version": "2019-02-02T065435.993593Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "7dc7d4d1", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv", - "s3_etag": "774fcabfad9067f60be364bca855f348", - "sha1": "30185e7092bd70d0415d23418ff9b29235483105", - "sha256": "951c31a3edd597d5d467cf695d74dc462c71eaa4a526987ecca96b2d0260cc3f", - "size": 8080, - "uuid": "78e49bf5-c92b-4663-bc12-6e838ad63040", - "version": "2019-02-02T065436.433736Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "65ded069", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv", - "s3_etag": "4ba621a399463d20987ee63db7951f08", - "sha1": "43eaa11ab0933eafc501fbe5ef953e0b5050909c", - "sha256": "90631bb7a429d94593795d11235fb21b6bb51e1f701ceaee98ff498dfa322193", - "size": 32302, - "uuid": "7a08e477-1b95-4667-a443-4257ff879e3a", - "version": "2019-02-02T065436.875303Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "202ef83a", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv", - "s3_etag": "81e3739416359684aa5395d556d66396", - "sha1": "c19c4c171e729d95641c33e746a102ad3200831f", - "sha256": "d6e968105c89f2aa69e8453111b1f5a2f99477203c1067fd79a43d583afb9708", - "size": 13102, - "uuid": "b263ebdf-6585-473a-a3eb-a19588b43e35", - "version": "2019-02-02T065437.247604Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "0e0c45c6", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv", - "s3_etag": "0c35947b7e49e3d13481a3dff35d4d69", - "sha1": "04797ec54ebdd12e545dae01e111b30d3e02760b", - "sha256": "b504b34d564eccfbf7cdbd401c8a32b92688c0067338b37e79bc53d978cea080", - "size": 486, - "uuid": "8fdc9b77-6b95-4149-91b6-1ed529eb75af", - "version": "2019-02-02T065437.646451Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "cd082d61", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv", - "s3_etag": "9b3a9b4731020def0434f01ab8fe2ad0", - "sha1": "35b199ffc788c97dfbd26fdda3a2b1fa4ba06268", - "sha256": "44660c52ac7c76df7dac98728936a7c95f69e0444263b8a85b12c7de1c17df76", - "size": 9075, - "uuid": "a08fbac2-47d0-426d-9b62-94f60792c554", - "version": "2019-02-02T065438.217456Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "4bb6bdc9", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv", - "s3_etag": "d0a5bec0bb91ccc17f5e344afca145e4", - "sha1": "a5a76fb326fbeae150f7f06ec98f99fbf232c904", - "sha256": "cf4deb16fb90ad4f62814f52929cabbcf030559ee1d7df0c30b34a77f2766290", - "size": 28752, - "uuid": "e274aff4-2348-4d25-a69f-aa5e30f50529", - "version": "2019-02-02T065438.572940Z" - }, - { - "content-type": "text/csv; dcp-type=data", - "crc32c": "99822758", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv", - "s3_etag": "d67ee0d3a4bc2c81373dbc668901f830", - "sha1": "364b21bbe2267dd859dc061d118ec324252b1fd5", - "sha256": "d596efc8207919d017bc8c935e1fee46b588938b5678da960595f3d312523264", - "size": 1894, - "uuid": "b426e03c-0f98-4b9e-838b-b6fe67e35a0a", - "version": "2019-02-02T065439.061311Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "d9e787ec", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam", - "s3_etag": "4d946798c0e62a4a9c82f8fddd0a385a", - "sha1": "e0e0577f8534c767702feb4492ea2592cc403edb", - "sha256": "d45f25d38c2506f4867c49869e610b37ce47a508d194fb923c350a6f39fac976", - "size": 35906509, - "uuid": "f467b2b5-d0d5-4c2c-a253-1f9f64629e3b", - "version": "2019-02-02T065439.579077Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "01716cae", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai", - "s3_etag": "f80304dbe6c2a8eb74e1c3232177396b", - "sha1": "030bc99c64f21915c9294d7b648c1a0360d39258", - "sha256": "997d2f8aa3871e63f3f6c6f8d27e57741433db6fedeb08375f092ec5998fddd8", - "size": 1835672, - "uuid": "70d8b64f-a333-4ac3-8b63-17ba0fb8ef64", - "version": "2019-02-02T065440.809043Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "c2d024b3", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam", - "s3_etag": "b07fa5f2d2ce1a088de1ab0a62b06200", - "sha1": "0ca398a8971ef854218ebd3e6cb95bb7cf004019", - "sha256": "a61415e45c58208d977185c528209be0b2c9d738fa7a6331f45d026c4aa26dbb", - "size": 36324944, - "uuid": "28d29046-bdb9-4b70-bb18-f4e8e577e26c", - "version": "2019-02-02T065441.191549Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "0d996a3f", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results", - "s3_etag": "60bee9ca3703d79fd356799aaeb8e9c7", - "sha1": "baf9b8d27b56525dfc579c545f2d17addf065170", - "sha256": "0c4920803f5ba726234b84c423af625330a8b773982a67e3d2a4676dbc4c8386", - "size": 7608598, - "uuid": "4bf077f4-ca44-48db-a1ec-fe8ee8a78ba6", - "version": "2019-02-02T065442.065089Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "c9e4f397", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results", - "s3_etag": "f4f372f63b6792d0ceedbfd24e598f36", - "sha1": "500321a1bcd226b21e905e04bb85b8830f21e4f7", - "sha256": "a776734581c06c3abba47d1c970e24fea4ae75bf6ee3c7f9c2d5025bf59fd831", - "size": 18886665, - "uuid": "ee682f7d-5153-4383-8820-7c382fea111a", - "version": "2019-02-02T065442.936752Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "f8813cc8", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs", - "s3_etag": "154c7026c73c9d1f3c36f5743dde7756", - "sha1": "b1e5bd4702e9c3c18f810160b5f09e55de714388", - "sha256": "655382d01214d1ac3a58deabea0463f58e1afead12cf581da5e447a4d77733da", - "size": 148, - "uuid": "1ac59e2e-ac4c-4bc0-a88a-fcfa8ff9e554", - "version": "2019-02-02T065443.721413Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "444a7707", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup", - "s3_etag": "e20297935e73dd0154104d4ea53040ab", - "sha1": "63b0fcd7748c79d0de97705fb1b8ed5fcc5ac788", - "sha256": "2383746e67b4bcc2762b3f100f06c3fa2d5f149ab5a8e5da5d33521464a01959", - "size": 24, - "uuid": "c736ed67-6c4e-4a9c-a4e0-42e1bb8e0fa7", - "version": "2019-02-02T065444.065526Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "f35d7e55", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray", - "s3_etag": "adf52f6446cf3395b891614c2cf2372a", - "sha1": "9fd2e280f325ed95273798729cf3129d5f31a55d", - "sha256": "2fa6969421abba6ad8f00f603ec90614fddf2fdea2fbe05def7e279ccc753b94", - "size": 311, - "uuid": "f1db2924-0210-4e97-9a24-302c61ad237f", - "version": "2019-02-02T065444.301965Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "067c801b", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0", - "s3_etag": "0f2eabc7960e1bf6985fa4c7a26d022c", - "sha1": "3f0b780c8a510d3863258e003a54b0c06901e7ee", - "sha256": "b0a1f538d7bd282b07f4b8d936fca4990a41efa3f196145e0b1394e83c66f86b", - "size": 146, - "uuid": "271f3b5a-549a-41dc-be0f-31b024f8be2b", - "version": "2019-02-02T065444.467750Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "88068bce", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray", - "s3_etag": "143c99e56f6dbf5df7db5f13b4bfcff4", - "sha1": "a7612dc1d58458f975ffd26d2bd8b5ce49a811b6", - "sha256": "95979e9877f4a2e5973967ed1e5cb4e3b894742696df8e4189f4fe3c42be6966", - "size": 337, - "uuid": "25122289-69e6-49ec-b2f7-34f8f0197fe1", - "version": "2019-02-02T065444.766955Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "5825e083", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0", - "s3_etag": "1b8f8382f047ed7e121020567f992bdb", - "sha1": "9eb85dfe145c3f226c454d6b2907a27c53ab0772", - "sha256": "a73160b367086d9b4a011b2431e53562488cd61ef022680902b2763fde90a04f", - "size": 620, - "uuid": "45cc3e84-7d4f-4fdc-b3f1-4fe5f3913c81", - "version": "2019-02-02T065444.968166Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "38a3821e", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray", - "s3_etag": "6cd55b5c19627b1221e44c0b623f6a7a", - "sha1": "379887b0c96e35f627437c9bd02884aee0a469ec", - "sha256": "1d678d0e30a79f5625ce9dcbfc0a16a755887c41c0c542896c9147c61d78dfc5", - "size": 315, - "uuid": "d8146b44-678e-4954-8a88-c796b21ff424", - "version": "2019-02-02T065445.333721Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "afce17ed", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0", - "s3_etag": "40a03beade9cbe20471da510719e87ee", - "sha1": "07067e1916a1f326c6039c1135cc365d8157e250", - "sha256": "109b07d4cac30dc70dbab56f630a100ba7edf46ced95eaaa60bbd1b642c8695e", - "size": 3920, - "uuid": "f4bb3e61-373c-4266-a55b-3c212a75d660", - "version": "2019-02-02T065445.564680Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "c6565f75", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray", - "s3_etag": "a191a4cbbc03d856923e37be13612e94", - "sha1": "967aa8a1960dd44731fc73e97bd31f9d31a1ac28", - "sha256": "bdfbef7a1f7947596fcc1e176471ce97e895f58970e8e2289d73343ccc60bc7e", - "size": 333, - "uuid": "9f9fd74e-59e3-4f7b-be1a-13ab4fef6bfd", - "version": "2019-02-02T065445.798613Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "c0b4fc1c", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0", - "s3_etag": "8e35dfc78f4530c7cc629e722e41c14a", - "sha1": "8f2698a020fa520b3619c7f24a016a0ebc7c52e8", - "sha256": "910c28ef76e19d3c845e7918df9fec4a45bf28aa349ad3b9d68bc765d7be5015", - "size": 104, - "uuid": "69635c16-9520-440e-a38e-3f618b1697d8", - "version": "2019-02-02T065446.025189Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "80af448b", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray", - "s3_etag": "d70cdb9540920623d2b47a915c218930", - "sha1": "34b30d940aedf75dd406119b8044ba1f0d718392", - "sha256": "ec2f2606d246f1ff4b76c00a5c38fc6298435762df413f88690e44abb5447075", - "size": 311, - "uuid": "e0130298-cda9-412e-9c80-aad41273e0aa", - "version": "2019-02-02T065446.267656Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "f282f971", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0", - "s3_etag": "a9f7d989dc368de1512249f67ae71b01", - "sha1": "823ae16a87d600986573fe05f5f03f30008c7fa3", - "sha256": "62248abc08d4717360bbcb7fea1aea23260ee6fa4c9bcdc207bffdcba17aedd2", - "size": 172, - "uuid": "1b685fee-669b-4f9d-b2d5-2f193e24fb29", - "version": "2019-02-02T065446.482201Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "b89e6723", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray", - "s3_etag": "1cc8c5a815470108493b451c5a974fd3", - "sha1": "b62a2d173d1b4fa4f35817a5eefa525a7b126691", - "sha256": "31f6f311ce1934669c993d3ae909f89084d605554312bc34262340e3f37005ca", - "size": 341, - "uuid": "247a7408-946c-4d2e-bbda-e79f27541347", - "version": "2019-02-02T065446.804119Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "38f2e38c", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0", - "s3_etag": "359eccbee3435e935ee6c9e106a07ca2", - "sha1": "3547f51280955e61de2cfac8a8fb0940cafe3ab5", - "sha256": "93bbe150426cc65d22c6185d6e63976cbdb7487585bdcb6ecf8b44a57fd39488", - "size": 45059, - "uuid": "133e7526-bc1e-4731-b304-942b2302b260", - "version": "2019-02-02T065447.022845Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "88035931", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray", - "s3_etag": "12f1697e02f5dc989975f3a4e2ac3f98", - "sha1": "fffcd7c2eda62aac81a0c656ae034a4271256cee", - "sha256": "fc15b29aeda7d465c6d39028fd015c7ec5e364129721154547d245107758cc4a", - "size": 319, - "uuid": "30d5a0b7-f83c-4834-a708-bfa5f33a1e79", - "version": "2019-02-02T065447.365605Z" - }, - { - "content-type": "application/octet-stream; dcp-type=data", - "crc32c": "d3733841", - "indexed": false, - "name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0", - "s3_etag": "b1340be37e97bfa77eea653ed55df86e", - "sha1": "edd20a8ccf3894e957f42913a8afb8d438569e13", - "sha256": "6934073545ed7cdc70acc7ec765929125452b2753510fdcb682a19e8d8fde970", - "size": 192191, - "uuid": "e0c065fb-3297-44e8-ab6b-cb6aa461bedc", - "version": "2019-02-02T065447.635894Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "4df5f693", - "indexed": false, - "name": "ERR2462443_1.fastq.gz", - "s3_etag": "50ea47ab9850309a470ce78b38f77c9a", - "sha1": "88ade3d68a3a835bcd4d4a5434e7ca0f27da7cea", - "sha256": "a8ba89633116043dcc81c4e79bb8794e8fabb45107cb1ae6aac50b425ea9951c", - "size": 11869523, - "uuid": "e3a876c0-814d-48d0-ab33-5de0ca400125", - "version": "2019-02-01T115352.287395Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "aa8d705d", - "indexed": false, - "name": "ERR2462443_2.fastq.gz", - "s3_etag": "eef771438861eb1181c0a42e707ce313", - "sha1": "13d71b1e22c7f000d4e95109757386214078ab13", - "sha256": "af1307de700fc3aa828fc08c1a6b0ebe7df3f168878e42f8ee597ec61d7cee5d", - "size": 11778346, - "uuid": "54d7fff5-6a9e-44c9-b515-ea28a9b1940f", - "version": "2019-02-01T115352.858162Z" - } -] \ No newline at end of file diff --git a/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/metadata.json b/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/metadata.json deleted file mode 100644 index 6377fb91d..000000000 --- a/test/hca_metadata_api/cans/prod/ffee7f29-5c38-461a-8771-a68e20ec4a2e/2019-02-02T065454.662896Z/metadata.json +++ /dev/null @@ -1,1656 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/8.6.6/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "24088_4_92", - "biomaterial_name": "T cell from blood", - "biomaterial_description": "=", - "ncbi_taxon_id": [ - 9606 - ], - "insdc_biomaterial": "ERS2335002", - "biosd_biomaterial": "SAMEA1015535" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "selected_cell_type": [ - { - "text": "T cell", - "ontology": "CL:0000084", - "ontology_label": "T cell" - } - ], - "total_estimated_cells": 1, - "plate_based_sequencing": { - "plate_id": "not provided" - }, - "provenance": { - "document_id": "9ea49dd1-7511-48f8-be12-237e3d0690c0", - "submission_date": "2019-01-23T10:27:50.080Z", - "update_date": "2019-01-23T11:01:24.376Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/6.3.8/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "blood_from_donor_D4", - "biomaterial_name": "Peripheral blood sample 1", - "biomaterial_description": "Blood from early pregnancy (6- 14 weeks gestation)", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "blood", - "ontology": "UBERON:0000178", - "ontology_label": "blood" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "preservation_storage": { - "preservation_method": "fresh" - }, - "provenance": { - "document_id": "e7049663-aa57-4001-8bb4-870e341b4f0b", - "submission_date": "2019-01-23T10:25:32.280Z", - "update_date": "2019-01-23T10:55:57.143Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/biomaterial/12.0.5/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "D4", - "biomaterial_name": "Donor 4", - "biomaterial_description": "Donor 4, 6-14 weeks pregnant", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "is_living": "yes", - "sex": "female", - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461", - "ontology_label": "normal" - } - ], - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272", - "ontology_label": "adult" - }, - "provenance": { - "document_id": "a879fffa-3b98-4204-ae5a-603180007ca0", - "submission_date": "2019-01-23T10:25:32.001Z", - "update_date": "2019-01-23T10:40:40.695Z" - } - }, - "analysis_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt", - "file_format": "txt" - }, - "provenance": { - "document_id": "b91aca7b-e71b-4014-ab09-5d87e52bc305", - "submission_date": "2019-02-02T06:45:00.418Z", - "update_date": "2019-02-02T06:49:43.861Z" - } - }, - "analysis_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt", - "file_format": "txt" - }, - "provenance": { - "document_id": "34e92010-0e2d-49af-b4b7-bed7a2c9e490", - "submission_date": "2019-02-02T06:45:00.594Z", - "update_date": "2019-02-02T06:49:37.893Z" - } - }, - "analysis_file_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt", - "file_format": "txt" - }, - "provenance": { - "document_id": "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", - "submission_date": "2019-02-02T06:45:00.770Z", - "update_date": "2019-02-02T06:49:40.900Z" - } - }, - "analysis_file_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt", - "file_format": "txt" - }, - "provenance": { - "document_id": "ed37a61e-4449-4bce-a774-7cbd732781c8", - "submission_date": "2019-02-02T06:45:00.949Z", - "update_date": "2019-02-02T06:49:40.853Z" - } - }, - "analysis_file_4.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt", - "file_format": "txt" - }, - "provenance": { - "document_id": "b70e4907-383c-4466-a244-3e7ce9890dae", - "submission_date": "2019-02-02T06:45:01.127Z", - "update_date": "2019-02-02T06:49:43.860Z" - } - }, - "analysis_file_5.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "7ee496ab-286c-4962-919a-70244090e315", - "submission_date": "2019-02-02T06:45:01.306Z", - "update_date": "2019-02-02T06:49:53.070Z" - } - }, - "analysis_file_6.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", - "submission_date": "2019-02-02T06:45:01.483Z", - "update_date": "2019-02-02T06:49:53.044Z" - } - }, - "analysis_file_7.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "b11e96c4-2472-4317-b45b-5bc1c9b55704", - "submission_date": "2019-02-02T06:45:01.662Z", - "update_date": "2019-02-02T06:49:55.885Z" - } - }, - "analysis_file_8.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", - "submission_date": "2019-02-02T06:45:01.843Z", - "update_date": "2019-02-02T06:49:55.882Z" - } - }, - "analysis_file_9.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "6804b943-fda7-4e8f-bfba-23e368843e63", - "submission_date": "2019-02-02T06:45:02.034Z", - "update_date": "2019-02-02T06:49:58.883Z" - } - }, - "analysis_file_10.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "aeb5aebe-9e45-4c9d-931a-883f8fa71225", - "submission_date": "2019-02-02T06:45:02.212Z", - "update_date": "2019-02-02T06:49:58.860Z" - } - }, - "analysis_file_11.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv", - "file_format": "csv" - }, - "provenance": { - "document_id": "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", - "submission_date": "2019-02-02T06:45:02.394Z", - "update_date": "2019-02-02T06:50:01.875Z" - } - }, - "analysis_file_12.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam", - "file_format": "bam" - }, - "provenance": { - "document_id": "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", - "submission_date": "2019-02-02T06:45:02.573Z", - "update_date": "2019-02-02T06:49:34.958Z" - } - }, - "analysis_file_13.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai", - "file_format": "bai" - }, - "provenance": { - "document_id": "0aa4b2f3-b969-40d7-97f9-f33af0088915", - "submission_date": "2019-02-02T06:45:02.767Z", - "update_date": "2019-02-02T06:49:37.919Z" - } - }, - "analysis_file_14.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam", - "file_format": "bam" - }, - "provenance": { - "document_id": "697a869d-079b-48d4-9a7d-c04cf05dd0a9", - "submission_date": "2019-02-02T06:45:02.955Z", - "update_date": "2019-02-02T06:49:46.903Z" - } - }, - "analysis_file_15.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results", - "file_format": "results" - }, - "provenance": { - "document_id": "6d928f58-2e83-46a0-84a2-d08744a42abd", - "submission_date": "2019-02-02T06:45:03.146Z", - "update_date": "2019-02-02T06:49:49.891Z" - } - }, - "analysis_file_16.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results", - "file_format": "results" - }, - "provenance": { - "document_id": "cc958050-fd69-4919-8529-6f91552ce0ea", - "submission_date": "2019-02-02T06:45:03.325Z", - "update_date": "2019-02-02T06:49:53.098Z" - } - }, - "analysis_file_17.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs", - "file_format": "matrix" - }, - "provenance": { - "document_id": "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", - "submission_date": "2019-02-02T06:45:03.500Z", - "update_date": "2019-02-02T06:50:01.882Z" - } - }, - "analysis_file_18.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup", - "file_format": "unknown" - }, - "provenance": { - "document_id": "42fffad8-d47d-4da5-8318-45b0f5577c08", - "submission_date": "2019-02-02T06:45:03.681Z", - "update_date": "2019-02-02T06:50:04.892Z" - } - }, - "analysis_file_19.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "2842a995-c205-4d80-959f-fcb9ff8719ee", - "submission_date": "2019-02-02T06:45:03.862Z", - "update_date": "2019-02-02T06:50:04.900Z" - } - }, - "analysis_file_20.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "90d148ed-a6eb-44c3-a398-df29459943ff", - "submission_date": "2019-02-02T06:45:04.048Z", - "update_date": "2019-02-02T06:50:07.892Z" - } - }, - "analysis_file_21.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "269a143b-a2c2-40cd-9394-41a13321581d", - "submission_date": "2019-02-02T06:45:04.228Z", - "update_date": "2019-02-02T06:50:10.886Z" - } - }, - "analysis_file_22.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "1dda8255-de1c-4bfa-aa79-dbc501d3a112", - "submission_date": "2019-02-02T06:45:04.425Z", - "update_date": "2019-02-02T06:50:10.905Z" - } - }, - "analysis_file_23.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "d76f404c-d294-49f2-bfd5-d475e08fa783", - "submission_date": "2019-02-02T06:45:04.602Z", - "update_date": "2019-02-02T06:50:13.892Z" - } - }, - "analysis_file_24.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", - "submission_date": "2019-02-02T06:45:04.791Z", - "update_date": "2019-02-02T06:50:13.961Z" - } - }, - "analysis_file_25.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", - "submission_date": "2019-02-02T06:45:04.980Z", - "update_date": "2019-02-02T06:50:13.945Z" - } - }, - "analysis_file_26.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", - "submission_date": "2019-02-02T06:45:05.160Z", - "update_date": "2019-02-02T06:50:16.898Z" - } - }, - "analysis_file_27.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "3fe1e9e8-1b0f-4683-a402-ae970b33f144", - "submission_date": "2019-02-02T06:45:05.347Z", - "update_date": "2019-02-02T06:50:16.905Z" - } - }, - "analysis_file_28.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "e53c14f5-1a4f-44d6-9773-53faac32233b", - "submission_date": "2019-02-02T06:45:05.539Z", - "update_date": "2019-02-02T06:50:19.912Z" - } - }, - "analysis_file_29.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "7a26e63d-fcf2-419a-a945-bca9e539480f", - "submission_date": "2019-02-02T06:45:05.734Z", - "update_date": "2019-02-02T06:50:19.912Z" - } - }, - "analysis_file_30.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "644b261b-450e-453c-bb5e-0498a1cf5804", - "submission_date": "2019-02-02T06:45:05.915Z", - "update_date": "2019-02-02T06:50:22.891Z" - } - }, - "analysis_file_31.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray", - "file_format": "unknown" - }, - "provenance": { - "document_id": "b367129a-e83f-4a2b-9278-b5f7930ad457", - "submission_date": "2019-02-02T06:45:06.096Z", - "update_date": "2019-02-02T06:50:22.873Z" - } - }, - "analysis_file_32.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "schema_type": "file", - "file_core": { - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0", - "file_format": "unknown" - }, - "provenance": { - "document_id": "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39", - "submission_date": "2019-02-02T06:45:06.274Z", - "update_date": "2019-02-02T06:50:25.954Z" - } - }, - "sequence_file_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/7.0.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "ERR2462443_1.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "read_length": 75, - "insdc_run": [ - "ERR2462443" - ], - "provenance": { - "document_id": "c15ee840-4702-45f7-bb19-693de19a742a", - "submission_date": "2019-01-23T10:32:54.467Z", - "update_date": "2019-01-23T16:20:56.497Z" - } - }, - "sequence_file_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/file/7.0.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "ERR2462443_2.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read2", - "read_length": 75, - "insdc_run": [ - "ERR2462443" - ], - "provenance": { - "document_id": "5f5d9c84-3565-4398-886c-2e50ad4c3964", - "submission_date": "2019-01-23T10:32:54.477Z", - "update_date": "2019-01-23T16:20:53.469Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/project/9.0.8/project", - "schema_type": "project", - "project_core": { - "project_short_name": "Fetal/Maternal Interface", - "project_title": "Reconstructing the human first trimester fetal-maternal interface using single cell transcriptomics", - "project_description": "During early human pregnancy the uterine mucosa transforms into the decidua, into which the fetal placenta implants and where placental trophoblast cells intermingle and communicate with maternal cells. Trophoblast\u2013decidual interactions underlie common diseases of pregnancy, including pre-eclampsia and stillbirth. Here we profile the transcriptomes of about 70,000 single cells from first-trimester placentas with matched maternal blood and decidual cells. The cellular composition of human decidua reveals subsets of perivascular and stromal cells that are located in distinct decidual layers. There are three major subsets of decidual natural killer cells that have distinctive immunomodulatory and chemokine profiles. We develop a repository of ligand\u2013receptor complexes and a statistical tool to predict the cell-type specificity of cell\u2013cell communication via these molecular interactions. Our data identify many regulatory interactions that prevent harmful innate or adaptive immune responses in this environment. Our single-cell atlas of the maternal\u2013fetal interface reveals the cellular organization of the decidua and placenta, and the interactions that are critical for placentation and reproductive success." - }, - "insdc_project": "ERP107748", - "array_express_investigation": "E-MTAB-6678", - "insdc_study": "PRJEB25794", - "supplementary_links": [ - "https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6678/", - "https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6701/", - "https://www.ebi.ac.uk/ena/data/view/PRJEB25794", - "https://www.ebi.ac.uk/ena/data/view/PRJEB28266" - ], - "contributors": [ - { - "contact_name": "Johan,,Henriksson", - "email": "mahogny@areta.org", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "corresponding_contributor": false - }, - { - "contact_name": "Mirjana,,Efremova", - "email": "me5@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Roser,,Vento-Tormo", - "email": "rv4@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Muzlifah,,Haniffa", - "email": "m.a.haniffa@ncl.ac.uk", - "institution": "Newcastle University", - "laboratory": "Institute of Cellular Medicine", - "address": "Newcastle upon Tyne, NE2 4HH", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Ashley,,Moffett", - "email": "am485@cam.ac.uk", - "institution": "University of Cambridge", - "laboratory": "Centre for Trophoblast Research", - "address": "Cambridge, CB2 3EG", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Sarah,A,Teichmann", - "email": "st9@sanger.ac.uk", - "institution": "Wellcome Trust Sanger Institute", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "corresponding_contributor": true - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Zinaida, A, Perova", - "email": "zina@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0001-9913-3249", - "corresponding_contributor": false - }, - { - "contact_name": "Anja,,Fullgrabe", - "email": "anjaf@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "ArrayExpress ", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8674-0039", - "corresponding_contributor": false - } - ], - "funders": [ - { - "funder_name": "Swedish Research Council" - }, - { - "grant_id": "099175/Z/12/Z", - "funder_name": "Medical Research Council / Wellcome Trust" - }, - { - "grant_id": "WT107931/Z/15/Z", - "funder_name": "Wellcome Trust" - }, - { - "funder_name": "EMBO Long-Term Fellowship" - }, - { - "funder_name": "Human Frontier Science Program Long-Term Fellowship" - }, - { - "funder_name": "Royal Society Dorothy Hodgkin Fellowship" - }, - { - "funder_name": "The Lister Institute for Preventive Medicine" - }, - { - "funder_name": "National Institute for Health Research" - }, - { - "funder_name": "Newcastle Biomedical Research Centre" - }, - { - "grant_id": "ThDEFINE, ThSWITCH", - "funder_name": "ERC" - }, - { - "grant_id": "MRG-GRAMMAR no. 664918", - "funder_name": "EU FET-OPEN" - }, - { - "grant_id": "Investigator award", - "funder_name": "Wellcome Trust" - }, - { - "grant_id": "WT206194", - "funder_name": "Wellcome Sanger core funding" - } - ], - "publications": [ - { - "authors": [ - "Vento-Tormo R", - "Efremova M", - "Botting RA", - "Turco MY", - "Vento-Tormo M", - "Meyer KB", - "Park J", - "Stephenson E", - "Polanski K", - "Payne RP", - "Goncalves A", - "Zou A", - "Henriksson J", - "Wood L", - "Lisgo S", - "Filby A", - "Wright GJ", - "Stubbington MJ", - "Haniffa M", - "Moffett A", - "Teichmann SA" - ], - "publication_title": "Reconstructing the human first trimester fetal-maternal interface using single cell transcriptomics", - "doi": "10.1101/429589", - "publication_url": "https://www.biorxiv.org/content/early/2018/09/29/429589" - }, - { - "authors": [ - "Vento-Tormo R", - "Efremova M", - "Botting RA", - "Turco MY", - "Vento-Tormo M", - "Meyer KB", - "Park J", - "Stephenson E", - "Polanski K", - "Goncalves A", - "Gardner L", - "Holmqvist S", - "Henriksson J", - "Zou A", - "Sharkey A", - "Millar B", - "Innes B", - "Wood L", - "Wilbrey-Clark A", - "Payne RP", - "Ivarsson M", - "Lisgo S", - "Filby A", - "Rowitch D", - "Bulmer J", - "Wright GJ", - "Stubbington MJ", - "Haniffa M", - "Moffett A", - "Teichmann SA" - ], - "publication_title": "Single-cell reconstruction of the early maternal\u2013fetal interface in humans", - "doi": "10.1038/s41586-018-0698-6", - "pmid": 30429548, - "publication_url": "https://www.nature.com/articles/s41586-018-0698-6#Sec35" - } - ], - "provenance": { - "document_id": "aabbec1a-1215-43e1-8e42-6489af25c12c", - "submission_date": "2019-01-23T10:25:31.744Z", - "update_date": "2019-01-23T10:40:40.301Z" - } - }, - "analysis_protocol_0.json": { - "computational_method": "SmartSeq2SingleCell", - "describedBy": "https://schema.humancellatlas.org/type/protocol/analysis/8.0.3/analysis_protocol", - "protocol_core": { - "protocol_id": "smartseq2_v2.2.0" - }, - "protocol_type": { - "text": "analysis" - }, - "schema_type": "protocol", - "provenance": { - "document_id": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7", - "submission_date": "2019-02-02T06:44:58.913Z", - "update_date": "2019-02-02T06:45:04.641Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/4.4.4/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", - "protocol_description": "The SmartSeq2 protocol was performed on single-cells as described in 10.1038/nprot.2014.006, with some modifications.", - "publication_doi": "10.1038/nprot.2014.006" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931", - "ontology_label": "Smart-seq2" - }, - "nucleic_acid_source": "single cell", - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869", - "ontology_label": "polyA RNA" - }, - "library_construction_kit": { - "retail_name": "Nextera XT library preparation kit" - }, - "provenance": { - "document_id": "edda2708-1172-47f0-9c8b-b6771f463db1", - "submission_date": "2019-01-23T10:33:59.845Z", - "update_date": "2019-01-23T10:34:05.563Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/sequencing/9.0.8/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "SmartSeq2 single cell sequencing", - "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2000 platform to obtain 75-bp paired-end reads." - }, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441", - "ontology_label": "full length single cell RNA sequencing" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2000", - "ontology": "EFO:0004203", - "ontology_label": "Illumina HiSeq 2000" - }, - "paired_end": true, - "provenance": { - "document_id": "46f58d61-c784-47fb-9c75-7af37871810e", - "submission_date": "2019-01-23T10:33:59.865Z", - "update_date": "2019-01-23T10:34:05.670Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_3", - "protocol_name": "Isolation (enrichment) of PBMCs from blood", - "protocol_description": "Blood samples were carefully layered onto a Ficoll-paque gradient and centrifuged at 2,000 rpm for 30 min without brakes. Peripheral blood mononuclear cells (PBMCs) from the interface between the plasma and the Ficoll\u2013 Paque gradient were collected and washed in ice-cold phosphate-buffered saline (PBS), followed by centrifugation at 2000r.p.m. for 5 min. The pellet was resuspended in 5ml of red blood cell lysis buffer (Invitrogen, 00-4300) for 10min.", - "publication_doi": "10.1038/s41586-018-0698-6" - }, - "enrichment_method": { - "text": "Ficoll-paque gradient", - "ontology": "EFO:0009112", - "ontology_label": "density gradient centrifugation" - }, - "provenance": { - "document_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1", - "submission_date": "2019-01-23T10:33:59.669Z", - "update_date": "2019-01-23T10:34:05.632Z" - } - }, - "enrichment_protocol_1.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_10", - "protocol_name": "FACS sorting to enrich for live cells (DAPI+)", - "protocol_description": "Cells were stained for DAPI and only viable (DAPI+) cells were sorted. ", - "publication_doi": "10.1038/s41586-018-0698-6" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "DAPI+", - "provenance": { - "document_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253", - "submission_date": "2019-01-23T10:33:59.759Z", - "update_date": "2019-01-23T10:34:06.540Z" - } - }, - "enrichment_protocol_2.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_11", - "protocol_name": "FACS sorting to deplete B cells", - "protocol_description": "FACS was used with CD19- and CD20-", - "publication_doi": "10.1038/s41586-018-0698-6" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "CD19- CD20-", - "provenance": { - "document_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2", - "submission_date": "2019-01-23T10:33:59.768Z", - "update_date": "2019-01-23T10:34:05.715Z" - } - }, - "enrichment_protocol_3.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/2.2.8/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_5", - "protocol_name": "FACS sorting to enrich for T cells for SS2", - "protocol_description": "FACS was used with gates CD45+HLADR\u2212CD56\u2212CD3+CD4+CD8\u2212; CD45+HLA-DR\u2212CD56\u2212CD3+CD8+; CD45+HLA-DR\u2212CD56\u2212CD3+CD4\u2212CD8\u2212", - "publication_doi": "10.1038/s41586-018-0698-6" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "CD45+ HLA-DR\u2212 CD56\u2212 CD3+ CD4+ CD8\u2212 CD8+ CD4\u2212", - "provenance": { - "document_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca", - "submission_date": "2019-01-23T10:33:59.686Z", - "update_date": "2019-01-23T10:34:05.783Z" - } - }, - "collection_protocol_0.json": { - "describedBy": "https://schema.humancellatlas.org/type/protocol/biomaterial_collection/8.2.10/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "blood_draw_1", - "protocol_name": "blood draw", - "protocol_description": "blood draw", - "publication_doi": "10.1038/s41586-018-0698-6" - }, - "collection_method": { - "text": "blood draw", - "ontology": "EFO:0009121", - "ontology_label": "blood draw" - }, - "provenance": { - "document_id": "477b201f-67f0-4f97-86d5-de32a7afc267", - "submission_date": "2019-01-23T10:33:59.629Z", - "update_date": "2019-01-23T10:34:05.575Z" - } - }, - "analysis_process_0.json": { - "analysis_run_type": "run", - "describedBy": "https://schema.humancellatlas.org/type/process/analysis/8.0.3/analysis_process", - "input_bundles": [ - "8324dd3f-ddaf-42aa-9b3f-aef342229028" - ], - "inputs": [ - { - "parameter_name": "fastq1", - "parameter_value": "gs://org-hca-dss-checkout-prod/bundles/8324dd3f-ddaf-42aa-9b3f-aef342229028.2019-02-01T115354.796712Z/ERR2462443_1.fastq.gz" - }, - { - "parameter_name": "fastq2", - "parameter_value": "gs://org-hca-dss-checkout-prod/bundles/8324dd3f-ddaf-42aa-9b3f-aef342229028.2019-02-01T115354.796712Z/ERR2462443_2.fastq.gz" - }, - { - "parameter_name": "sample_name", - "parameter_value": "9ea49dd1-7511-48f8-be12-237e3d0690c0" - }, - { - "parameter_name": "output_name", - "parameter_value": "9ea49dd1-7511-48f8-be12-237e3d0690c0" - }, - { - "parameter_name": "gtf_file", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode.v27.primary_assembly.annotation.gtf" - }, - { - "parameter_name": "genome_ref_fasta", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/GRCh38.primary_assembly.genome.fa" - }, - { - "parameter_name": "rrna_intervals", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode.v27.rRNA.interval_list" - }, - { - "parameter_name": "gene_ref_flat", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/GRCh38_gencode.v27.refFlat.txt" - }, - { - "parameter_name": "hisat2_ref_index", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/HISAT2/genome_snp_tran.tar.gz" - }, - { - "parameter_name": "hisat2_ref_trans_name", - "parameter_value": "gencode_v27_trans_rsem" - }, - { - "parameter_name": "rsem_ref_index", - "parameter_value": "gs://hca-dcp-mint-test-data/reference/GRCh38_Gencode/gencode_v27_primary.tar" - }, - { - "parameter_name": "hisat2_ref_name", - "parameter_value": "genome_snp_tran" - }, - { - "parameter_name": "hisat2_ref_trans_name", - "parameter_value": "gencode_v27_trans_rsem" - }, - { - "parameter_name": "stranded", - "parameter_value": "NONE" - } - ], - "outputs": [ - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "txt", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bait_bias_summary_metrics.txt" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "txt", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.insert_size_metrics.txt" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "txt", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_by_cycle_metrics.txt" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "txt", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.quality_distribution_metrics.txt" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "txt", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.rna_metrics.txt" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_QCs.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_bait_bias_detail_metrics.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_base_distribution_by_cycle_metrics.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_error_summary_metrics.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_gc_bias.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_detail_metrics.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "csv", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_pre_adapter_summary_metrics.csv" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "bam", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "bai", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_qc.bam.bai" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "bam", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.bam" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "results", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.genes.results" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "results", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0_rsem.isoforms.results" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "matrix", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zattrs" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!.zgroup" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_id!0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric!0.0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_numeric_name!0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string!0.0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!cell_metadata_string_name!0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!expression!0.0" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!.zarray" - }, - "schema_type": "file" - }, - { - "describedBy": "https://schema.humancellatlas.org/type/file/5.3.4/analysis_file", - "file_core": { - "file_format": "unknown", - "file_name": "9ea49dd1-7511-48f8-be12-237e3d0690c0.zarr!gene_id!0" - }, - "schema_type": "file" - } - ], - "process_core": { - "process_id": "1a5b6337-c719-4dc7-9014-e7cb7f739e22" - }, - "process_type": { - "text": "analysis" - }, - "reference_bundle": "bf51d668-3e14-4843-9bc7-5d676fdf0e01", - "schema_type": "process", - "tasks": [ - { - "cpus": 2, - "disk_size": "local-disk 11 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectDuplicationMetrics/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectDuplicationMetrics/stdout", - "memory": "7.5 GB", - "start_time": "2019-02-02T06:17:07.504Z", - "stop_time": "2019-02-02T06:20:06.008Z", - "task_name": "CollectDuplicationMetrics", - "zone": "us-central1-b" - }, - { - "cpus": 1, - "disk_size": "local-disk 14 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectMultipleMetrics/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectMultipleMetrics/stdout", - "memory": "7.5 GB", - "start_time": "2019-02-02T06:17:07.504Z", - "stop_time": "2019-02-02T06:26:15.019Z", - "task_name": "CollectMultipleMetrics", - "zone": "us-central1-b" - }, - { - "cpus": 1, - "disk_size": "local-disk 11 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-picard:v0.2.2-2.10.10", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectRnaMetrics/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-CollectRnaMetrics/stdout", - "memory": "3.5 GB", - "start_time": "2019-02-02T06:17:07.504Z", - "stop_time": "2019-02-02T06:30:57.010Z", - "task_name": "CollectRnaMetrics", - "zone": "us-central1-b" - }, - { - "cpus": 1, - "disk_size": "local-disk 20 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-sctools:v0.3.0", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-GroupQCOutputs/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-GroupQCOutputs/stdout", - "memory": "2 GB", - "start_time": "2019-02-02T06:30:58.954Z", - "stop_time": "2019-02-02T06:36:21.014Z", - "task_name": "GroupQCOutputs", - "zone": "us-central1-b" - }, - { - "cpus": 4, - "disk_size": "local-disk 23 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-hisat2:v0.2.2-2-2.1.0", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2PairedEnd/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2PairedEnd/stdout", - "memory": "15 GB", - "start_time": "2019-02-02T06:09:49.934Z", - "stop_time": "2019-02-02T06:17:06.009Z", - "task_name": "HISAT2PairedEnd", - "zone": "us-central1-b" - }, - { - "cpus": 4, - "disk_size": "local-disk 14 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-hisat2:v0.2.2-2-2.1.0", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2Transcriptome/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-HISAT2Transcriptome/stdout", - "memory": "15 GB", - "start_time": "2019-02-02T06:09:49.935Z", - "stop_time": "2019-02-02T06:13:12.013Z", - "task_name": "HISAT2Transcriptome", - "zone": "us-central1-b" - }, - { - "cpus": 4, - "disk_size": "local-disk 22 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-rsem:v0.2.2-1.3.0", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-RSEMExpression/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-RSEMExpression/stdout", - "memory": "3.5 GB", - "start_time": "2019-02-02T06:13:13.934Z", - "stop_time": "2019-02-02T06:18:24.008Z", - "task_name": "RSEMExpression", - "zone": "us-central1-b" - }, - { - "cpus": 4, - "disk_size": "local-disk 100 HDD", - "docker_image": "quay.io/humancellatlas/secondary-analysis-python3-scientific:0.1.7", - "log_err": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-SmartSeq2ZarrConversion/stderr", - "log_out": "gs://hca-dcp-pipelines-prod-cromwell-execution/caas-cromwell-executions/AdapterSmartSeq2SingleCell/e39de6d0-0ba4-4c92-bd96-f4b1117ca390/call-analysis/ss2.SmartSeq2SingleCell/1a5b6337-c719-4dc7-9014-e7cb7f739e22/call-SmartSeq2ZarrConversion/stdout", - "memory": "16 GB", - "start_time": "2019-02-02T06:36:22.504Z", - "stop_time": "2019-02-02T06:39:18.012Z", - "task_name": "SmartSeq2ZarrConversion", - "zone": "us-central1-b" - } - ], - "timestamp_start_utc": "2019-02-02T06:09:46.854Z", - "timestamp_stop_utc": "2019-02-02T06:39:21.010Z", - "provenance": { - "document_id": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", - "submission_date": "2019-02-02T06:44:59.796Z", - "update_date": "2019-02-02T06:45:04.794Z" - } - }, - "process_0.json": { - "insdc_experiment": { - "insdc_experiment": "ERX2481489" - }, - "process_core": { - "process_id": "24088_4_92" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", - "provenance": { - "document_id": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", - "submission_date": "2019-01-23T10:40:00.000Z", - "update_date": "2019-01-23T11:19:16.982Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_5845" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", - "provenance": { - "document_id": "e84cac5b-1467-4055-a029-48d67a5505d6", - "submission_date": "2019-01-23T10:36:29.102Z", - "update_date": "2019-01-23T11:10:57.210Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_21" - }, - "schema_type": "process", - "describedBy": "https://schema.humancellatlas.org/type/process/6.0.6/process", - "provenance": { - "document_id": "832b39e3-ebba-4686-a724-52babb96056f", - "submission_date": "2019-01-23T10:34:00.619Z", - "update_date": "2019-01-23T11:05:44.002Z" - } - }, - "links.json": { - "describedBy": "https://schema.humancellatlas.org/system/1.1.4/links", - "schema_type": "link_bundle", - "schema_version": "1.1.4", - "links": [ - { - "process": "d6c56c65-bed0-4d6e-bf89-7e0d71bd3026", - "inputs": [ - "c15ee840-4702-45f7-bb19-693de19a742a", - "5f5d9c84-3565-4398-886c-2e50ad4c3964" - ], - "input_type": "file", - "outputs": [ - "b91aca7b-e71b-4014-ab09-5d87e52bc305", - "34e92010-0e2d-49af-b4b7-bed7a2c9e490", - "3db4d80f-cbd5-45da-9048-6fe8e2e4d0d2", - "ed37a61e-4449-4bce-a774-7cbd732781c8", - "b70e4907-383c-4466-a244-3e7ce9890dae", - "7ee496ab-286c-4962-919a-70244090e315", - "c15427d1-e5b7-4bee-91fe-d98b04dc6a01", - "b11e96c4-2472-4317-b45b-5bc1c9b55704", - "828d7e40-4f6b-42e1-8cd2-6ddccb5b0e6c", - "6804b943-fda7-4e8f-bfba-23e368843e63", - "aeb5aebe-9e45-4c9d-931a-883f8fa71225", - "7c5a87c1-e3b6-42aa-8d68-0f534ded7d2d", - "87bd704c-3d36-4620-bdf2-5ad28c5a3d56", - "0aa4b2f3-b969-40d7-97f9-f33af0088915", - "697a869d-079b-48d4-9a7d-c04cf05dd0a9", - "6d928f58-2e83-46a0-84a2-d08744a42abd", - "cc958050-fd69-4919-8529-6f91552ce0ea", - "0a5730dc-eeeb-4f25-bcc7-24cb7d15ac01", - "42fffad8-d47d-4da5-8318-45b0f5577c08", - "2842a995-c205-4d80-959f-fcb9ff8719ee", - "90d148ed-a6eb-44c3-a398-df29459943ff", - "269a143b-a2c2-40cd-9394-41a13321581d", - "1dda8255-de1c-4bfa-aa79-dbc501d3a112", - "d76f404c-d294-49f2-bfd5-d475e08fa783", - "3f672b26-ea2f-4e94-ba77-f463c3cb7c38", - "4bc5b41c-9fea-4baa-9bf9-75fa4f4a9818", - "3e44e8f9-e76d-4158-a7af-eeb9602cf8cc", - "3fe1e9e8-1b0f-4683-a402-ae970b33f144", - "e53c14f5-1a4f-44d6-9773-53faac32233b", - "7a26e63d-fcf2-419a-a945-bca9e539480f", - "644b261b-450e-453c-bb5e-0498a1cf5804", - "b367129a-e83f-4a2b-9278-b5f7930ad457", - "6d4785d0-bd42-4f98-8f7a-ab9ca8fcab39" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "analysis_protocol", - "protocol_id": "bb17ee61-193e-4ae1-a014-4f1b1c19b8b7" - } - ] - }, - { - "process": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", - "inputs": [ - "9ea49dd1-7511-48f8-be12-237e3d0690c0" - ], - "input_type": "biomaterial", - "outputs": [ - "c15ee840-4702-45f7-bb19-693de19a742a", - "5f5d9c84-3565-4398-886c-2e50ad4c3964" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "edda2708-1172-47f0-9c8b-b6771f463db1" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "46f58d61-c784-47fb-9c75-7af37871810e" - } - ] - }, - { - "process": "e84cac5b-1467-4055-a029-48d67a5505d6", - "inputs": [ - "e7049663-aa57-4001-8bb4-870e341b4f0b" - ], - "input_type": "biomaterial", - "outputs": [ - "9ea49dd1-7511-48f8-be12-237e3d0690c0" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "enrichment_protocol", - "protocol_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca" - } - ] - }, - { - "process": "832b39e3-ebba-4686-a724-52babb96056f", - "inputs": [ - "a879fffa-3b98-4204-ae5a-603180007ca0" - ], - "input_type": "biomaterial", - "outputs": [ - "e7049663-aa57-4001-8bb4-870e341b4f0b" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "477b201f-67f0-4f97-86d5-de32a7afc267" - } - ] - }, - { - "process": "55faef19-0c09-41ef-b21c-ad25a89ea2e3", - "inputs": [ - "9ea49dd1-7511-48f8-be12-237e3d0690c0" - ], - "input_type": "biomaterial", - "outputs": [ - "c15ee840-4702-45f7-bb19-693de19a742a", - "5f5d9c84-3565-4398-886c-2e50ad4c3964" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "edda2708-1172-47f0-9c8b-b6771f463db1" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "46f58d61-c784-47fb-9c75-7af37871810e" - } - ] - }, - { - "process": "e84cac5b-1467-4055-a029-48d67a5505d6", - "inputs": [ - "e7049663-aa57-4001-8bb4-870e341b4f0b" - ], - "input_type": "biomaterial", - "outputs": [ - "9ea49dd1-7511-48f8-be12-237e3d0690c0" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "enrichment_protocol", - "protocol_id": "dcfe8429-af02-491e-96e9-4ac0569cd5d1" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "55dd1cfc-cc9c-4a03-aa43-2cb92b843253" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "3d2707fa-83ad-472b-8282-7b6191f96bc2" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "88bd21a4-8d6c-48ce-ab57-8b5e0b582cca" - } - ] - }, - { - "process": "832b39e3-ebba-4686-a724-52babb96056f", - "inputs": [ - "a879fffa-3b98-4204-ae5a-603180007ca0" - ], - "input_type": "biomaterial", - "outputs": [ - "e7049663-aa57-4001-8bb4-870e341b4f0b" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "477b201f-67f0-4f97-86d5-de32a7afc267" - } - ] - } - ] - } -} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018.2018-10-07T130111.835234Z.json b/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018.2018-10-07T130111.835234Z.json new file mode 100644 index 000000000..c301e8a49 --- /dev/null +++ b/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018.2018-10-07T130111.835234Z.json @@ -0,0 +1,672 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "092b0c23", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "d20baf1781d6a8c71983c22438a36a1a", + "sha1": "ad19c4ec4b4cbc6efc2a381ac7a0d5f063d6f13d", + "sha256": "5719b272070a25297bebd02579b670ccfbe2cb481d3a2c25a5f973c5498e4864", + "size": 1085, + "uuid": "ef97eef1-a436-4462-a152-1a2b86ee8831", + "version": "2018-10-07T120446.292000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ac85eb5f", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "aa95222bb2d422ecda6506874ece3700", + "sha1": "734cc60ef29949d3fec6b401ddac0a99afcd39f7", + "sha256": "0e01cfbdc118c821473c8140a5c90ece30daac8fd515a0dd6ea7679a42a59829", + "size": 1103, + "uuid": "80cb479b-dcb4-4dbb-a75d-0249a964bb70", + "version": "2018-10-07T120139.672000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "84b139be", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "4d0a70ccd6bf3a6edcac6eea2a38c9e5", + "sha1": "315d282c7b29311fdf90e8a4e9731801b6472be7", + "sha256": "55d2a1ab247b3047dd9ed40764eeddf6d8db97e834043d34249bd7477fca6cd7", + "size": 1166, + "uuid": "6c992ba4-c132-4dd3-840e-13cf3f38243e", + "version": "2018-10-07T120040.749000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cbad3ef1", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "6259ed5a836550f3ab254427792e2b6b", + "sha1": "7812a833b008de1b4c18b4e3524afee0351f605f", + "sha256": "288a291d47730fd8dfd5b2f895f66957ddb344412de0dd7f02cdf3281353a93b", + "size": 523, + "uuid": "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27", + "version": "2018-10-07T120849.204000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "1b63912f", + "indexed": true, + "name": "project_0.json", + "s3_etag": "a281bf03ee65c12504c4400eb9483078", + "sha1": "ad001b59219e07a0d13ff9e1e79588e4989f828e", + "sha256": "58d4e558959ef2f4b45bb7ea6ff9fadec4e7c7eff8a67398846339151758cf40", + "size": 5236, + "uuid": "519b58ef-6462-4ed3-8c0d-375b54f53c31", + "version": "2018-10-07T120040.290000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "41491acc", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "eeb4e161fcc3e4b55807b63ebb6eb45f", + "sha1": "49f108ad2626b72eaaa4b5fb7f4032f7a0bd7e69", + "sha256": "bfded3b26644d5e6c5e6a85e7c55d56f94f7df33951a760d6d9fc4a97b13f62f", + "size": 1475, + "uuid": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5", + "version": "2018-10-07T115850.532000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "0c8996e6", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "871475e72700c0db371ca1bd12878eb2", + "sha1": "1f0420e95b82fb42f2649ab7cf5b82de94a25db7", + "sha256": "61f0562521612a3f67253786b52339f58e322f2c32919a530a1c6dfa0d1c7bde", + "size": 976, + "uuid": "d678165b-2753-4393-bf3b-5e2a09ba892c", + "version": "2018-10-07T115850.511000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "b7b8f50f", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "89bb2934dc767d1f8021c341841c998f", + "sha1": "87c1e866fc2f385a106b1d3a2182d96f7a664615", + "sha256": "cf7c8ef8ee28ec120c21ea5809011c9b8e333d10dfdb67cd982b11c86098145c", + "size": 763, + "uuid": "920078d0-b17e-4f23-8cf6-0674b19e7bec", + "version": "2018-10-07T115850.432000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "1649738e", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "d11ddb17081131e48c84f89661325d06", + "sha1": "5d8f8272cde4254663bf352cbf9e181dde9c6fee", + "sha256": "a54d7e50e1de03736b4a09026bb96252261ef9b025767e394bc81f8458da9bc8", + "size": 1302, + "uuid": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227", + "version": "2018-10-07T115850.413000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "076cf3c4", + "indexed": true, + "name": "collection_protocol_0.json", + "s3_etag": "4851e0601f479550bb68e6c1f92b15ce", + "sha1": "e3b0565d7dca00a513b607d8218f511ee27691c8", + "sha256": "33d5e07b7400680eb92c6c5aaa4c3dc6cee7b143f723dd86b5d137fcbf054c3e", + "size": 716, + "uuid": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4", + "version": "2018-10-07T115850.563000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "51f9d7f0", + "indexed": true, + "name": "enrichment_protocol_1.json", + "s3_etag": "055a83f481596882b8798897ee50d781", + "sha1": "9aa0c45b79a32c98ab6ea18b463d505662389a92", + "sha256": "cf117a6d17c1fcdc8780d7b877bae57f8e43d5873c92130157599bd0e403abf0", + "size": 728, + "uuid": "9ab53e6a-464e-44b1-aa24-12daca989969", + "version": "2018-10-07T115850.474000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "bec07d53", + "indexed": true, + "name": "process_0.json", + "s3_etag": "feed82fc2af4e32d7f91b029109d7860", + "sha1": "ab75c100a5336e0d69966303b88185008be48963", + "sha256": "75270eceb8c411a386f9793196cb96a23d9e644bb53a3925f863b475956e862a", + "size": 465, + "uuid": "18d49b08-d095-4371-bb34-151037f9f461", + "version": "2018-10-07T120828.754000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "5e38608b", + "indexed": true, + "name": "process_1.json", + "s3_etag": "c1b135ffd9ea0c6d0c8c70b3ad808ec3", + "sha1": "11a2ba86e5e6b994a993451cf54964c27c9edcce", + "sha256": "2e58428d74c3e07db41cbe954630ceb2e2840d822ba09ac7245b8ae8186dc482", + "size": 391, + "uuid": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", + "version": "2018-10-07T120652.636000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "078475f9", + "indexed": true, + "name": "process_2.json", + "s3_etag": "1c0345db2437b44dc1fcb017929e0461", + "sha1": "bbef6705b342d6be7b5b7860ee57a68c7524c769", + "sha256": "70a79f92be2a19ddd63fc4369c79770808072151396c3b88abbcfaa9edef50f8", + "size": 430, + "uuid": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", + "version": "2018-10-07T120517.018000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "56d56718", + "indexed": true, + "name": "links.json", + "s3_etag": "70623328382d0927e3242efc726fe29d", + "sha1": "a947b0283b948cf08e1197064506bfa2491d8b3a", + "sha256": "0bc6c6fa6a9093caddd8a4921826cd47c6a0773312cc62f51abcd55f93e52ecb", + "size": 2393, + "uuid": "a1681a39-e8d2-43f7-8781-ac4edab527fe", + "version": "2018-10-07T130110.624725Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "a3f89844", + "indexed": false, + "name": "SRR6260013.fastq.gz", + "s3_etag": "8c9bb4704875cbe67cfc12abb0c66d57", + "sha1": "ee681bf47c0b7fbad663b20704ddb45d632709ed", + "sha256": "3f50829dc75cbb1e5a95403fe59e1f3bc4e897e5fbf1bb3c5861854eafa5b84c", + "size": 38471612, + "uuid": "9dee7111-d743-43a1-b768-118614bf7987", + "version": "2018-10-07T130110.968810Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", + "biomaterial_name": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", + "biomaterial_description": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", + "ncbi_taxon_id": [ + 9606 + ], + "insdc_biomaterial": "SRS2664188" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "selected_cell_type": [ + { + "text": "TEMRA", + "ontology": "CL:0000625" + } + ], + "total_estimated_cells": 1, + "plate_based_sequencing": { + "plate_id": "subject9-10_batch1", + "cell_quality": "OK" + }, + "provenance": { + "document_id": "ef97eef1-a436-4462-a152-1a2b86ee8831", + "submission_date": "2018-10-07T11:57:52.282Z", + "update_date": "2018-10-07T12:04:46.292Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/6.3.3/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Subject9_DENV negative_PBMC_TEMRA", + "biomaterial_name": "Subject9_DENV negative_PBMC_TEMRA", + "biomaterial_description": "Subject9_DENV negative_PBMC_TEMRA", + "ncbi_taxon_id": [ + 9606 + ] + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "organ": { + "text": "blood", + "ontology": "UBERON:0000178" + }, + "organ_part": { + "text": "peripheral blood mononuclear cell", + "ontology": "CL:2000001" + }, + "preservation_storage": { + "preservation_method": "cryopreservation, other", + "storage_method": "frozen, liquid nitrogen" + }, + "provenance": { + "document_id": "80cb479b-dcb4-4dbb-a75d-0249a964bb70", + "submission_date": "2018-10-07T11:56:59.350Z", + "update_date": "2018-10-07T12:01:39.672Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/10.1.2/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Subject9", + "biomaterial_name": "Subject9", + "biomaterial_description": "Subject9", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "not provided" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606" + } + ], + "is_living": "yes", + "sex": "unknown", + "medical_history": { + "test_results": "dengue virus negative" + }, + "diseases": [ + { + "text": "normal", + "ontology": "PATO:0000461" + } + ], + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272" + }, + "organism_age": "18-60", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036" + }, + "provenance": { + "document_id": "6c992ba4-c132-4dd3-840e-13cf3f38243e", + "submission_date": "2018-10-07T11:56:59.023Z", + "update_date": "2018-10-07T12:00:40.749Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "SRR6260013.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "read_length": 50, + "insdc_run": [ + "SRR6260013" + ], + "provenance": { + "document_id": "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27", + "submission_date": "2018-10-07T11:58:46.814Z", + "update_date": "2018-10-07T12:08:49.204Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/project/9.0.3/project", + "schema_type": "project", + "project_core": { + "project_short_name": "CD4+ cytotoxic T lymphocytes", + "project_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis", + "project_description": "CD4+ cytotoxic T lymphocytes (CD4-CTLs) have been reported to play a protective role in several viral infections. However, little is known in humans about the biology of CD4-CTL generation, their functional properties, heterogeneity and clonal diversity, especially in relation to other well-described CD4+ memory T cell subsets. We performed single-cell RNA-seq in over 9000 cells to unravel CD4-CTL heterogeneity, transcriptional profile and clonality in humans. The single-cell differential gene expression analysis, revealed a spectrum of known transcripts, including several linked to cytotoxic and co-stimulatory function, and transcripts of unknown cytotoxicity-related function that are expressed at higher levels in the TEMRA subset, which is highly enriched for CD4-CTLs, compared to cells in the central and effector memory subsets (TCM, TEM). Simultaneous T cells antigen receptor (TCR) analysis in single-cells and bulk subsets revealed that CD4-TEMRA cells show marked clonal expansion compared to TCM and TEM cells and that the majority of CD4-TEMRA were dengue virus (DENV)-specific in subjects with previous DENV infection. The profile of CD4-TEMRA was highly heterogeneous across subjects, with four distinct clusters identified by the single-cell analysis. Most importantly, we identified distinct clusters of CD4-CTL effector and precursor cells in the TEMRA subset; the precursor cells shared TCR clonotypes with CD4-CTL effectors and were distinguished by high expression of the interleukin-7 receptor. Our identification of a CD4-CTL precursor population may allow further investigation of how CD4-CTLs arise in humans and thus could provide insights into the mechanisms that may be utilized to generate durable and effective CD4-CTL immunity." + }, + "insdc_project": "SRP124157", + "geo_series": "GSE106540", + "insdc_study": "PRJNA417191", + "supplementary_links": [ + "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-106540/Results" + ], + "contributors": [ + { + "contact_name": "Pandurangan,,Vijayanand", + "email": "vijay@lji.org", + "institution": "La Jolla Institute for Allergy and Immunology", + "laboratory": "Division of Vaccine Discovery", + "address": "La Jolla, CA 92037", + "country": "USA", + "corresponding_contributor": true + }, + { + "contact_name": "Mallory,Ann,Freeberg", + "email": "mfreeberg@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Human Cell Atlas Data Coordination Platform", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "Human Cell Atlas wrangler", + "orcid_id": "0000-0003-2949-3921", + "corresponding_contributor": false + }, + { + "contact_name": "Laura,,Huerta", + "email": "lauhuema@ebi.ac.uk", + "institution": "EMBL-EBI", + "laboratory": "Molecular Atlas", + "address": "Wellcome Trust Genome Campus, Cambridge UK", + "country": "UK", + "project_role": "external curator", + "orcid_id": "0000-0002-8748-599X", + "corresponding_contributor": false + } + ], + "funders": [ + { + "grant_id": "U19AI118626", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "U19AI118610", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "R01HL114093", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "grant_id": "R24AI108564", + "funder_name": "National Institutes of Health (NIH)" + }, + { + "funder_name": "William K. Bowes Jr. Foundation" + } + ], + "publications": [ + { + "authors": [ + "Patil VS", + "Madrigal A", + "Schmiedel BJ", + "Clarke J", + "ORourke P", + "Harris E", + "de Silva AD", + "Harris E", + "Peters B", + "Seumois G", + "Weiskopf D", + "Sette A", + "Vijayanand P" + ], + "publication_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis.", + "doi": "10.1126/sciimmunol.aan8664", + "pmid": 29352091, + "publication_url": "http://immunology.sciencemag.org/content/3/19/eaan8664.long" + } + ], + "provenance": { + "document_id": "519b58ef-6462-4ed3-8c0d-375b54f53c31", + "submission_date": "2018-10-07T11:56:58.869Z", + "update_date": "2018-10-07T12:00:40.290Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.3.3/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "library_preparation_protocol_1", + "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", + "protocol_description": "Single cell RNAseq was performed as described in Picelli et al.Nat Protoc. 2014, PMID:24385147. We performed 23 cycles of amplification. Barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) were prepared as following manufacturers protocol.", + "publication_doi": "10.1038/nprot.2014.006" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "nucleic_acid_source": "single cell", + "end_bias": "full length", + "primer": "poly-dT", + "strand": "unstranded", + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869" + }, + "library_construction_kit": { + "retail_name": "Nextera XT library preparation kit", + "manufacturer": "Illumina" + }, + "library_preamplification_method": { + "text": "PCR", + "ontology": "OBI:0000415" + }, + "provenance": { + "document_id": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5", + "submission_date": "2018-10-07T11:58:47.200Z", + "update_date": "2018-10-07T11:58:50.532Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "SmartSeq 2 single cell sequencing", + "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2500 platform to obtain 50-bp single end reads (barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina))." + }, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565" + }, + "paired_end": false, + "provenance": { + "document_id": "d678165b-2753-4393-bf3b-5e2a09ba892c", + "submission_date": "2018-10-07T11:58:47.211Z", + "update_date": "2018-10-07T11:58:50.511Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "Dissociation by FACS into single cells", + "protocol_description": "Dissociation by FACS into single cells", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "dissociation_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "provenance": { + "document_id": "920078d0-b17e-4f23-8cf6-0674b19e7bec", + "submission_date": "2018-10-07T11:58:47.100Z", + "update_date": "2018-10-07T11:58:50.432Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_2", + "protocol_name": "TEMRA Enrichment", + "protocol_description": "For single-cell RNA-seq experiments, live and singlet gated cells were further gated to sort 1) TCM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7+, 2) TEM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7-, 3) TEMRA; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-, 4) IL-7Rhigh TEMRA (CD4-CTL precursors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-CD127high, 5) IL-7R- TEMRA (CD4-CTL effectors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7- CD127-. Single cells were directly sorted into 96 well plate with lysis buffer for downstream processing using Smart-seq2 method", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "markers": "CD3+ CD4+ CD8alpha/CD14/CD19- CD45RA+ CCR7-", + "provenance": { + "document_id": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227", + "submission_date": "2018-10-07T11:58:47.120Z", + "update_date": "2018-10-07T11:58:50.413Z" + } + }, + "collection_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.6/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "collection_protocol_2", + "protocol_name": "Blood sample collection", + "protocol_description": "Blood sample collection by blood draw", + "publication_doi": "10.1126/sciimmunol.aan8664" + }, + "collection_method": { + "text": "blood draw", + "ontology": "EFO:0009121" + }, + "provenance": { + "document_id": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4", + "submission_date": "2018-10-07T11:58:47.087Z", + "update_date": "2018-10-07T11:58:50.563Z" + } + }, + "enrichment_protocol_1.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_1", + "protocol_name": "PBMC Enrichment", + "protocol_description": "Enrichment for peripheral blood mononuclear cells", + "publication_doi": "10.1073/pnas.1305227110" + }, + "enrichment_method": { + "text": "Ficoll-Hypaque method", + "ontology": "EFO:0009110" + }, + "provenance": { + "document_id": "9ab53e6a-464e-44b1-aa24-12daca989969", + "submission_date": "2018-10-07T11:58:47.110Z", + "update_date": "2018-10-07T11:58:50.474Z" + } + }, + "process_0.json": { + "insdc_experiment": { + "insdc_experiment": "SRX3366459" + }, + "process_core": { + "process_id": "process_id_4499" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "18d49b08-d095-4371-bb34-151037f9f461", + "submission_date": "2018-10-07T12:00:39.740Z", + "update_date": "2018-10-07T12:08:28.754Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_2255" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", + "submission_date": "2018-10-07T11:59:45.914Z", + "update_date": "2018-10-07T12:06:52.636Z" + } + }, + "process_2.json": { + "process_core": { + "process_location": "Sri Lanka", + "process_id": "process_id_15" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", + "provenance": { + "document_id": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", + "submission_date": "2018-10-07T11:58:47.999Z", + "update_date": "2018-10-07T12:05:17.018Z" + } + }, + "links.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/system/1.1.3/links", + "schema_type": "link_bundle", + "schema_version": "1.1.3", + "links": [ + { + "process": "18d49b08-d095-4371-bb34-151037f9f461", + "inputs": [ + "ef97eef1-a436-4462-a152-1a2b86ee8831" + ], + "input_type": "biomaterial", + "outputs": [ + "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "d678165b-2753-4393-bf3b-5e2a09ba892c" + } + ] + }, + { + "process": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", + "inputs": [ + "80cb479b-dcb4-4dbb-a75d-0249a964bb70" + ], + "input_type": "biomaterial", + "outputs": [ + "ef97eef1-a436-4462-a152-1a2b86ee8831" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "920078d0-b17e-4f23-8cf6-0674b19e7bec" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227" + } + ] + }, + { + "process": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", + "inputs": [ + "6c992ba4-c132-4dd3-840e-13cf3f38243e" + ], + "input_type": "biomaterial", + "outputs": [ + "80cb479b-dcb4-4dbb-a75d-0249a964bb70" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "9ab53e6a-464e-44b1-aa24-12daca989969" + } + ] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/manifest.json b/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/manifest.json deleted file mode 100644 index 278d9f55b..000000000 --- a/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/manifest.json +++ /dev/null @@ -1,194 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "092b0c23", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "d20baf1781d6a8c71983c22438a36a1a", - "sha1": "ad19c4ec4b4cbc6efc2a381ac7a0d5f063d6f13d", - "sha256": "5719b272070a25297bebd02579b670ccfbe2cb481d3a2c25a5f973c5498e4864", - "size": 1085, - "uuid": "ef97eef1-a436-4462-a152-1a2b86ee8831", - "version": "2018-10-07T120446.292000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ac85eb5f", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "aa95222bb2d422ecda6506874ece3700", - "sha1": "734cc60ef29949d3fec6b401ddac0a99afcd39f7", - "sha256": "0e01cfbdc118c821473c8140a5c90ece30daac8fd515a0dd6ea7679a42a59829", - "size": 1103, - "uuid": "80cb479b-dcb4-4dbb-a75d-0249a964bb70", - "version": "2018-10-07T120139.672000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "84b139be", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "4d0a70ccd6bf3a6edcac6eea2a38c9e5", - "sha1": "315d282c7b29311fdf90e8a4e9731801b6472be7", - "sha256": "55d2a1ab247b3047dd9ed40764eeddf6d8db97e834043d34249bd7477fca6cd7", - "size": 1166, - "uuid": "6c992ba4-c132-4dd3-840e-13cf3f38243e", - "version": "2018-10-07T120040.749000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cbad3ef1", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "6259ed5a836550f3ab254427792e2b6b", - "sha1": "7812a833b008de1b4c18b4e3524afee0351f605f", - "sha256": "288a291d47730fd8dfd5b2f895f66957ddb344412de0dd7f02cdf3281353a93b", - "size": 523, - "uuid": "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27", - "version": "2018-10-07T120849.204000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "1b63912f", - "indexed": true, - "name": "project_0.json", - "s3_etag": "a281bf03ee65c12504c4400eb9483078", - "sha1": "ad001b59219e07a0d13ff9e1e79588e4989f828e", - "sha256": "58d4e558959ef2f4b45bb7ea6ff9fadec4e7c7eff8a67398846339151758cf40", - "size": 5236, - "uuid": "519b58ef-6462-4ed3-8c0d-375b54f53c31", - "version": "2018-10-07T120040.290000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "41491acc", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "eeb4e161fcc3e4b55807b63ebb6eb45f", - "sha1": "49f108ad2626b72eaaa4b5fb7f4032f7a0bd7e69", - "sha256": "bfded3b26644d5e6c5e6a85e7c55d56f94f7df33951a760d6d9fc4a97b13f62f", - "size": 1475, - "uuid": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5", - "version": "2018-10-07T115850.532000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "0c8996e6", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "871475e72700c0db371ca1bd12878eb2", - "sha1": "1f0420e95b82fb42f2649ab7cf5b82de94a25db7", - "sha256": "61f0562521612a3f67253786b52339f58e322f2c32919a530a1c6dfa0d1c7bde", - "size": 976, - "uuid": "d678165b-2753-4393-bf3b-5e2a09ba892c", - "version": "2018-10-07T115850.511000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "b7b8f50f", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "89bb2934dc767d1f8021c341841c998f", - "sha1": "87c1e866fc2f385a106b1d3a2182d96f7a664615", - "sha256": "cf7c8ef8ee28ec120c21ea5809011c9b8e333d10dfdb67cd982b11c86098145c", - "size": 763, - "uuid": "920078d0-b17e-4f23-8cf6-0674b19e7bec", - "version": "2018-10-07T115850.432000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "1649738e", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "d11ddb17081131e48c84f89661325d06", - "sha1": "5d8f8272cde4254663bf352cbf9e181dde9c6fee", - "sha256": "a54d7e50e1de03736b4a09026bb96252261ef9b025767e394bc81f8458da9bc8", - "size": 1302, - "uuid": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227", - "version": "2018-10-07T115850.413000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "076cf3c4", - "indexed": true, - "name": "collection_protocol_0.json", - "s3_etag": "4851e0601f479550bb68e6c1f92b15ce", - "sha1": "e3b0565d7dca00a513b607d8218f511ee27691c8", - "sha256": "33d5e07b7400680eb92c6c5aaa4c3dc6cee7b143f723dd86b5d137fcbf054c3e", - "size": 716, - "uuid": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4", - "version": "2018-10-07T115850.563000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "51f9d7f0", - "indexed": true, - "name": "enrichment_protocol_1.json", - "s3_etag": "055a83f481596882b8798897ee50d781", - "sha1": "9aa0c45b79a32c98ab6ea18b463d505662389a92", - "sha256": "cf117a6d17c1fcdc8780d7b877bae57f8e43d5873c92130157599bd0e403abf0", - "size": 728, - "uuid": "9ab53e6a-464e-44b1-aa24-12daca989969", - "version": "2018-10-07T115850.474000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "bec07d53", - "indexed": true, - "name": "process_0.json", - "s3_etag": "feed82fc2af4e32d7f91b029109d7860", - "sha1": "ab75c100a5336e0d69966303b88185008be48963", - "sha256": "75270eceb8c411a386f9793196cb96a23d9e644bb53a3925f863b475956e862a", - "size": 465, - "uuid": "18d49b08-d095-4371-bb34-151037f9f461", - "version": "2018-10-07T120828.754000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "5e38608b", - "indexed": true, - "name": "process_1.json", - "s3_etag": "c1b135ffd9ea0c6d0c8c70b3ad808ec3", - "sha1": "11a2ba86e5e6b994a993451cf54964c27c9edcce", - "sha256": "2e58428d74c3e07db41cbe954630ceb2e2840d822ba09ac7245b8ae8186dc482", - "size": 391, - "uuid": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", - "version": "2018-10-07T120652.636000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "078475f9", - "indexed": true, - "name": "process_2.json", - "s3_etag": "1c0345db2437b44dc1fcb017929e0461", - "sha1": "bbef6705b342d6be7b5b7860ee57a68c7524c769", - "sha256": "70a79f92be2a19ddd63fc4369c79770808072151396c3b88abbcfaa9edef50f8", - "size": 430, - "uuid": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", - "version": "2018-10-07T120517.018000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "56d56718", - "indexed": true, - "name": "links.json", - "s3_etag": "70623328382d0927e3242efc726fe29d", - "sha1": "a947b0283b948cf08e1197064506bfa2491d8b3a", - "sha256": "0bc6c6fa6a9093caddd8a4921826cd47c6a0773312cc62f51abcd55f93e52ecb", - "size": 2393, - "uuid": "a1681a39-e8d2-43f7-8781-ac4edab527fe", - "version": "2018-10-07T130110.624725Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "a3f89844", - "indexed": false, - "name": "SRR6260013.fastq.gz", - "s3_etag": "8c9bb4704875cbe67cfc12abb0c66d57", - "sha1": "ee681bf47c0b7fbad663b20704ddb45d632709ed", - "sha256": "3f50829dc75cbb1e5a95403fe59e1f3bc4e897e5fbf1bb3c5861854eafa5b84c", - "size": 38471612, - "uuid": "9dee7111-d743-43a1-b768-118614bf7987", - "version": "2018-10-07T130110.968810Z" - } -] diff --git a/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/metadata.json b/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/metadata.json deleted file mode 100644 index c3c7e596c..000000000 --- a/test/hca_metadata_api/cans/staging/68bdc676-c442-4581-923e-319c1c2d9018/2018-10-07T130111.835234Z/metadata.json +++ /dev/null @@ -1,476 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/8.6.1/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", - "biomaterial_name": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", - "biomaterial_description": "Single-cell_RNA-seq_Subject9_TEMRA_Cell030", - "ncbi_taxon_id": [ - 9606 - ], - "insdc_biomaterial": "SRS2664188" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "selected_cell_type": [ - { - "text": "TEMRA", - "ontology": "CL:0000625" - } - ], - "total_estimated_cells": 1, - "plate_based_sequencing": { - "plate_id": "subject9-10_batch1", - "cell_quality": "OK" - }, - "provenance": { - "document_id": "ef97eef1-a436-4462-a152-1a2b86ee8831", - "submission_date": "2018-10-07T11:57:52.282Z", - "update_date": "2018-10-07T12:04:46.292Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/6.3.3/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Subject9_DENV negative_PBMC_TEMRA", - "biomaterial_name": "Subject9_DENV negative_PBMC_TEMRA", - "biomaterial_description": "Subject9_DENV negative_PBMC_TEMRA", - "ncbi_taxon_id": [ - 9606 - ] - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "organ": { - "text": "blood", - "ontology": "UBERON:0000178" - }, - "organ_part": { - "text": "peripheral blood mononuclear cell", - "ontology": "CL:2000001" - }, - "preservation_storage": { - "preservation_method": "cryopreservation, other", - "storage_method": "frozen, liquid nitrogen" - }, - "provenance": { - "document_id": "80cb479b-dcb4-4dbb-a75d-0249a964bb70", - "submission_date": "2018-10-07T11:56:59.350Z", - "update_date": "2018-10-07T12:01:39.672Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/10.1.2/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Subject9", - "biomaterial_name": "Subject9", - "biomaterial_description": "Subject9", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "not provided" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606" - } - ], - "is_living": "yes", - "sex": "unknown", - "medical_history": { - "test_results": "dengue virus negative" - }, - "diseases": [ - { - "text": "normal", - "ontology": "PATO:0000461" - } - ], - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272" - }, - "organism_age": "18-60", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036" - }, - "provenance": { - "document_id": "6c992ba4-c132-4dd3-840e-13cf3f38243e", - "submission_date": "2018-10-07T11:56:59.023Z", - "update_date": "2018-10-07T12:00:40.749Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "SRR6260013.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "read_length": 50, - "insdc_run": [ - "SRR6260013" - ], - "provenance": { - "document_id": "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27", - "submission_date": "2018-10-07T11:58:46.814Z", - "update_date": "2018-10-07T12:08:49.204Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/project/9.0.3/project", - "schema_type": "project", - "project_core": { - "project_short_name": "CD4+ cytotoxic T lymphocytes", - "project_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis", - "project_description": "CD4+ cytotoxic T lymphocytes (CD4-CTLs) have been reported to play a protective role in several viral infections. However, little is known in humans about the biology of CD4-CTL generation, their functional properties, heterogeneity and clonal diversity, especially in relation to other well-described CD4+ memory T cell subsets. We performed single-cell RNA-seq in over 9000 cells to unravel CD4-CTL heterogeneity, transcriptional profile and clonality in humans. The single-cell differential gene expression analysis, revealed a spectrum of known transcripts, including several linked to cytotoxic and co-stimulatory function, and transcripts of unknown cytotoxicity-related function that are expressed at higher levels in the TEMRA subset, which is highly enriched for CD4-CTLs, compared to cells in the central and effector memory subsets (TCM, TEM). Simultaneous T cells antigen receptor (TCR) analysis in single-cells and bulk subsets revealed that CD4-TEMRA cells show marked clonal expansion compared to TCM and TEM cells and that the majority of CD4-TEMRA were dengue virus (DENV)-specific in subjects with previous DENV infection. The profile of CD4-TEMRA was highly heterogeneous across subjects, with four distinct clusters identified by the single-cell analysis. Most importantly, we identified distinct clusters of CD4-CTL effector and precursor cells in the TEMRA subset; the precursor cells shared TCR clonotypes with CD4-CTL effectors and were distinguished by high expression of the interleukin-7 receptor. Our identification of a CD4-CTL precursor population may allow further investigation of how CD4-CTLs arise in humans and thus could provide insights into the mechanisms that may be utilized to generate durable and effective CD4-CTL immunity." - }, - "insdc_project": "SRP124157", - "geo_series": "GSE106540", - "insdc_study": "PRJNA417191", - "supplementary_links": [ - "https://www.ebi.ac.uk/gxa/sc/experiments/E-GEOD-106540/Results" - ], - "contributors": [ - { - "contact_name": "Pandurangan,,Vijayanand", - "email": "vijay@lji.org", - "institution": "La Jolla Institute for Allergy and Immunology", - "laboratory": "Division of Vaccine Discovery", - "address": "La Jolla, CA 92037", - "country": "USA", - "corresponding_contributor": true - }, - { - "contact_name": "Mallory,Ann,Freeberg", - "email": "mfreeberg@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Human Cell Atlas Data Coordination Platform", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "Human Cell Atlas wrangler", - "orcid_id": "0000-0003-2949-3921", - "corresponding_contributor": false - }, - { - "contact_name": "Laura,,Huerta", - "email": "lauhuema@ebi.ac.uk", - "institution": "EMBL-EBI", - "laboratory": "Molecular Atlas", - "address": "Wellcome Trust Genome Campus, Cambridge UK", - "country": "UK", - "project_role": "external curator", - "orcid_id": "0000-0002-8748-599X", - "corresponding_contributor": false - } - ], - "funders": [ - { - "grant_id": "U19AI118626", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "U19AI118610", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "R01HL114093", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "grant_id": "R24AI108564", - "funder_name": "National Institutes of Health (NIH)" - }, - { - "funder_name": "William K. Bowes Jr. Foundation" - } - ], - "publications": [ - { - "authors": [ - "Patil VS", - "Madrigal A", - "Schmiedel BJ", - "Clarke J", - "ORourke P", - "Harris E", - "de Silva AD", - "Harris E", - "Peters B", - "Seumois G", - "Weiskopf D", - "Sette A", - "Vijayanand P" - ], - "publication_title": "Precursors of human CD4+ cytotoxic T lymphocytes identified by single-cell transcriptome analysis.", - "doi": "10.1126/sciimmunol.aan8664", - "pmid": 29352091, - "publication_url": "http://immunology.sciencemag.org/content/3/19/eaan8664.long" - } - ], - "provenance": { - "document_id": "519b58ef-6462-4ed3-8c0d-375b54f53c31", - "submission_date": "2018-10-07T11:56:58.869Z", - "update_date": "2018-10-07T12:00:40.290Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.3.3/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "library_preparation_protocol_1", - "protocol_name": "Preparation of mRNAs for single cell SmartSeq2 sequencing", - "protocol_description": "Single cell RNAseq was performed as described in Picelli et al.Nat Protoc. 2014, PMID:24385147. We performed 23 cycles of amplification. Barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) were prepared as following manufacturers protocol.", - "publication_doi": "10.1038/nprot.2014.006" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "nucleic_acid_source": "single cell", - "end_bias": "full length", - "primer": "poly-dT", - "strand": "unstranded", - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869" - }, - "library_construction_kit": { - "retail_name": "Nextera XT library preparation kit", - "manufacturer": "Illumina" - }, - "library_preamplification_method": { - "text": "PCR", - "ontology": "OBI:0000415" - }, - "provenance": { - "document_id": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5", - "submission_date": "2018-10-07T11:58:47.200Z", - "update_date": "2018-10-07T11:58:50.532Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.2/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "SmartSeq 2 single cell sequencing", - "protocol_description": "Libraries were sequenced on the Illumina HiSeq 2500 platform to obtain 50-bp single end reads (barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina))." - }, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565" - }, - "paired_end": false, - "provenance": { - "document_id": "d678165b-2753-4393-bf3b-5e2a09ba892c", - "submission_date": "2018-10-07T11:58:47.211Z", - "update_date": "2018-10-07T11:58:50.511Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.3/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "Dissociation by FACS into single cells", - "protocol_description": "Dissociation by FACS into single cells", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "dissociation_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "provenance": { - "document_id": "920078d0-b17e-4f23-8cf6-0674b19e7bec", - "submission_date": "2018-10-07T11:58:47.100Z", - "update_date": "2018-10-07T11:58:50.432Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_2", - "protocol_name": "TEMRA Enrichment", - "protocol_description": "For single-cell RNA-seq experiments, live and singlet gated cells were further gated to sort 1) TCM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7+, 2) TEM; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA-CCR7-, 3) TEMRA; CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-, 4) IL-7Rhigh TEMRA (CD4-CTL precursors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7-CD127high, 5) IL-7R- TEMRA (CD4-CTL effectors); CD3+CD4+CD8\u03b1/CD14/CD19-CD45RA+CCR7- CD127-. Single cells were directly sorted into 96 well plate with lysis buffer for downstream processing using Smart-seq2 method", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "markers": "CD3+ CD4+ CD8alpha/CD14/CD19- CD45RA+ CCR7-", - "provenance": { - "document_id": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227", - "submission_date": "2018-10-07T11:58:47.120Z", - "update_date": "2018-10-07T11:58:50.413Z" - } - }, - "collection_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.6/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "collection_protocol_2", - "protocol_name": "Blood sample collection", - "protocol_description": "Blood sample collection by blood draw", - "publication_doi": "10.1126/sciimmunol.aan8664" - }, - "collection_method": { - "text": "blood draw", - "ontology": "EFO:0009121" - }, - "provenance": { - "document_id": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4", - "submission_date": "2018-10-07T11:58:47.087Z", - "update_date": "2018-10-07T11:58:50.563Z" - } - }, - "enrichment_protocol_1.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.5/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_1", - "protocol_name": "PBMC Enrichment", - "protocol_description": "Enrichment for peripheral blood mononuclear cells", - "publication_doi": "10.1073/pnas.1305227110" - }, - "enrichment_method": { - "text": "Ficoll-Hypaque method", - "ontology": "EFO:0009110" - }, - "provenance": { - "document_id": "9ab53e6a-464e-44b1-aa24-12daca989969", - "submission_date": "2018-10-07T11:58:47.110Z", - "update_date": "2018-10-07T11:58:50.474Z" - } - }, - "process_0.json": { - "insdc_experiment": { - "insdc_experiment": "SRX3366459" - }, - "process_core": { - "process_id": "process_id_4499" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "18d49b08-d095-4371-bb34-151037f9f461", - "submission_date": "2018-10-07T12:00:39.740Z", - "update_date": "2018-10-07T12:08:28.754Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_2255" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", - "submission_date": "2018-10-07T11:59:45.914Z", - "update_date": "2018-10-07T12:06:52.636Z" - } - }, - "process_2.json": { - "process_core": { - "process_location": "Sri Lanka", - "process_id": "process_id_15" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.2/process", - "provenance": { - "document_id": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", - "submission_date": "2018-10-07T11:58:47.999Z", - "update_date": "2018-10-07T12:05:17.018Z" - } - }, - "links.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/system/1.1.3/links", - "schema_type": "link_bundle", - "schema_version": "1.1.3", - "links": [ - { - "process": "18d49b08-d095-4371-bb34-151037f9f461", - "inputs": [ - "ef97eef1-a436-4462-a152-1a2b86ee8831" - ], - "input_type": "biomaterial", - "outputs": [ - "f3d5c7cb-7ab4-4903-8e0e-dc942121fe27" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "5f82b9c4-f3d7-410c-b843-0e5cdec9efa5" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "d678165b-2753-4393-bf3b-5e2a09ba892c" - } - ] - }, - { - "process": "d13a5a85-b8c7-4a07-9c0c-9180bd0a78eb", - "inputs": [ - "80cb479b-dcb4-4dbb-a75d-0249a964bb70" - ], - "input_type": "biomaterial", - "outputs": [ - "ef97eef1-a436-4462-a152-1a2b86ee8831" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "920078d0-b17e-4f23-8cf6-0674b19e7bec" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "644c5f2d-33c8-4bf4-b411-b2dbec8b8227" - } - ] - }, - { - "process": "5a15ed38-5e37-44ff-ba35-0d17bb8564bd", - "inputs": [ - "6c992ba4-c132-4dd3-840e-13cf3f38243e" - ], - "input_type": "biomaterial", - "outputs": [ - "80cb479b-dcb4-4dbb-a75d-0249a964bb70" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "403b586f-fd8d-45f2-a431-4bb6cc33d7d4" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "9ab53e6a-464e-44b1-aa24-12daca989969" - } - ] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab.2018-09-05T182535.846470Z.json b/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab.2018-09-05T182535.846470Z.json new file mode 100644 index 000000000..15a52e8e6 --- /dev/null +++ b/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab.2018-09-05T182535.846470Z.json @@ -0,0 +1,501 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "d4f5cd12", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "5e8254dfdffffd29565733dd2cfffcaa", + "sha1": "0781fe1a5664f0c551a2f1abb2405b42e545ba2f", + "sha256": "18a711089e7e7521167480ff618cbe359a3ead6acfb9042e95345c7d4e361330", + "size": 483, + "uuid": "a31a0e93-5be4-44b8-b152-9e25b066e1e5", + "version": "2018-09-05T182529.829436Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "3a5dcf9f", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "bab34095b45b908e90af42b38a100610", + "sha1": "351a584cf4b86f310e342e4b1aee46ee9c7ed4ee", + "sha256": "fc5db431a010774ea3f44b550f40d2506cbef3333234a6f97925d3fa06856152", + "size": 979, + "uuid": "e964f81f-54d9-4600-a9e9-981b1f1a6ca2", + "version": "2018-09-05T182530.509615Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "b2a8ddd4", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "64a3df1095f7ad856316df6a7cc3769b", + "sha1": "0c5fdd8242ca2b47ab6b45588499756b3792adcd", + "sha256": "4e37a6623bf54545f79e81c1f00138b097f1bf9effff5b8779cc7aab05a90172", + "size": 720, + "uuid": "c6001597-990c-4753-80bb-c5a01c9dda0d", + "version": "2018-09-05T182530.753141Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "07762f9b", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "e080db2a9bad61cc224b431bc19d6ee1", + "sha1": "50acb0b71506f7d33e21a569a8c948de0d2ffa0d", + "sha256": "6d85b91099ccf7cc0885b7768a4ad0bba1976142607febeae3a126fb3f49d822", + "size": 466, + "uuid": "20474552-c0a3-471e-8fa0-d3c5aa05c017", + "version": "2018-09-05T182531.434373Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a48d67f8", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "42558005fcec60f60eba431070911579", + "sha1": "74b69311babd0340193b2a7badf95933da48ed13", + "sha256": "ae586e31de46482795e445d86b72a64445dffbda6caf63eee9f030e0fbbc42e4", + "size": 466, + "uuid": "177a9d2c-99d4-4fb6-aab7-5869923e9d6a", + "version": "2018-09-05T182531.758479Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "cb5778fc", + "indexed": true, + "name": "project_0.json", + "s3_etag": "59ff33c4be479e7d1e533f4226eee790", + "sha1": "773758a3ad93e4739b8b2b95d62dfaa2f34b96b1", + "sha256": "13b631dd0391b76855ab62813b9b89ff266505c1a32d3fd25b37f6b863696331", + "size": 3447, + "uuid": "bedfd14f-cc98-4142-b627-d44dfec5aced", + "version": "2018-09-05T182532.053288Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "7991780e", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "971b2da85e96e0e0c97c32961e5a7759", + "sha1": "7b28867a79c2ebee2d65c36e25b7ea2fc1e2f184", + "sha256": "26f468e4b48171408932bedeba4d566ad0f90bce485e901f979056231f99da78", + "size": 737, + "uuid": "f77e65be-ca7a-4711-a7a9-701ad372901a", + "version": "2018-09-05T182532.367703Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "8f1349fc", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "0580202fa550118fbf296ff1e7be07c7", + "sha1": "c61aea8b5343c254384ecc8c2e1068ba03f5c68d", + "sha256": "35be2f7be3b0f668fbf6266670659a56c438fb3c92321647c177f62a3ebb8ee3", + "size": 646, + "uuid": "9d3c0c92-2716-410b-85c6-963a29c24fe0", + "version": "2018-09-05T182532.806226Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "9d493dd1", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "fe728c06f0155a281a7cd7c262e67576", + "sha1": "a887d082c83bbebfd86921ecbc3d0fcdc5cdf938", + "sha256": "cdf539ca7aa9daf909e1aaeec294da31d4cb9180db3f3a6a91ba8089701b2fab", + "size": 616, + "uuid": "d08422cf-7d04-46cd-9452-394bb2864ba7", + "version": "2018-09-05T182533.118298Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "87ed3a2e", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "cba92494442a5fed8fe32c90c007845d", + "sha1": "798f4e6b3408538d1d6fb34a39cbcff5e3652634", + "sha256": "d7489161783fbb31702e8b42d00e9783cdf89f879d3606a48d9fca668c382ea2", + "size": 549, + "uuid": "f3304cfe-c133-444c-a2db-92294d3f6a4d", + "version": "2018-09-05T182533.623990Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "7e86bd3e", + "indexed": true, + "name": "process_0.json", + "s3_etag": "cde6f57b10bbf2fd2ef0d113b1f1ba46", + "sha1": "04e75ecff86fd496a46893fca40a94f69ca08ab0", + "sha256": "ca18f50c068bf1e4dccc425eb04396f2f3970e5ae45de5d90339bb1fdd961e71", + "size": 399, + "uuid": "bf7360ae-511e-4803-821e-c03167107588", + "version": "2018-09-05T182533.917284Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "b4aa6e39", + "indexed": true, + "name": "process_1.json", + "s3_etag": "2346a2c4650ff05cd589aa7c0ece8684", + "sha1": "e41eeef27f8064a47fb575a2e367cf2a23075069", + "sha256": "d8681a89bfd3d0a4491e4bed969683f7bf69868d1fd132afdb4d109812455ca9", + "size": 388, + "uuid": "b78f4279-9c6f-49da-890f-98499d8fb84a", + "version": "2018-09-05T182534.250294Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "51ee448d", + "indexed": true, + "name": "process_2.json", + "s3_etag": "636cdff0ff32a4802c1a553fc8eae22b", + "sha1": "818b0e257652e179fe023945117b89e16b3ba807", + "sha256": "faaeaab765ff6dd7cfbfb42bd4b276f85222bd635c595429ec6ab9c5f4efbdf1", + "size": 388, + "uuid": "6284381f-de72-4015-ae51-fa17e13677f8", + "version": "2018-09-05T182534.886667Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "ac18a06b", + "indexed": true, + "name": "links.json", + "s3_etag": "46cce577c8cfc281c8e33233f0366f99", + "sha1": "da4381b79641d4de4fe15ff2e7385aa75b79d79f", + "sha256": "0d881b169fbc809219d9eaf6b1c77349b9bbd298ac5c7ce9714517f01ca47a0b", + "size": 2095, + "uuid": "d33848ba-a9f8-4aa9-a72c-26755f0273d1", + "version": "2018-09-05T182535.148513Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "4ef74578", + "indexed": false, + "name": "R1.fastq.gz", + "s3_etag": "c7bbee4c46bbf29432862e05830c8f39", + "sha1": "17f8b4be0cc6e8281a402bb365b1283b458906a3", + "sha256": "fe6d4fdfea2ff1df97500dcfe7085ac3abfb760026bff75a34c20fb97a4b2b29", + "size": 125191, + "uuid": "2580e8f2-f2f8-4292-b14d-c9ae8bd25a4e", + "version": "2018-09-05T182535.418417Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "69987b3e", + "indexed": false, + "name": "R2.fastq.gz", + "s3_etag": "a3a9f23d07cfc5e40a4c3a8adf3903ae", + "sha1": "f166b6952e30a41e1409e7fb0cb0fb1ad93f3f21", + "sha256": "c305bee37b3c3735585e11306272b6ab085f04cd22ea8703957b4503488cfeba", + "size": 130024, + "uuid": "a53ef014-85f1-4ea8-b24a-454328724e77", + "version": "2018-09-05T182535.627826Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/8.4.0/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Q4_DEMO-cellsus_SAMN02797092", + "ncbi_taxon_id": [ + 9606 + ] + }, + "provenance": { + "document_id": "a31a0e93-5be4-44b8-b152-9e25b066e1e5", + "submission_date": "2018-09-05T18:24:05.915Z", + "update_date": "2018-09-05T18:24:09.865Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/6.2.7/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Q4_DEMO-sample_SAMN02797092", + "biomaterial_name": "Q4_DEMO-Single cell mRNA-seq_MGH30_A01", + "ncbi_taxon_id": [ + 9606 + ], + "supplementary_files": [ + "Q4_DEMO-protocol" + ] + }, + "genus_species": [ + { + "text": "Homo sapiens" + } + ], + "organ": { + "text": "brain", + "ontology": "UBERON:0000955" + }, + "organ_part": { + "text": "temporal lobe", + "ontology": "UBERON:0001871" + }, + "disease": [ + { + "text": "glioblastoma" + } + ], + "provenance": { + "document_id": "e964f81f-54d9-4600-a9e9-981b1f1a6ca2", + "submission_date": "2018-09-05T18:24:05.907Z", + "update_date": "2018-09-05T18:24:10.111Z" + } + }, + "donor_organism_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/10.0.0/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "Q4_DEMO-donor_MGH30", + "biomaterial_name": "Q4 DEMO donor MGH30", + "ncbi_taxon_id": [ + 9606 + ] + }, + "medical_history": { + "smoking_history": "yes" + }, + "genus_species": [ + { + "text": "Homo sapiens" + } + ], + "is_living": "no", + "sex": "unknown", + "provenance": { + "document_id": "c6001597-990c-4753-80bb-c5a01c9dda0d", + "submission_date": "2018-09-05T18:24:05.892Z", + "update_date": "2018-09-05T18:24:09.957Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "R1.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read1", + "lane_index": 1, + "provenance": { + "document_id": "20474552-c0a3-471e-8fa0-d3c5aa05c017", + "submission_date": "2018-09-05T18:24:05.950Z", + "update_date": "2018-09-05T18:25:10.415Z" + } + }, + "sequence_file_1.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.0/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "R2.fastq.gz", + "file_format": "fastq.gz" + }, + "read_index": "read2", + "lane_index": 1, + "provenance": { + "document_id": "177a9d2c-99d4-4fb6-aab7-5869923e9d6a", + "submission_date": "2018-09-05T18:24:05.995Z", + "update_date": "2018-09-05T18:25:10.316Z" + } + }, + "project_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/project/9.0.0/project", + "schema_type": "project", + "project_core": { + "project_short_name": "integration/Smart-seq2/2018-09-05T18:24:03Z", + "project_title": "Q4_DEMO-Single cell RNA-seq of primary human glioblastomas", + "project_description": "Q4_DEMO-We report transcriptomes from 430 single glioblastoma cells isolated from 5 individual tumors and 102 single cells from gliomasphere cells lines generated using SMART-seq. In addition, we report population RNA-seq from the five tumors as well as RNA-seq from cell lines derived from 3 tumors (MGH26, MGH28, MGH31) cultured under serum free (GSC) and differentiated (DGC) conditions. This dataset highlights intratumoral heterogeneity with regards to the expression of de novo derived transcriptional modules and established subtype classifiers. Overall design: Operative specimens from five glioblastoma patients (MGH26, MGH28, MGH29, MGH30, MGH31) were acutely dissociated, depleted for CD45+ inflammatory cells and then sorted as single cells (576 samples). Population controls for each tumor were isolated by sorting 2000-10000 cells and processed in parallel (5 population control samples). Single cells from two established cell lines, GBM6 and GBM8, were also sorted as single cells (192 samples). SMART-seq protocol was implemented to generate single cell full length transcriptomes (modified from Shalek, et al Nature 2013) and sequenced using 25 bp paired end reads. Single cell cDNA libraries for MGH30 were resequenced using 100 bp paired end reads to allow for isoform and splice junction reconstruction (96 samples, annotated MGH30L). Cells were also cultured in serum free conditions to generate gliomasphere cell lines for MGH26, MGH28, and MGH31 (GSC) which were then differentiated using 10% serum (DGC). Population RNA-seq was performed on these samples (3 GSC, 3 DGC, 6 total). The initial dataset included 875 RNA-seq libraries (576 single glioblastoma cells, 96 resequenced MGH30L, 192 single gliomasphere cells, 5 tumor population controls, 6 population libraries from GSC and DGC samples). Data was processed as described below using RSEM for quantification of gene expression. 5,948 genes with the highest composite expression either across all single cells combined (average log2(TPM)>4.5) or within a single tumor (average log2(TPM)>6 in at least one tumor) were included. Cells expressing less than 2,000 of these 5,948 genes were excluded. The final processed dataset then included 430 primary single cell glioblastoma transcriptomes, 102 single cell transcriptomes from cell lines(GBM6,GBM8), 5 population controls (1 for each tumor), and 6 population libraries from cell lines derived from the tumors (GSC and DGC for MGH26, MGH28 and MGH31). The final matrix (GBM_data_matrix.txt) therefore contains 5948 rows (genes) quantified in 543 samples (columns). Please note that the samples which are not included in the data processing are indicated in the sample description field." + }, + "contributors": [ + { + "contact_name": "Q4_DEMO-MintTeam", + "email": "dummy@email.com", + "institution": "Fake Institution" + } + ], + "provenance": { + "document_id": "bedfd14f-cc98-4142-b627-d44dfec5aced", + "submission_date": "2018-09-05T18:24:05.880Z", + "update_date": "2018-09-05T18:24:10.105Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.3.0/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "preparation1" + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA" + }, + "library_construction_approach": { + "text": "Smart-seq2", + "ontology": "EFO:0008931" + }, + "nucleic_acid_source": "single cell", + "end_bias": "5 prime end bias", + "primer": "poly-dT", + "strand": "unstranded", + "provenance": { + "document_id": "f77e65be-ca7a-4711-a7a9-701ad372901a", + "submission_date": "2018-09-05T18:24:06.041Z", + "update_date": "2018-09-05T18:24:09.959Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.0/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "assay_1" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500" + }, + "paired_end": true, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441" + }, + "provenance": { + "document_id": "9d3c0c92-2716-410b-85c6-963a29c24fe0", + "submission_date": "2018-09-05T18:24:06.050Z", + "update_date": "2018-09-05T18:24:09.960Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.1/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_1", + "protocol_name": "a FACS method to separate cells" + }, + "dissociation_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "provenance": { + "document_id": "d08422cf-7d04-46cd-9452-394bb2864ba7", + "submission_date": "2018-09-05T18:24:06.024Z", + "update_date": "2018-09-05T18:24:10.036Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.3/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment1" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108" + }, + "provenance": { + "document_id": "f3304cfe-c133-444c-a2db-92294d3f6a4d", + "submission_date": "2018-09-05T18:24:06.033Z", + "update_date": "2018-09-05T18:24:09.887Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "sequence_process_file_1" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", + "provenance": { + "document_id": "bf7360ae-511e-4803-821e-c03167107588", + "submission_date": "2018-09-05T18:24:06.090Z", + "update_date": "2018-09-05T18:24:09.872Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_2" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", + "provenance": { + "document_id": "b78f4279-9c6f-49da-890f-98499d8fb84a", + "submission_date": "2018-09-05T18:24:06.079Z", + "update_date": "2018-09-05T18:24:09.856Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", + "provenance": { + "document_id": "6284381f-de72-4015-ae51-fa17e13677f8", + "submission_date": "2018-09-05T18:24:06.058Z", + "update_date": "2018-09-05T18:24:09.861Z" + } + }, + "links.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/system/1.1.1/links", + "schema_type": "link_bundle", + "schema_version": "1.1.1", + "links": [ + { + "process": "bf7360ae-511e-4803-821e-c03167107588", + "inputs": [ + "a31a0e93-5be4-44b8-b152-9e25b066e1e5" + ], + "input_type": "biomaterial", + "outputs": [ + "20474552-c0a3-471e-8fa0-d3c5aa05c017", + "177a9d2c-99d4-4fb6-aab7-5869923e9d6a" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "f77e65be-ca7a-4711-a7a9-701ad372901a" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "9d3c0c92-2716-410b-85c6-963a29c24fe0" + } + ] + }, + { + "process": "b78f4279-9c6f-49da-890f-98499d8fb84a", + "inputs": [ + "e964f81f-54d9-4600-a9e9-981b1f1a6ca2" + ], + "input_type": "biomaterial", + "outputs": [ + "a31a0e93-5be4-44b8-b152-9e25b066e1e5" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "d08422cf-7d04-46cd-9452-394bb2864ba7" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "f3304cfe-c133-444c-a2db-92294d3f6a4d" + } + ] + }, + { + "process": "6284381f-de72-4015-ae51-fa17e13677f8", + "inputs": [ + "c6001597-990c-4753-80bb-c5a01c9dda0d" + ], + "input_type": "biomaterial", + "outputs": [ + "e964f81f-54d9-4600-a9e9-981b1f1a6ca2" + ], + "output_type": "biomaterial", + "protocols": [] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/manifest.json b/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/manifest.json deleted file mode 100644 index 781d94c59..000000000 --- a/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/manifest.json +++ /dev/null @@ -1,194 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "d4f5cd12", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "5e8254dfdffffd29565733dd2cfffcaa", - "sha1": "0781fe1a5664f0c551a2f1abb2405b42e545ba2f", - "sha256": "18a711089e7e7521167480ff618cbe359a3ead6acfb9042e95345c7d4e361330", - "size": 483, - "uuid": "a31a0e93-5be4-44b8-b152-9e25b066e1e5", - "version": "2018-09-05T182529.829436Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "3a5dcf9f", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "bab34095b45b908e90af42b38a100610", - "sha1": "351a584cf4b86f310e342e4b1aee46ee9c7ed4ee", - "sha256": "fc5db431a010774ea3f44b550f40d2506cbef3333234a6f97925d3fa06856152", - "size": 979, - "uuid": "e964f81f-54d9-4600-a9e9-981b1f1a6ca2", - "version": "2018-09-05T182530.509615Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "b2a8ddd4", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "64a3df1095f7ad856316df6a7cc3769b", - "sha1": "0c5fdd8242ca2b47ab6b45588499756b3792adcd", - "sha256": "4e37a6623bf54545f79e81c1f00138b097f1bf9effff5b8779cc7aab05a90172", - "size": 720, - "uuid": "c6001597-990c-4753-80bb-c5a01c9dda0d", - "version": "2018-09-05T182530.753141Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "07762f9b", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "e080db2a9bad61cc224b431bc19d6ee1", - "sha1": "50acb0b71506f7d33e21a569a8c948de0d2ffa0d", - "sha256": "6d85b91099ccf7cc0885b7768a4ad0bba1976142607febeae3a126fb3f49d822", - "size": 466, - "uuid": "20474552-c0a3-471e-8fa0-d3c5aa05c017", - "version": "2018-09-05T182531.434373Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a48d67f8", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "42558005fcec60f60eba431070911579", - "sha1": "74b69311babd0340193b2a7badf95933da48ed13", - "sha256": "ae586e31de46482795e445d86b72a64445dffbda6caf63eee9f030e0fbbc42e4", - "size": 466, - "uuid": "177a9d2c-99d4-4fb6-aab7-5869923e9d6a", - "version": "2018-09-05T182531.758479Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "cb5778fc", - "indexed": true, - "name": "project_0.json", - "s3_etag": "59ff33c4be479e7d1e533f4226eee790", - "sha1": "773758a3ad93e4739b8b2b95d62dfaa2f34b96b1", - "sha256": "13b631dd0391b76855ab62813b9b89ff266505c1a32d3fd25b37f6b863696331", - "size": 3447, - "uuid": "bedfd14f-cc98-4142-b627-d44dfec5aced", - "version": "2018-09-05T182532.053288Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "7991780e", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "971b2da85e96e0e0c97c32961e5a7759", - "sha1": "7b28867a79c2ebee2d65c36e25b7ea2fc1e2f184", - "sha256": "26f468e4b48171408932bedeba4d566ad0f90bce485e901f979056231f99da78", - "size": 737, - "uuid": "f77e65be-ca7a-4711-a7a9-701ad372901a", - "version": "2018-09-05T182532.367703Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "8f1349fc", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "0580202fa550118fbf296ff1e7be07c7", - "sha1": "c61aea8b5343c254384ecc8c2e1068ba03f5c68d", - "sha256": "35be2f7be3b0f668fbf6266670659a56c438fb3c92321647c177f62a3ebb8ee3", - "size": 646, - "uuid": "9d3c0c92-2716-410b-85c6-963a29c24fe0", - "version": "2018-09-05T182532.806226Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "9d493dd1", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "fe728c06f0155a281a7cd7c262e67576", - "sha1": "a887d082c83bbebfd86921ecbc3d0fcdc5cdf938", - "sha256": "cdf539ca7aa9daf909e1aaeec294da31d4cb9180db3f3a6a91ba8089701b2fab", - "size": 616, - "uuid": "d08422cf-7d04-46cd-9452-394bb2864ba7", - "version": "2018-09-05T182533.118298Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "87ed3a2e", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "cba92494442a5fed8fe32c90c007845d", - "sha1": "798f4e6b3408538d1d6fb34a39cbcff5e3652634", - "sha256": "d7489161783fbb31702e8b42d00e9783cdf89f879d3606a48d9fca668c382ea2", - "size": 549, - "uuid": "f3304cfe-c133-444c-a2db-92294d3f6a4d", - "version": "2018-09-05T182533.623990Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "7e86bd3e", - "indexed": true, - "name": "process_0.json", - "s3_etag": "cde6f57b10bbf2fd2ef0d113b1f1ba46", - "sha1": "04e75ecff86fd496a46893fca40a94f69ca08ab0", - "sha256": "ca18f50c068bf1e4dccc425eb04396f2f3970e5ae45de5d90339bb1fdd961e71", - "size": 399, - "uuid": "bf7360ae-511e-4803-821e-c03167107588", - "version": "2018-09-05T182533.917284Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "b4aa6e39", - "indexed": true, - "name": "process_1.json", - "s3_etag": "2346a2c4650ff05cd589aa7c0ece8684", - "sha1": "e41eeef27f8064a47fb575a2e367cf2a23075069", - "sha256": "d8681a89bfd3d0a4491e4bed969683f7bf69868d1fd132afdb4d109812455ca9", - "size": 388, - "uuid": "b78f4279-9c6f-49da-890f-98499d8fb84a", - "version": "2018-09-05T182534.250294Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "51ee448d", - "indexed": true, - "name": "process_2.json", - "s3_etag": "636cdff0ff32a4802c1a553fc8eae22b", - "sha1": "818b0e257652e179fe023945117b89e16b3ba807", - "sha256": "faaeaab765ff6dd7cfbfb42bd4b276f85222bd635c595429ec6ab9c5f4efbdf1", - "size": 388, - "uuid": "6284381f-de72-4015-ae51-fa17e13677f8", - "version": "2018-09-05T182534.886667Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "ac18a06b", - "indexed": true, - "name": "links.json", - "s3_etag": "46cce577c8cfc281c8e33233f0366f99", - "sha1": "da4381b79641d4de4fe15ff2e7385aa75b79d79f", - "sha256": "0d881b169fbc809219d9eaf6b1c77349b9bbd298ac5c7ce9714517f01ca47a0b", - "size": 2095, - "uuid": "d33848ba-a9f8-4aa9-a72c-26755f0273d1", - "version": "2018-09-05T182535.148513Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "4ef74578", - "indexed": false, - "name": "R1.fastq.gz", - "s3_etag": "c7bbee4c46bbf29432862e05830c8f39", - "sha1": "17f8b4be0cc6e8281a402bb365b1283b458906a3", - "sha256": "fe6d4fdfea2ff1df97500dcfe7085ac3abfb760026bff75a34c20fb97a4b2b29", - "size": 125191, - "uuid": "2580e8f2-f2f8-4292-b14d-c9ae8bd25a4e", - "version": "2018-09-05T182535.418417Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "69987b3e", - "indexed": false, - "name": "R2.fastq.gz", - "s3_etag": "a3a9f23d07cfc5e40a4c3a8adf3903ae", - "sha1": "f166b6952e30a41e1409e7fb0cb0fb1ad93f3f21", - "sha256": "c305bee37b3c3735585e11306272b6ab085f04cd22ea8703957b4503488cfeba", - "size": 130024, - "uuid": "a53ef014-85f1-4ea8-b24a-454328724e77", - "version": "2018-09-05T182535.627826Z" - } -] diff --git a/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/metadata.json b/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/metadata.json deleted file mode 100644 index 5d79269d7..000000000 --- a/test/hca_metadata_api/cans/staging/70184761-70fc-4b80-8c48-f406a478d5ab/2018-09-05T182535.846470Z/metadata.json +++ /dev/null @@ -1,305 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/8.4.0/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Q4_DEMO-cellsus_SAMN02797092", - "ncbi_taxon_id": [ - 9606 - ] - }, - "provenance": { - "document_id": "a31a0e93-5be4-44b8-b152-9e25b066e1e5", - "submission_date": "2018-09-05T18:24:05.915Z", - "update_date": "2018-09-05T18:24:09.865Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/6.2.7/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Q4_DEMO-sample_SAMN02797092", - "biomaterial_name": "Q4_DEMO-Single cell mRNA-seq_MGH30_A01", - "ncbi_taxon_id": [ - 9606 - ], - "supplementary_files": [ - "Q4_DEMO-protocol" - ] - }, - "genus_species": [ - { - "text": "Homo sapiens" - } - ], - "organ": { - "text": "brain", - "ontology": "UBERON:0000955" - }, - "organ_part": { - "text": "temporal lobe", - "ontology": "UBERON:0001871" - }, - "disease": [ - { - "text": "glioblastoma" - } - ], - "provenance": { - "document_id": "e964f81f-54d9-4600-a9e9-981b1f1a6ca2", - "submission_date": "2018-09-05T18:24:05.907Z", - "update_date": "2018-09-05T18:24:10.111Z" - } - }, - "donor_organism_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/biomaterial/10.0.0/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "Q4_DEMO-donor_MGH30", - "biomaterial_name": "Q4 DEMO donor MGH30", - "ncbi_taxon_id": [ - 9606 - ] - }, - "medical_history": { - "smoking_history": "yes" - }, - "genus_species": [ - { - "text": "Homo sapiens" - } - ], - "is_living": "no", - "sex": "unknown", - "provenance": { - "document_id": "c6001597-990c-4753-80bb-c5a01c9dda0d", - "submission_date": "2018-09-05T18:24:05.892Z", - "update_date": "2018-09-05T18:24:09.957Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "R1.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read1", - "lane_index": 1, - "provenance": { - "document_id": "20474552-c0a3-471e-8fa0-d3c5aa05c017", - "submission_date": "2018-09-05T18:24:05.950Z", - "update_date": "2018-09-05T18:25:10.415Z" - } - }, - "sequence_file_1.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/6.5.0/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "R2.fastq.gz", - "file_format": "fastq.gz" - }, - "read_index": "read2", - "lane_index": 1, - "provenance": { - "document_id": "177a9d2c-99d4-4fb6-aab7-5869923e9d6a", - "submission_date": "2018-09-05T18:24:05.995Z", - "update_date": "2018-09-05T18:25:10.316Z" - } - }, - "project_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/project/9.0.0/project", - "schema_type": "project", - "project_core": { - "project_short_name": "integration/Smart-seq2/2018-09-05T18:24:03Z", - "project_title": "Q4_DEMO-Single cell RNA-seq of primary human glioblastomas", - "project_description": "Q4_DEMO-We report transcriptomes from 430 single glioblastoma cells isolated from 5 individual tumors and 102 single cells from gliomasphere cells lines generated using SMART-seq. In addition, we report population RNA-seq from the five tumors as well as RNA-seq from cell lines derived from 3 tumors (MGH26, MGH28, MGH31) cultured under serum free (GSC) and differentiated (DGC) conditions. This dataset highlights intratumoral heterogeneity with regards to the expression of de novo derived transcriptional modules and established subtype classifiers. Overall design: Operative specimens from five glioblastoma patients (MGH26, MGH28, MGH29, MGH30, MGH31) were acutely dissociated, depleted for CD45+ inflammatory cells and then sorted as single cells (576 samples). Population controls for each tumor were isolated by sorting 2000-10000 cells and processed in parallel (5 population control samples). Single cells from two established cell lines, GBM6 and GBM8, were also sorted as single cells (192 samples). SMART-seq protocol was implemented to generate single cell full length transcriptomes (modified from Shalek, et al Nature 2013) and sequenced using 25 bp paired end reads. Single cell cDNA libraries for MGH30 were resequenced using 100 bp paired end reads to allow for isoform and splice junction reconstruction (96 samples, annotated MGH30L). Cells were also cultured in serum free conditions to generate gliomasphere cell lines for MGH26, MGH28, and MGH31 (GSC) which were then differentiated using 10% serum (DGC). Population RNA-seq was performed on these samples (3 GSC, 3 DGC, 6 total). The initial dataset included 875 RNA-seq libraries (576 single glioblastoma cells, 96 resequenced MGH30L, 192 single gliomasphere cells, 5 tumor population controls, 6 population libraries from GSC and DGC samples). Data was processed as described below using RSEM for quantification of gene expression. 5,948 genes with the highest composite expression either across all single cells combined (average log2(TPM)>4.5) or within a single tumor (average log2(TPM)>6 in at least one tumor) were included. Cells expressing less than 2,000 of these 5,948 genes were excluded. The final processed dataset then included 430 primary single cell glioblastoma transcriptomes, 102 single cell transcriptomes from cell lines(GBM6,GBM8), 5 population controls (1 for each tumor), and 6 population libraries from cell lines derived from the tumors (GSC and DGC for MGH26, MGH28 and MGH31). The final matrix (GBM_data_matrix.txt) therefore contains 5948 rows (genes) quantified in 543 samples (columns). Please note that the samples which are not included in the data processing are indicated in the sample description field." - }, - "contributors": [ - { - "contact_name": "Q4_DEMO-MintTeam", - "email": "dummy@email.com", - "institution": "Fake Institution" - } - ], - "provenance": { - "document_id": "bedfd14f-cc98-4142-b627-d44dfec5aced", - "submission_date": "2018-09-05T18:24:05.880Z", - "update_date": "2018-09-05T18:24:10.105Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.3.0/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "preparation1" - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA" - }, - "library_construction_approach": { - "text": "Smart-seq2", - "ontology": "EFO:0008931" - }, - "nucleic_acid_source": "single cell", - "end_bias": "5 prime end bias", - "primer": "poly-dT", - "strand": "unstranded", - "provenance": { - "document_id": "f77e65be-ca7a-4711-a7a9-701ad372901a", - "submission_date": "2018-09-05T18:24:06.041Z", - "update_date": "2018-09-05T18:24:09.959Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.0/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "assay_1" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500" - }, - "paired_end": true, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441" - }, - "provenance": { - "document_id": "9d3c0c92-2716-410b-85c6-963a29c24fe0", - "submission_date": "2018-09-05T18:24:06.050Z", - "update_date": "2018-09-05T18:24:09.960Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.1/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_1", - "protocol_name": "a FACS method to separate cells" - }, - "dissociation_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "provenance": { - "document_id": "d08422cf-7d04-46cd-9452-394bb2864ba7", - "submission_date": "2018-09-05T18:24:06.024Z", - "update_date": "2018-09-05T18:24:10.036Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.3/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment1" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108" - }, - "provenance": { - "document_id": "f3304cfe-c133-444c-a2db-92294d3f6a4d", - "submission_date": "2018-09-05T18:24:06.033Z", - "update_date": "2018-09-05T18:24:09.887Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "sequence_process_file_1" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", - "provenance": { - "document_id": "bf7360ae-511e-4803-821e-c03167107588", - "submission_date": "2018-09-05T18:24:06.090Z", - "update_date": "2018-09-05T18:24:09.872Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_2" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", - "provenance": { - "document_id": "b78f4279-9c6f-49da-890f-98499d8fb84a", - "submission_date": "2018-09-05T18:24:06.079Z", - "update_date": "2018-09-05T18:24:09.856Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "http://schema.staging.data.humancellatlas.org/type/process/6.0.0/process", - "provenance": { - "document_id": "6284381f-de72-4015-ae51-fa17e13677f8", - "submission_date": "2018-09-05T18:24:06.058Z", - "update_date": "2018-09-05T18:24:09.861Z" - } - }, - "links.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/system/1.1.1/links", - "schema_type": "link_bundle", - "schema_version": "1.1.1", - "links": [ - { - "process": "bf7360ae-511e-4803-821e-c03167107588", - "inputs": [ - "a31a0e93-5be4-44b8-b152-9e25b066e1e5" - ], - "input_type": "biomaterial", - "outputs": [ - "20474552-c0a3-471e-8fa0-d3c5aa05c017", - "177a9d2c-99d4-4fb6-aab7-5869923e9d6a" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "f77e65be-ca7a-4711-a7a9-701ad372901a" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "9d3c0c92-2716-410b-85c6-963a29c24fe0" - } - ] - }, - { - "process": "b78f4279-9c6f-49da-890f-98499d8fb84a", - "inputs": [ - "e964f81f-54d9-4600-a9e9-981b1f1a6ca2" - ], - "input_type": "biomaterial", - "outputs": [ - "a31a0e93-5be4-44b8-b152-9e25b066e1e5" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "d08422cf-7d04-46cd-9452-394bb2864ba7" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "f3304cfe-c133-444c-a2db-92294d3f6a4d" - } - ] - }, - { - "process": "6284381f-de72-4015-ae51-fa17e13677f8", - "inputs": [ - "c6001597-990c-4753-80bb-c5a01c9dda0d" - ], - "input_type": "biomaterial", - "outputs": [ - "e964f81f-54d9-4600-a9e9-981b1f1a6ca2" - ], - "output_type": "biomaterial", - "protocols": [] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c.2019-04-03T103426.471000Z.json b/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c.2019-04-03T103426.471000Z.json new file mode 100644 index 000000000..6072f329f --- /dev/null +++ b/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c.2019-04-03T103426.471000Z.json @@ -0,0 +1,11982 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "8079eb90", + "indexed": true, + "name": "imaged_specimen_0.json", + "s3_etag": "038fab03a6a415e07fa01214f058cb01", + "sha1": "a5d1b0e5457d029d0fe0f2c19c0c2b2f45c67083", + "sha256": "dcabfb5b083bb3ec5ef482c6266aa46617da50712520f911542d7428228e315d", + "size": 896, + "uuid": "87f58f88-ef8b-4323-bd19-cde1a2497b59", + "version": "2019-04-03T101350.866000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "d46a73e9", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "889570fe22be551b40a308389b62aef7", + "sha1": "f2b51ec11480e4b8613d1adef1beb5850847f57c", + "sha256": "86b0f47a079ed4226c6297c02196c0d9ac3b75666790a0bfa2aed117c158883c", + "size": 1006, + "uuid": "edd1d525-a6ae-4658-a6bf-6c31d7ab6948", + "version": "2019-04-03T101345.512000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "387a6170", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "3ed8a682ec9b84753e948b05aa7b50d3", + "sha1": "c054bb3fdbe4a5c87b2cbbf8af58c9e32445b9af", + "sha256": "3bcd6249e1982a1400a67330c8eb6c72c1c2a6bb94e3f27df9abbd75a2cd4fca", + "size": 1461, + "uuid": "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4", + "version": "2019-04-03T101345.427000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "15c0476b", + "indexed": true, + "name": "image_file_0.json", + "s3_etag": "78969f572594bd6ec8db29581fc3fc49", + "sha1": "821bcb53fadcf5a54df2b80912509394bcf85251", + "sha256": "39477700ca5e11cf9d50e14e734e8b84b9767260f293bfce799fc24cae174953", + "size": 414, + "uuid": "6baa3aff-b2a5-4e49-82f7-25c108a6107a", + "version": "2019-04-03T101544.995000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b2bc1297", + "indexed": true, + "name": "image_file_1.json", + "s3_etag": "352bd9b676d359440b0ab6610d82f880", + "sha1": "92ace2e3683c59df707f6c2cea97a245211b29e4", + "sha256": "fd9e953ea6a0e58915541e4831e77908b2bbb7fe75f8f434bac1f0cc888f71a4", + "size": 416, + "uuid": "06dcfc33-21da-485f-8e50-49d294713a9e", + "version": "2019-04-03T101544.993000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e80dc77a", + "indexed": true, + "name": "image_file_2.json", + "s3_etag": "effc7cc9060288b3fcf6a5a396b8610c", + "sha1": "a55cceb5feb41a61b3e862bab40ab2e07faf527c", + "sha256": "8668a42e2f5e3b222e5c4b9dacf966d4c3a8f9dccd78cb9ca9e6f5ec6204be4e", + "size": 429, + "uuid": "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", + "version": "2019-04-03T101551.032000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b57b1b8b", + "indexed": true, + "name": "image_file_3.json", + "s3_etag": "83e170b0259053817181e116c761c10d", + "sha1": "891e174eaa01454d5c1bd1c2535ec38e2df4a529", + "sha256": "cd07df0ccb235bed07bc0e721465c24ccf4c06d71c5757c63a385be396b4c513", + "size": 429, + "uuid": "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", + "version": "2019-04-03T101547.812000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f6331c39", + "indexed": true, + "name": "image_file_4.json", + "s3_etag": "9faadbc50ac5600af400235f8619f2db", + "sha1": "1f3eb773f5765e4f05fda64697b4ed01eb6ca829", + "sha256": "634269e93a580aa1c58159983acff3cff9d8b0324260ca91932bf600c1441916", + "size": 430, + "uuid": "76e52f76-ede7-4088-b7f6-d6e5f6152292", + "version": "2019-04-03T101551.115000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8920d5a7", + "indexed": true, + "name": "image_file_5.json", + "s3_etag": "1e2fa48d2a074dce3710d3f77fda11f0", + "sha1": "c4f24b94ad65c3ee335e51282e0e406c520b45e2", + "sha256": "6aebe94fb11a4fa44e63d0ee0018938e2051608093e22674a66fe6d9fa35d704", + "size": 430, + "uuid": "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", + "version": "2019-04-03T101554.073000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "56db8826", + "indexed": true, + "name": "image_file_6.json", + "s3_etag": "7b928c34176f343317e854080601345c", + "sha1": "20b719ad5ecaa8028efc6a67d7e192447958db7f", + "sha256": "4f4a790c166529d6fc9621fcbe38e81258e81626dcc46cc9e22f79a0008cbdc4", + "size": 430, + "uuid": "be66141d-84a3-457d-a8d2-2f0da8c91dff", + "version": "2019-04-03T101551.125000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7e67e8ea", + "indexed": true, + "name": "image_file_7.json", + "s3_etag": "eb52641a787d20c9cd079997a79a5260", + "sha1": "f9fb054da4ad78ca1f26c196c4f9494a6fb9bb30", + "sha256": "5e519556738cf22b5e064429fd20f14218cddd0bc07fabcd249373ced79ba62d", + "size": 430, + "uuid": "680cf532-ef0c-4155-b44d-a6ec3920743a", + "version": "2019-04-03T101550.982000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a09c647e", + "indexed": true, + "name": "image_file_8.json", + "s3_etag": "23317a256997a1f7185b08afb0d5d425", + "sha1": "0219f2b9aa844e770b1f58b55aab4ecabaeeca7d", + "sha256": "f18c6fab1c9b5e27c8e5e653e7299cb59801e8d5fd8220d9c9d0afc86d7d7ff1", + "size": 430, + "uuid": "08609f14-cf43-4188-b743-4a0b55b17347", + "version": "2019-04-03T101547.817000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0d5e37c4", + "indexed": true, + "name": "image_file_9.json", + "s3_etag": "abf43be05ab7f890a121d6039aee5750", + "sha1": "dd1a6c404b22f8bf09ef2d880b26a24ff2a66604", + "sha256": "afaf14187b58ad4f3e74329550b4b4163f85a5a9e7cdf36c82735094502c8291", + "size": 430, + "uuid": "d10827a1-38f7-457d-9c9f-695f2fc7689c", + "version": "2019-04-03T101544.996000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8b291c4a", + "indexed": true, + "name": "image_file_10.json", + "s3_etag": "ed31588f7ca14e039f8136f7dc30372b", + "sha1": "792f631014297c0d69add49b8db0ac24f5f664ee", + "sha256": "0a30e13100abf47ee849ee3f62c11dc9409f90cd631f3f584d46d8623bcd6d71", + "size": 430, + "uuid": "6f8eb2e5-7a0c-4c98-8da0-276457357071", + "version": "2019-04-03T101547.821000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a3fcc566", + "indexed": true, + "name": "image_file_11.json", + "s3_etag": "7fdffc464baaa3a9657051b6c05bffd8", + "sha1": "8122461a763c16ce6503f55d7efbefdad4d70887", + "sha256": "9ca32bea5e4ca1fa061592be5f4d390aed852c383253f6c019db8b58dc5ec85e", + "size": 429, + "uuid": "ca480df3-71bb-4634-8f71-b6a75aeb9f05", + "version": "2019-04-03T101547.796000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3f77b944", + "indexed": true, + "name": "image_file_12.json", + "s3_etag": "f2a4015ce36f854b62f5769a5f20bb1c", + "sha1": "8dab42ab4a2c2dc411bfa10a1186ed7c4e2ed420", + "sha256": "a14886279ea8319351bc1da333bf3c087eebbf10b170d9ff9f557293b845b5cb", + "size": 429, + "uuid": "03ae5f5e-65ac-4491-b0ce-eefc940e0224", + "version": "2019-04-03T101548.018000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "290467c1", + "indexed": true, + "name": "image_file_13.json", + "s3_etag": "1103eacb609b98885f4c7a771690d527", + "sha1": "53bdebd939a1c4521dd4a5430b61f71a187b02b1", + "sha256": "9e14b02fb42e2e6d7b4b408274b8262ac8438065e3a368ad483e8ae731907705", + "size": 429, + "uuid": "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", + "version": "2019-04-03T101551.040000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "fc68d967", + "indexed": true, + "name": "image_file_14.json", + "s3_etag": "0e8c05a96c95c62a756e2be8eda7d864", + "sha1": "18b2898720e44376e96d08e289d8788a6dda009c", + "sha256": "29963b642a9e628b630d9591a078c138ff62ed23ecb1d0f0601be29f9c4d6b24", + "size": 429, + "uuid": "887f3d73-94d2-44ac-9047-67aca5225882", + "version": "2019-04-03T101551.029000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1b9ad91f", + "indexed": true, + "name": "image_file_15.json", + "s3_etag": "18b349c44199e87aed42a8e54bd7419d", + "sha1": "4a93629d4d59d8676bdf567b020bbe201e430e88", + "sha256": "0b9a89e36e3690da9259e43290fe70b60603009d00fe39452ba0bbf4dfbb9418", + "size": 429, + "uuid": "896dfacd-206b-4e4f-a846-ba5b070060d9", + "version": "2019-04-03T101547.819000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "27cf3a08", + "indexed": true, + "name": "image_file_16.json", + "s3_etag": "2883ccabfd63c0110b8ca0139ff62493", + "sha1": "51f02c93335d069692528ff7b4b4272b3ad4f76f", + "sha256": "24073054e30b0de495c92dcc02391d8b8c8b1422a655c8bb5f132941c3233319", + "size": 429, + "uuid": "23303c88-01b1-47d0-b770-dca6802caa13", + "version": "2019-04-03T101547.812000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "de878d17", + "indexed": true, + "name": "image_file_17.json", + "s3_etag": "6df775c743947206fc5b6d054135a761", + "sha1": "b53d6fc48f41eb5d4014dbc0468a1c60aec29b83", + "sha256": "5318ef81c7636ad059452277bbaa1b15b120d489a355d221ee58216818405641", + "size": 429, + "uuid": "3c1a388d-0577-4417-9cd2-ff33bfed9140", + "version": "2019-04-03T101547.821000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "76b4e019", + "indexed": true, + "name": "image_file_18.json", + "s3_etag": "02ff24b7bbf5995acb045ac05fb17065", + "sha1": "82886a97a3933d232acb4da65c78fd157d0aa26f", + "sha256": "f0cd2b5a3ff27f319d78edcb6ae8649768810273a759af44ef249f04d2b4df13", + "size": 429, + "uuid": "67e71b34-7157-4a37-b495-0d740772b480", + "version": "2019-04-03T101551.111000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a2a8f359", + "indexed": true, + "name": "image_file_19.json", + "s3_etag": "ce0597ac8c4d8814a2e603eec2965ea9", + "sha1": "8965dfd33a90ff2a03b15bfcba57893e456042ba", + "sha256": "610fa9de68fc0c392e981e7ed61bcab9c656aae9debf6067cc6a5eca7a31150c", + "size": 420, + "uuid": "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", + "version": "2019-04-03T101551.054000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6f83b0eb", + "indexed": true, + "name": "image_file_20.json", + "s3_etag": "48292580773c094adec3a832e7968944", + "sha1": "d7935356c353ad1b8aa0b0665bd541be3718ef24", + "sha256": "5415fddfae88e6ad9a1248b52f041c541a91568bdd528a729cf296a66e07990f", + "size": 412, + "uuid": "5fbcb75e-3ee3-4429-8ede-b243afa0789f", + "version": "2019-04-03T101551.028000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7a5f8396", + "indexed": true, + "name": "image_file_21.json", + "s3_etag": "4a0074b189ce3989a5315274668f47f7", + "sha1": "65ba0cc95f878158865ea52129e4368c7a4b7117", + "sha256": "517eef28842bbdedb80bafbd691dbbc9218a14a197ba1d094b293cd1f3aa5d6b", + "size": 436, + "uuid": "09226b24-6b11-4e4f-8052-2b544be461aa", + "version": "2019-04-03T101551.126000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f9d5a275", + "indexed": true, + "name": "image_file_22.json", + "s3_etag": "40bc3e0ea2d8f5c200e188e62105f352", + "sha1": "b6d3ab14c34c3c9926fec8b9ddbcad9af3495b6b", + "sha256": "0bb8b449b7c18075f3f157facd415fef08888124bbdac344873a8887d66a2a50", + "size": 436, + "uuid": "f67473fd-fbf8-4d69-9db1-556938ab5b87", + "version": "2019-04-03T101554.317000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "438b1035", + "indexed": true, + "name": "image_file_23.json", + "s3_etag": "34fed4de23ea62eee190201f0ca332b2", + "sha1": "31ec656cde738741d43f7bff141132e7639c15a3", + "sha256": "fb46973e9398e82e5e842bab20db97b5e7464a14c8ef8e0bca8ac8b90b1d1215", + "size": 436, + "uuid": "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", + "version": "2019-04-03T101550.940000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "69359cac", + "indexed": true, + "name": "image_file_24.json", + "s3_etag": "fb0fb60fcb0f76f67edc4a61ecea4b39", + "sha1": "684a152a02274a7dca17d263d3ea313b49a0eb71", + "sha256": "1d2b9a93a4188ddec501b996fde7ec2fc38f060ed0c2cb82b30e1584353bb44a", + "size": 436, + "uuid": "017a2c88-4f6e-418e-bb96-f42f3a220f87", + "version": "2019-04-03T101550.977000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4811eaf7", + "indexed": true, + "name": "image_file_25.json", + "s3_etag": "ad0643bdfa0eb18c8d67f9efa7bd602c", + "sha1": "f68e533ecb1f121f52631c6010619eb47c3968fa", + "sha256": "6989e2d3d621b3f9fcb307bd7905c745cf36fba395e6a061e3681e7fe31097f1", + "size": 436, + "uuid": "30305240-004d-4632-84d4-37d7e7378782", + "version": "2019-04-03T101551.136000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d89e7350", + "indexed": true, + "name": "image_file_26.json", + "s3_etag": "45bbd1cd2580a55e3eeaa20e73e8acad", + "sha1": "98dae7c81669f3b0dbf2ddef9c78db8d13311411", + "sha256": "28393237e14ce9891dbc646df4a7c562333f925cdc3189184893b630b7678048", + "size": 436, + "uuid": "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", + "version": "2019-04-03T101551.052000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "442d4d84", + "indexed": true, + "name": "image_file_27.json", + "s3_etag": "8f90d9f8fb508084508fc300ef4bb4d0", + "sha1": "5092ba88250f093030a7ab84774df73210cdc08b", + "sha256": "afd4ea38d62c45ff93a5abfe15d892a54c5fe188347e1c5bf7595c2d4a814748", + "size": 436, + "uuid": "3fd2781b-6855-4eaa-b2fb-81db386adb18", + "version": "2019-04-03T101551.027000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0c4146ab", + "indexed": true, + "name": "image_file_28.json", + "s3_etag": "80856577d5972945a7afe21ae2c3835f", + "sha1": "c20bcbca57adf6ef800ed44fd8201cf626a750e1", + "sha256": "f00fb2b5d6da250b1d50d35f447d0cbd4ed99b3d2e3acccd9b4a0ae22e8bc56f", + "size": 436, + "uuid": "40474d53-44a4-4ab2-9f20-61b71291f8aa", + "version": "2019-04-03T101547.810000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ce7e2b8b", + "indexed": true, + "name": "image_file_29.json", + "s3_etag": "e00f6a988100b240e32a67e570b7ba38", + "sha1": "2410904c1785fb9bf0daa3171474a0fecd979ae3", + "sha256": "ccd379770ac524045e495ea08411378a90e6c2970dd329c391da22bb842cb681", + "size": 436, + "uuid": "aaa97d47-7124-4763-a3fc-f6d66eb6d990", + "version": "2019-04-03T101550.958000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b9183afa", + "indexed": true, + "name": "image_file_30.json", + "s3_etag": "28e9cd98bdef0d045db1ddcb23abe0f3", + "sha1": "428ef83c0b71284a0edb85b976579d381127ffb7", + "sha256": "472be58ecb075755d87eb778b337c7697d8885ea6d97c7f48b3b1266c14d60a0", + "size": 436, + "uuid": "4adbed13-1cb6-4405-b892-fe8165050691", + "version": "2019-04-03T101551.040000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "571ac117", + "indexed": true, + "name": "image_file_31.json", + "s3_etag": "fdf353efd62c1d32f79002132495b9ec", + "sha1": "a06c917ba4016a7de26bf2f91931d55e085ad078", + "sha256": "b12f58e60c5d2e30be93e6fa39ae8f8b73781f07722b24158a36dc19893bb1f2", + "size": 436, + "uuid": "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", + "version": "2019-04-03T101551.020000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8db2e4c7", + "indexed": true, + "name": "image_file_32.json", + "s3_etag": "d67dc364c58e8bd22753e80490aba312", + "sha1": "c7426a20f166f6657c7cf1ea60fa33d74e09cf5f", + "sha256": "cea402f913566a622705f61d4b339bbf4ca6b9b0a0ba60122c742dfc41f8bb6f", + "size": 436, + "uuid": "5402916f-6de1-4842-8585-fc25c153992b", + "version": "2019-04-03T101551.039000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "291b9622", + "indexed": true, + "name": "image_file_33.json", + "s3_etag": "c610bd7d6df298676d3ab9e03974c6d4", + "sha1": "fc80e91c6acb500470e0c78be820c0d09364e09d", + "sha256": "e28f94fdbab9f4cc65e509289c0ed8175c2fe6a74e4180c7f22759619e206abd", + "size": 436, + "uuid": "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", + "version": "2019-04-03T101600.740000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c5d54b4d", + "indexed": true, + "name": "image_file_34.json", + "s3_etag": "71a459e0e4ebe380e4f5ad699dfe39e5", + "sha1": "a870a769c567e00fd726b069f591e0509a705dbc", + "sha256": "1834e21010a32a18fbaa3b0414efb7c6ae7e159d3333df54bb678f24881aff95", + "size": 436, + "uuid": "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", + "version": "2019-04-03T101600.295000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "81bfdbb5", + "indexed": true, + "name": "image_file_35.json", + "s3_etag": "5a9051abd6e6ed9cee00abd59c9862f1", + "sha1": "fc71295b18c68520da079e4560583f89ffa459a6", + "sha256": "205f951bbc20d1c1ca49520908cf7d655478db083dd96d62f176979454893392", + "size": 436, + "uuid": "cb92dd92-570c-4075-8893-eb19dbd837b8", + "version": "2019-04-03T101600.289000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9b22db0b", + "indexed": true, + "name": "image_file_36.json", + "s3_etag": "c55531713486c10a999da38866629fff", + "sha1": "8b80501e4488e6a73b6164926aa9e938571fef64", + "sha256": "552fe82b645d82a4ab8dec0f3e975b585a471b6ec71dad714d19d37a619295f8", + "size": 436, + "uuid": "b36948c4-0646-42be-9db2-16626a757343", + "version": "2019-04-03T101557.643000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "147e5d0a", + "indexed": true, + "name": "image_file_37.json", + "s3_etag": "17a6a4d22efbf306b66d00457f0609f1", + "sha1": "17abc1637628aaa85c60cc5d2e3d8e14e01018ee", + "sha256": "d4296b9d358855fe9af556d6aee1d8ccd13901e4276c3b8e174ba9db65df7a73", + "size": 436, + "uuid": "c974f4eb-27b8-4ec3-913e-a6eb19572a51", + "version": "2019-04-03T101557.265000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f72b1879", + "indexed": true, + "name": "image_file_38.json", + "s3_etag": "dcdb7889b5563daff4401efdf07424f4", + "sha1": "cd81502dc2051090a806608de2284e18856b76b4", + "sha256": "8e16a4bfe71a99a57492f2de4d6a462713d5c5a90bd8ec67008a5bc69f18e31a", + "size": 436, + "uuid": "febb760d-1e9e-4432-9b88-ce2869a43c44", + "version": "2019-04-03T101603.118000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7ba1aac8", + "indexed": true, + "name": "image_file_39.json", + "s3_etag": "fed9a54f347c79af8759da6c18fd8797", + "sha1": "52782e2d062d6491bb4dc0096de07396a3053599", + "sha256": "c333fe3b4e6856c7e0f45e61b44dc2aad0a819d3a446e2f1ebde6451c4673418", + "size": 436, + "uuid": "054f40a4-68d0-41db-81e9-00239042d9fa", + "version": "2019-04-03T101554.056000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "26797393", + "indexed": true, + "name": "image_file_40.json", + "s3_etag": "fb9706107509f936c61eb3ed7473c37f", + "sha1": "92a5c2a82ae00336de23e896d1775ac1079032a4", + "sha256": "f57b95d9d82aa33c9b1ff61c4b4c8471e243b1e190dee06fdc46bc82a9840ddc", + "size": 436, + "uuid": "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", + "version": "2019-04-03T101557.262000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a21721ad", + "indexed": true, + "name": "image_file_41.json", + "s3_etag": "e93177fa673e8f89c9efcc51e5b56d69", + "sha1": "9492388cc20efe206f452e3be6615be353f3f6ec", + "sha256": "1b65fa5a886865bc8323393642034c144e9af72f295f44a5bf0d00b1a1fe0fed", + "size": 436, + "uuid": "819e3227-cc54-4919-95af-c1f8194bf729", + "version": "2019-04-03T101600.245000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8e944c70", + "indexed": true, + "name": "image_file_42.json", + "s3_etag": "b489a896e0b737d725f3f8578d534384", + "sha1": "6bfe2e4ba1e0c332b44e09bb9e196a4960b787ba", + "sha256": "2403b7b6306342055a0da03f1598da76a6602912a7db0ed480a9ec8ba058edf6", + "size": 436, + "uuid": "b1e2b9d1-6973-41dc-acdf-95474303561f", + "version": "2019-04-03T101600.392000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "18f0255d", + "indexed": true, + "name": "image_file_43.json", + "s3_etag": "fc8e33e1a5986dcce6dcd8d35047db9d", + "sha1": "e07b9a462b46380bc61904da44e719a7efe0df60", + "sha256": "6400cd38b14ef3a2ed4259d63836e6a5ccb62c4b65a7a8568dbc5201024f0219", + "size": 436, + "uuid": "41ffc783-5ad4-4197-8fd1-c029903c43c0", + "version": "2019-04-03T101600.242000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "bc005686", + "indexed": true, + "name": "image_file_44.json", + "s3_etag": "530ae4741bece22de276dd91e3ffa50f", + "sha1": "7e06635cca390c555051dbe62a6b7cd36e7b56a7", + "sha256": "69541c6253b9cb9fd37845812eacf0d6ca58ebf0294837f2c02e30fb0c03157b", + "size": 436, + "uuid": "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", + "version": "2019-04-03T101554.163000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7d5688f2", + "indexed": true, + "name": "image_file_45.json", + "s3_etag": "a9351b5ba3a3022072636c6f6fcdb51c", + "sha1": "0adf628f224663418d182c681549f3f405f1be9c", + "sha256": "770b880f656b6aa00efdf008791444c126efe1fd297efca8c5a7c7097ea900dd", + "size": 437, + "uuid": "9014bbaf-a047-4b69-8e28-8356cc99f84e", + "version": "2019-04-03T101554.097000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "49d735f5", + "indexed": true, + "name": "image_file_46.json", + "s3_etag": "316b6a48cb999f8a91aebf262eebdb85", + "sha1": "a011d8c48da4c80098bf0147a5abf5949259c5d5", + "sha256": "2bd3f30fd85544254ba37fe941a8328ab3fae7e66fe53f69c48f2b6d9e262421", + "size": 437, + "uuid": "f7acf90c-2b32-463b-b832-8daa8529f727", + "version": "2019-04-03T101551.110000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a7afb522", + "indexed": true, + "name": "image_file_47.json", + "s3_etag": "48de5c790860cfa4b31dbda89fb14848", + "sha1": "3d5adb3c12680dd6b482b82536f4cd487136d0d3", + "sha256": "5bc6eb1cb42a02ced63e8a010cde537c78b3ff34c68ec1d178fd227248a7cd41", + "size": 437, + "uuid": "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", + "version": "2019-04-03T101554.068000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "477f3b73", + "indexed": true, + "name": "image_file_48.json", + "s3_etag": "9ee3a28b10bc548bf3e3e6b255d51b4a", + "sha1": "dada78babeba45bfb4b77ac7ae8be3c3d4481221", + "sha256": "e4c440e517c39a6c3f0ad820f97fda13929d46868355988673c2713eaaa0db5f", + "size": 437, + "uuid": "db22deab-498a-409c-8386-5bf4e60a080c", + "version": "2019-04-03T101554.171000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5a11b2c6", + "indexed": true, + "name": "image_file_49.json", + "s3_etag": "b9920ca8d3aa46ee824b24676d14606c", + "sha1": "78cead43f864e56baf51c1fb43bed2fbe92e044b", + "sha256": "602346da07c3d1d779290fd3fbdcb9046a2929a8bacc384a9b252e70a0a5aacf", + "size": 437, + "uuid": "07d600bc-0d55-4a8d-9a48-390fc4169845", + "version": "2019-04-03T101554.155000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "df5272b6", + "indexed": true, + "name": "image_file_50.json", + "s3_etag": "e394067e17591779b210e0f1aa5217c2", + "sha1": "4a421755b723f08cac72ec4fb7ee96fd551344a4", + "sha256": "cd289cc2db430f92925bc05e40dd5cb1c6ee7c2a3f9c55a3c1f36fbeeb46580a", + "size": 437, + "uuid": "d0a032bb-cd0e-4873-b346-5cb19e45c202", + "version": "2019-04-03T101554.147000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a615de2d", + "indexed": true, + "name": "image_file_51.json", + "s3_etag": "9fd36791a8c43c2303cdb0e17cd33063", + "sha1": "396a37e54eaef8f4fcb4851723b4cb51c80b964e", + "sha256": "4870a840ce29281fa93e8e6a7c8bbde6f78e9c0832e6067432333c00b7e75f60", + "size": 437, + "uuid": "a161f60f-af92-4b09-9df0-dd7ff2bf571a", + "version": "2019-04-03T101554.146000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cc86f251", + "indexed": true, + "name": "image_file_52.json", + "s3_etag": "e32d50d29dc7257124e623a845ce5009", + "sha1": "4de19aae0120499c1ada6758a2a7c6846673c8d2", + "sha256": "bd3c7aea6543616f7861d9ab086c8147df04f39d64b824a4a2696922faac606d", + "size": 437, + "uuid": "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", + "version": "2019-04-03T101557.073000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "331abd76", + "indexed": true, + "name": "image_file_53.json", + "s3_etag": "6431956d2e565c3b1ae3f2846d2e83c9", + "sha1": "b8e4f97a697ce1f604e5b1da059553157ee14c85", + "sha256": "b64c80ab42af729c766d7057252b4792d81976491eaeef548f5d2e5e22f1592a", + "size": 437, + "uuid": "f10fd9e2-5747-4d7a-8c0c-beba81749011", + "version": "2019-04-03T101554.011000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d443e379", + "indexed": true, + "name": "image_file_54.json", + "s3_etag": "28cee81f519bc1d49494e1e3d19537d8", + "sha1": "1430224d8d07c762faf15bf9d85f6a69cf22978a", + "sha256": "f530d71a7102885e24310411cff4052f2ed8c26377f49debd65443c824b0d9b2", + "size": 437, + "uuid": "553b6aab-4745-45f8-98ab-de6aadbf48e4", + "version": "2019-04-03T101554.255000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "17c75bdf", + "indexed": true, + "name": "image_file_55.json", + "s3_etag": "94ecbf24a51f24dcdc2f9a7c215841f5", + "sha1": "0ac5b3148ab528d1f59c0e66600ae99a369b9e28", + "sha256": "77bfaab517f05ded0d779f672033b4fe36a53d8a34d67431b227632c520a58ad", + "size": 437, + "uuid": "3572abe9-6e42-4266-8671-ff24b592065c", + "version": "2019-04-03T101554.233000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5c8d1fd8", + "indexed": true, + "name": "image_file_56.json", + "s3_etag": "a2aff7c7341b8e31e3788539d3723155", + "sha1": "c426fdd2f0fd279ef55023ead517e3ba79d5f936", + "sha256": "244c172dc730e03c4775435ca9d8d6209ae6561d1fa244557e72650d76ec68d4", + "size": 437, + "uuid": "6882abf6-c247-4167-a18d-e3fec24bcba2", + "version": "2019-04-03T101554.124000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b5a3d1f0", + "indexed": true, + "name": "image_file_57.json", + "s3_etag": "55ed2fa1bf8138a0a3c00e0f08cc4bca", + "sha1": "d0756edfcd1ebcd7508bb90a891c3068f6430414", + "sha256": "09ee934bb00c75597a81e8619f1bf36a37d0bfd4a120a4a38b8ccdfe4ee49f62", + "size": 437, + "uuid": "15f8b73e-937c-444d-8362-fdf458abb651", + "version": "2019-04-03T101554.117000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "627f0d21", + "indexed": true, + "name": "image_file_58.json", + "s3_etag": "b02ac497470cbf16eac17fab69f55e69", + "sha1": "783f66868b6e8d15e834bc3fcaff82a4cfc45a1d", + "sha256": "b492fc206e7af25ad25cd703477562e33f6b55a8d729f554762707d47518520f", + "size": 437, + "uuid": "33b4e374-20ad-4fee-b682-aaa4fc12bec2", + "version": "2019-04-03T101554.178000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0b92cd9f", + "indexed": true, + "name": "image_file_59.json", + "s3_etag": "1b95b4be0212ee7f892a2ce76f7c3c01", + "sha1": "5281e448041b0486840c5192760c57d756a1417a", + "sha256": "9c59cb6b48fe2f9c2e2dc1af39c963fa08d04d62db044e25343c91002c18dd74", + "size": 437, + "uuid": "0e83c507-2211-4561-b75a-92326fb2d4fd", + "version": "2019-04-03T101554.229000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "36893dd3", + "indexed": true, + "name": "image_file_60.json", + "s3_etag": "17f6ebe07687b8b410eed108625fa619", + "sha1": "8401c957587084fcda65d0c437f4c231b8b27e43", + "sha256": "264ba999cd45d6439826e2627a2b09c39e6b15e68efc3891f2daff7185b4ce16", + "size": 437, + "uuid": "912c55cf-0774-4838-8874-352766984715", + "version": "2019-04-03T101554.213000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7078c29e", + "indexed": true, + "name": "image_file_61.json", + "s3_etag": "d93bf47f7a357c6a83e44f3679a8b285", + "sha1": "01e6f534e7ce61612dd8ad8cc1aa18f1d659fac8", + "sha256": "07c595226f8dff95523046921d22c770ef035dc177670deaff09efec9b9a5bc2", + "size": 437, + "uuid": "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", + "version": "2019-04-03T101550.981000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3939945a", + "indexed": true, + "name": "image_file_62.json", + "s3_etag": "e2310bdd90fad3e5ff497cb27eae01c8", + "sha1": "f420e9b5654bf60206202a773eb3baacfc612dc5", + "sha256": "c8e688f4d5792c15eff9b60c17e7cb11eb5b9fc22df4b8686da5462ef6c3ebf8", + "size": 437, + "uuid": "5b8e3d96-e625-46b6-9689-110fa84fd721", + "version": "2019-04-03T101554.097000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d1a6ff37", + "indexed": true, + "name": "image_file_63.json", + "s3_etag": "6dbbbe2b32ce74d079b2bef920f1b746", + "sha1": "eedf5323a2543af65d286942be0c6109a301bda9", + "sha256": "1a437156830c17b703cf0ab7b86263a941cb6163eebc323ce1a0986d9b6ee86d", + "size": 437, + "uuid": "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", + "version": "2019-04-03T101557.225000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "130f873c", + "indexed": true, + "name": "image_file_64.json", + "s3_etag": "5ac0b9eeef7510891bc75fd5edf5a18d", + "sha1": "befe8f910959c5bf73d830eee47c30b5336b8d6e", + "sha256": "f80c0c38eba9dc34691c3eb73b7992d6133164b99b36fa1ada3fedfffc7a3db2", + "size": 437, + "uuid": "6f3272d7-4a62-4a3c-8c44-11dda8756956", + "version": "2019-04-03T101553.957000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5430e9f8", + "indexed": true, + "name": "image_file_65.json", + "s3_etag": "f143f2b13c13e3a0ef33d76a35edffd0", + "sha1": "06a516e9cb7e845e2d25550d4d46952b91afc610", + "sha256": "c68187461c589cf329d0388cec56220dccdbc18f731cae340afe945332e3f390", + "size": 437, + "uuid": "168422c5-e89d-466c-9085-f29c02160143", + "version": "2019-04-03T101554.119000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "68502f42", + "indexed": true, + "name": "image_file_66.json", + "s3_etag": "358bbcce28a2897636b9d2e9299bba07", + "sha1": "fd9c1c53771b3aef5b94439c6342a250edc31c24", + "sha256": "3e78b422abd43d4b98ac9fc7c1e194f0bd3bbba37d0dc85059045d02ee677922", + "size": 437, + "uuid": "7331367a-cc43-4af0-8750-a2921d513f97", + "version": "2019-04-03T101557.287000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6649f82a", + "indexed": true, + "name": "image_file_67.json", + "s3_etag": "62579375c4de1c7a4e989f77f3b3d176", + "sha1": "9a9ea328e726e620b6b62f67537757af3b02d86e", + "sha256": "22d6abeef0ef609847afe1ab25316816f47b37e191303574780496bc6def3513", + "size": 437, + "uuid": "edf83a09-2e60-4571-b650-abf4c7ff757b", + "version": "2019-04-03T101554.149000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "53f03eaf", + "indexed": true, + "name": "image_file_68.json", + "s3_etag": "918563dcf5b3881c5e453718f317f045", + "sha1": "34fd4c4a9d3a1c4dc1610643197a9092e9bb0adf", + "sha256": "49fd51fabce4301c831e6ecbf82108fb0e7a8ee70e549b2d87e47ce111690a90", + "size": 437, + "uuid": "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", + "version": "2019-04-03T101554.166000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "01833a50", + "indexed": true, + "name": "image_file_69.json", + "s3_etag": "05d5d3bc163ce94baa3ee79842a90fa4", + "sha1": "18654f02facd85891ff8495e861f61619bfca6a5", + "sha256": "dc427510fa0620ad3eb272fe4e81e0a23e8eef322edf52b38cca3799f6049045", + "size": 437, + "uuid": "be9d12b6-f8dd-407c-b1d7-844deb6a5023", + "version": "2019-04-03T101554.168000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a9d26b59", + "indexed": true, + "name": "image_file_70.json", + "s3_etag": "beae917af371b2fb95b3a2adbdf21e65", + "sha1": "0303ec0d5692e7a62235958df7b712b76a5ff0d8", + "sha256": "3e0af88cb3304fa3f4aa2118d2a94cc8576deb86564146d2022ab0d6453a6173", + "size": 437, + "uuid": "e3e59792-61e3-4bf0-a985-2acec75acafd", + "version": "2019-04-03T101557.350000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9fe6ba4d", + "indexed": true, + "name": "image_file_71.json", + "s3_etag": "387f36478b6eb60e7acf905ebb9a5842", + "sha1": "9c01dc63dff035a391b328738e87ac39b13af959", + "sha256": "e42e317ce059afd91d7365c52ed2baad3120380b354b1cb9d493a9433b7e10a5", + "size": 437, + "uuid": "095ee09c-1605-4c07-9324-b5382f20b78e", + "version": "2019-04-03T101551.023000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7ad3743d", + "indexed": true, + "name": "image_file_72.json", + "s3_etag": "a4342cc672a96585326afda3a205261c", + "sha1": "04c729435898e80e38de10184f44b6602bc218a7", + "sha256": "dade5e214dbc78247a89a7d6ef9d1008fb951858e4267208a2d598c94b295fd1", + "size": 437, + "uuid": "77b96424-accb-4c6b-884c-756f2bb40929", + "version": "2019-04-03T101554.145000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ba0941b9", + "indexed": true, + "name": "image_file_73.json", + "s3_etag": "12c381a6f2c6832468c66997392d83c3", + "sha1": "599497576384f0e1c98a389d6025215af6744c5c", + "sha256": "df4d56cef909e3c2ce9d4c336fd753c47a1731fbf1c2058b0c8aa4f79c6890a1", + "size": 437, + "uuid": "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", + "version": "2019-04-03T101557.414000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a141033a", + "indexed": true, + "name": "image_file_74.json", + "s3_etag": "df8f791ca45a522323e01418f86c25a5", + "sha1": "fb018f093d4434d8dc47966e22ce23633fdae934", + "sha256": "8d6cda07d844c1d5c022954b2431a60b2fcba5d7233da6adfc211117c5e5badd", + "size": 437, + "uuid": "78518dc1-d38e-4230-88b8-887bdd83f965", + "version": "2019-04-03T101554.195000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cc1184ee", + "indexed": true, + "name": "image_file_75.json", + "s3_etag": "6518fb057b8c7f2a56caa360b1519757", + "sha1": "f519a4da84b758b6d776920863efbbd1ba640759", + "sha256": "793bc7b3b9e4a543a458c3f68bb5827beddd934c102e87be93945190950e3453", + "size": 437, + "uuid": "652dd3c5-6467-41ee-89b3-e4b3361fb533", + "version": "2019-04-03T101554.138000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1a59e2d8", + "indexed": true, + "name": "image_file_76.json", + "s3_etag": "48aa40e3a77ca54322dc0f64da753fbd", + "sha1": "38dc7bca72733b1a44b431e8181d5c976e40c7d8", + "sha256": "df2b61efc26152c558cb2943696d322091109587591c61b7408890f35a2fd646", + "size": 437, + "uuid": "cae3d214-d485-4350-8cd2-f4142aca4aef", + "version": "2019-04-03T101554.152000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a1ddc855", + "indexed": true, + "name": "image_file_77.json", + "s3_etag": "ededc6656768c58f119d4980f70254f4", + "sha1": "5c630b8a409f7f835cac142d118696fdbbb00d64", + "sha256": "eb94a6d41ccab3e1c1f7dbecdd96ce2c82cd1fd789359f8e05645f4b66e6fec0", + "size": 437, + "uuid": "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", + "version": "2019-04-03T101554.144000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c53f9c1e", + "indexed": true, + "name": "image_file_78.json", + "s3_etag": "109b91349e3cbb3e381e1901d6fe3489", + "sha1": "03754fc3c3da983b559aeb9a60173362190cfa2a", + "sha256": "67fb4687262d1951b1b876e13877bac009c1306f3d6a993a3a74afe873faf5be", + "size": 437, + "uuid": "de282263-0944-48d4-9819-6182636c76bd", + "version": "2019-04-03T101550.968000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8d566bb1", + "indexed": true, + "name": "image_file_79.json", + "s3_etag": "597d15f02500d28ff234417f602d1d40", + "sha1": "eb4208dfe7401b4ce7fd64f8fa8914475c4728a9", + "sha256": "60578d0981d6c0a835df6e917ff9d0d297c62a6e97e36666bbf2640f6b82d123", + "size": 437, + "uuid": "bfdbe9b5-42ac-419a-b297-843095de2cc2", + "version": "2019-04-03T101557.263000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "60902f7b", + "indexed": true, + "name": "image_file_80.json", + "s3_etag": "39f399a9d08ef483207e36e918fcb092", + "sha1": "4fb249c2a84d19c71aa8f5838174012bc110edc8", + "sha256": "30b856dbc8c2a79fef91e6e8e124674843238a2aa7c078fbd8c779881b7c1e7f", + "size": 437, + "uuid": "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", + "version": "2019-04-03T101557.144000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "33ec1464", + "indexed": true, + "name": "image_file_81.json", + "s3_etag": "2d0c895d47fb3e0e63fc2e5db4ae297e", + "sha1": "42ad5f23c979338cb6d9c4502d5e59b7f2ded445", + "sha256": "6c43740b4d9754cab558430310c8cb4ac1c32a59802eb4fc8198e238fdada39c", + "size": 437, + "uuid": "e2763cda-3236-487e-9944-5169c0cb8856", + "version": "2019-04-03T101557.230000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "55c07209", + "indexed": true, + "name": "image_file_82.json", + "s3_etag": "9a473e1c3162cd9eeca4260125d7bfa4", + "sha1": "f392161ccc348296e32e3559732aff34679af0f0", + "sha256": "34f70ea5ffd42361331bd21ad3e39868bca7162f0d32f83c7d11753b3a20caa2", + "size": 437, + "uuid": "37018bd8-8537-47c3-a5a9-efb43552f30c", + "version": "2019-04-03T101557.364000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "621e5f97", + "indexed": true, + "name": "image_file_83.json", + "s3_etag": "298619f74be831631fd104c5b5cad470", + "sha1": "7dcc56f153ff341fe60e7f49d0eb3bb225b728a1", + "sha256": "1929e1c99a24ccf2931c086fd3d8746449a7e2eb18805090d3fb06efd94631f2", + "size": 437, + "uuid": "a6c9b1ce-2054-4a48-b262-bb0723b8a567", + "version": "2019-04-03T101557.302000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "70ced63d", + "indexed": true, + "name": "image_file_84.json", + "s3_etag": "7d69de69006a80659a97cdf67c08d7b5", + "sha1": "f1dff5908f09eec4cec54dde9e1602afa18183c3", + "sha256": "2c31cc1a1ebed37153f365b27d4deb9abc4119c3e283348c8873d96b12e5a921", + "size": 437, + "uuid": "8319ee38-f199-49d7-989a-25b451656b38", + "version": "2019-04-03T101554.124000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "38e38e3d", + "indexed": true, + "name": "image_file_85.json", + "s3_etag": "56aed7326c3f1bfa0c6b9d7dacf20e32", + "sha1": "a8fecab539fd4ff259ab5dd5fdd1e19bf939b3ac", + "sha256": "7e31d64e42873ab36812aa6ce79dae2b44b0e2312174c5f951893b23d40584c1", + "size": 437, + "uuid": "022841b6-8b7c-4d0c-b65f-06ba14253540", + "version": "2019-04-03T101554.250000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0bca100e", + "indexed": true, + "name": "image_file_86.json", + "s3_etag": "fa63ae3fe746e56b47c9d62577989f9b", + "sha1": "cbc472805f45908fd63e674861c44c1ac57e8982", + "sha256": "709a2c0bb5fd2c33aeb0a48a93b24b7947a89989db89c8bd26cc5a0a7f410cd9", + "size": 437, + "uuid": "299dfbe5-05f5-48a7-816b-61036f0e435a", + "version": "2019-04-03T101554.232000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "16162a4f", + "indexed": true, + "name": "image_file_87.json", + "s3_etag": "58f2f4b9a105d3b89cceb1e748816c25", + "sha1": "eb7dc8ed82ffe878749bc7841d7cde8acb8aa14d", + "sha256": "8c07684be9327c97b8f4260d5b8653a25b0961f75f639a2dd400bc29b931d5f3", + "size": 437, + "uuid": "6b8b11aa-3600-4a63-a980-93465e681c9c", + "version": "2019-04-03T101550.951000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c58cf92e", + "indexed": true, + "name": "image_file_88.json", + "s3_etag": "eba9085a7e39d9fff4e5da8d451f61ed", + "sha1": "d4236e73125c388d1a4d16903b5c843af4f3129f", + "sha256": "c6dc86adf9e12786e038487f201109cc48bd03828ef5bf1ba603db9657ac4359", + "size": 437, + "uuid": "35716168-df43-4273-b52f-72e3d18a47bc", + "version": "2019-04-03T101557.202000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9a0da2c4", + "indexed": true, + "name": "image_file_89.json", + "s3_etag": "bec756d6be365766fdfad45b53f38880", + "sha1": "749b564f0385e28d865ad240b96e909fb47ab44c", + "sha256": "b3a6e0d610ad5c171130df88cc1df675ec51ffec48781ef25f00e3bb96a9015f", + "size": 437, + "uuid": "6be783ec-c132-4e09-90e0-0958efaf6619", + "version": "2019-04-03T101557.305000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "665d3f1d", + "indexed": true, + "name": "image_file_90.json", + "s3_etag": "abca2e6e1ed70947444c7fd878aa2d5b", + "sha1": "f064f41ece19e3865c8cab294bc0b9fb5f04388c", + "sha256": "8bb1b6b4470029750f1387f4c9e66a939ed3f6c4ecbadebb40601d354ce34e00", + "size": 437, + "uuid": "a11956c9-c24e-4efb-8af8-1167b3081e70", + "version": "2019-04-03T101557.283000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c70854d7", + "indexed": true, + "name": "image_file_91.json", + "s3_etag": "89feebd68aa27a9cd0884f7c1ed32ea9", + "sha1": "af50b2be1793c1290dd5488ed7d7b38b9acdb5d6", + "sha256": "492b495aa8b0722ab69598f15f24324e7627415a77fe26ec382cba71a7fe75cf", + "size": 437, + "uuid": "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", + "version": "2019-04-03T101551.102000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "73ce1e4b", + "indexed": true, + "name": "image_file_92.json", + "s3_etag": "0faba09d5b0be8d8c42db50dcfe32ef4", + "sha1": "ae62cf99381dd28323a02f941a7fc3873d922e9a", + "sha256": "52b880a8c81b99983c728c7c2c0866ba96e8148402ffbc13b694f867ba27a7e6", + "size": 437, + "uuid": "753c2a57-b5f1-4984-b874-b2b10d582847", + "version": "2019-04-03T101600.454000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ea20fe74", + "indexed": true, + "name": "image_file_93.json", + "s3_etag": "f8c0ec3314cc411ab605da45ee1ae1c4", + "sha1": "3932905d596d5d826d76ad750f9ee5aa83300a5d", + "sha256": "8a7603ecc0ff0b6b717477aa5d5afbd3df097137983e8e1f5adaba919a560842", + "size": 437, + "uuid": "e0b93b3d-075b-482b-838a-e36d8849607b", + "version": "2019-04-03T101557.655000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "622c51fc", + "indexed": true, + "name": "image_file_94.json", + "s3_etag": "8c64a2315a751302959367ff6db0f258", + "sha1": "cf13fc28ccfcbbe1757f2e36ac5e680af272fbcc", + "sha256": "3399cd5ce881ad41a2c66de6a2eb9beec34607c9a23e055aa033a7cc2f812c55", + "size": 437, + "uuid": "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", + "version": "2019-04-03T101557.378000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f742a098", + "indexed": true, + "name": "image_file_95.json", + "s3_etag": "b82ff13446f48b797b25ee7a247523b1", + "sha1": "9ce3bd2c23c3f3f318436171829e848879752b0d", + "sha256": "cf8e194170ee6776493818ba0565a0801d2b857072aa7f03764309ab3db3a116", + "size": 437, + "uuid": "c647964a-7796-4dd2-9fa8-b23f012ac14e", + "version": "2019-04-03T101554.078000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "33f738ad", + "indexed": true, + "name": "image_file_96.json", + "s3_etag": "7e3ff05da1641afd7f8e448506ab7bbe", + "sha1": "7e0c25e40da0f9cc8130390540fe5850bef5adc5", + "sha256": "8a74efabad603cbe62ae6711c2777020934ff877be26bd854748aa9b4d6d2857", + "size": 437, + "uuid": "87a63649-9834-49b8-89a0-310211c1b5b3", + "version": "2019-04-03T101557.378000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "372f7803", + "indexed": true, + "name": "image_file_97.json", + "s3_etag": "86eee4d968daf81c07b15df9578c3a79", + "sha1": "5c052256e33b424fecd5cd48d15340358dd1966a", + "sha256": "f9d96e64d719a40319b77c2f25b2b0d57729005c589da7caedb8750f063333f0", + "size": 437, + "uuid": "b2eb5b20-fd1a-403c-8b55-9eec5972d482", + "version": "2019-04-03T101554.167000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7920ddea", + "indexed": true, + "name": "image_file_98.json", + "s3_etag": "3f7514879a314611145fada6d6ef1a1c", + "sha1": "680d17694216d6446b2a97a811f5e938acabb819", + "sha256": "86f486d31d468286eea367872038a8f9a6cd7cb92120a2e84e0afda813f3dcee", + "size": 437, + "uuid": "4b3b36cb-cd90-4526-978d-2e7e8f7add39", + "version": "2019-04-03T101557.225000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4bb30263", + "indexed": true, + "name": "image_file_99.json", + "s3_etag": "299c9a59919fc74679773ad2137e5beb", + "sha1": "7c06964d005e1006afa38a10bd2bec82845f293f", + "sha256": "181f6ed90801bdd3f19172909a54eec5964520a6f1883f80b0407bb674c76662", + "size": 437, + "uuid": "cdc774f8-3310-4f1f-8c67-03579c253640", + "version": "2019-04-03T101557.258000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c7f66f6a", + "indexed": true, + "name": "image_file_100.json", + "s3_etag": "84d7f8e31b4e82269118ec57bfbe9de0", + "sha1": "9a3279a8e854b7198890d3cc90a82b3e98e3effc", + "sha256": "ac1e8d1a0b4b81f2f04392c43c65f80b658830eed5f9a82be8c37966e211f352", + "size": 437, + "uuid": "607370e0-7e7e-4d25-ba5c-957c00a73ac1", + "version": "2019-04-03T101600.280000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "624ffe6d", + "indexed": true, + "name": "image_file_101.json", + "s3_etag": "9612eff1a5c6807b112ca4f617c1a0cf", + "sha1": "43b0e9771bce23227ed553fc915bd7977fad7e9c", + "sha256": "a75773e2cb876338fa609bedd525a3bd19a8ba2f130326e9ed1a4f10af45b39a", + "size": 437, + "uuid": "3240d7ab-568b-4be5-adba-3178b3e8f85e", + "version": "2019-04-03T101600.280000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "61105f50", + "indexed": true, + "name": "image_file_102.json", + "s3_etag": "d6c60238a7e239f1b2c2d14ffdbfaff7", + "sha1": "4dc9d964fc5e3f096ff97e655379e44f51ae6283", + "sha256": "6cb57b49802a50e4dddeb57588ea5186e0377e89f623a77c65fbf1fe27571ae6", + "size": 437, + "uuid": "c0b6ee98-677a-41d9-9d80-9ac63d251b08", + "version": "2019-04-03T101557.303000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e2a40e24", + "indexed": true, + "name": "image_file_103.json", + "s3_etag": "ef8478fb1671bbc1d61e611d71df6209", + "sha1": "66a40c2e81ba53a78ead911040a04e4164060ae5", + "sha256": "a5c98779f87e59fa7376751b9ce911a4a2b478d0da157ff9d1471b3e97222d1c", + "size": 437, + "uuid": "f34c01ec-06df-49e6-bc2f-c50c7f398851", + "version": "2019-04-03T101600.436000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ed53b87c", + "indexed": true, + "name": "image_file_104.json", + "s3_etag": "cd43d127238ae68d6c2327f31449708e", + "sha1": "db64df46a9f42e44207740bd97841361c60e052c", + "sha256": "f6c5e6e0dbd6fef34c139a9435403c39f7de7c0fababdc5f4d8bbb4f9b8b66ed", + "size": 437, + "uuid": "2047311b-f3ee-4137-8338-a45166e01d53", + "version": "2019-04-03T101550.968000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "59fccb86", + "indexed": true, + "name": "image_file_105.json", + "s3_etag": "d92291c2deeb51a389c5211a387cbdd7", + "sha1": "3a23e34dd658ca95b49f583b6874ff845db80159", + "sha256": "15e24fe5fc4b6cf2ca9ed30d1268221ae111280b6ccff9683d16d196d36a4d3d", + "size": 437, + "uuid": "44ea335a-1991-4504-be12-04f1a332ddfb", + "version": "2019-04-03T101600.403000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d7098a00", + "indexed": true, + "name": "image_file_106.json", + "s3_etag": "85283fdd005d246b6fb38459d7f2440c", + "sha1": "1c73d5fb44792b50527e840d2e625e9a56ede3f5", + "sha256": "0e02dcf31f407949507893d0a21d3ca9b4b9a179a7acdf9f787ed8fe920a738e", + "size": 437, + "uuid": "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", + "version": "2019-04-03T101554.147000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e63be200", + "indexed": true, + "name": "image_file_107.json", + "s3_etag": "233a420f75217bb794b045ccfbb292c5", + "sha1": "3603e59b9f6c90a093ef7749eb098778cbd638aa", + "sha256": "235200c223615ab1193535c564f774895e405aa2e9546759f2dab55aa5ce2451", + "size": 437, + "uuid": "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", + "version": "2019-04-03T101600.681000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f9a3777d", + "indexed": true, + "name": "image_file_108.json", + "s3_etag": "65d36a223b22814e7a5114378f4febf2", + "sha1": "b1d71006b9a1198c2e506f408872bdd5ac4db009", + "sha256": "8fba1891ad6b9df93f54b549089db335e7e30f54887f530ac21b9277457e9d18", + "size": 437, + "uuid": "6af3cb41-9e64-4b11-b272-be87adf0fa94", + "version": "2019-04-03T101557.097000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "54b9897c", + "indexed": true, + "name": "image_file_109.json", + "s3_etag": "0924942c5529ce97e69d64deeafe4193", + "sha1": "a3b0c53987977b17d90b50cbe75d04e08767e28d", + "sha256": "bf4ccbd57c8ab29598df6db62c0242c59cf9497d68523d7d34cd27dfd4e1534c", + "size": 437, + "uuid": "7541d176-dfba-4e05-ba45-0c6964271dff", + "version": "2019-04-03T101557.397000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "79071d9d", + "indexed": true, + "name": "image_file_110.json", + "s3_etag": "9102a7f7284f714de7dd7716a9e27620", + "sha1": "5e42004ac09f29adb33554087c9de21e557be9d9", + "sha256": "9697819224a07cc6cacd817a072d1ea331692b8c2de7c80d21883d8e2c5502ae", + "size": 437, + "uuid": "8ee1e829-a507-40a5-87ac-7fd8379b87ce", + "version": "2019-04-03T101557.618000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e7e82287", + "indexed": true, + "name": "image_file_111.json", + "s3_etag": "04794f18a9e69798098d87af82b0ac50", + "sha1": "d9f31ee11b671fc7e5c4ea5e9fd656380358a6ed", + "sha256": "17d7e6629a107f8cd2513a9b54ed787786842ed61bff2f0ee99a816572922417", + "size": 437, + "uuid": "8e57554a-abb2-4664-87b6-a397f4da6555", + "version": "2019-04-03T101600.218000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c1769884", + "indexed": true, + "name": "image_file_112.json", + "s3_etag": "2c4ac75a339eccbb64b95a4772ca0286", + "sha1": "3ca9d372b0d6515a12492af3b6e253634d3a2c35", + "sha256": "1f3ea4e1d4dbb998ea75391d51abd0bce2110c13dd8364ba8a37391dc92761a0", + "size": 437, + "uuid": "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", + "version": "2019-04-03T101557.372000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ae603b89", + "indexed": true, + "name": "image_file_113.json", + "s3_etag": "92a50c4f73d046495f9047669dc95400", + "sha1": "645f1bff947772653acd03f6a7a28dd4a1254259", + "sha256": "cc69be74713fbfc1bb0b5a0acad1c8836c9b2147fe007457f90272266f70cf39", + "size": 437, + "uuid": "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", + "version": "2019-04-03T101557.219000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "73d138c9", + "indexed": true, + "name": "image_file_114.json", + "s3_etag": "f5a3493d4933a9d3def5aed6bf4dc974", + "sha1": "4eac231dc59f280fac884896aa72681c22b9a22c", + "sha256": "b32d18b2ef17e125b656df0e09afc7cf6f21ea3009dd79f73f3ab7d291b9a5be", + "size": 437, + "uuid": "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", + "version": "2019-04-03T101600.319000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "2002b87e", + "indexed": true, + "name": "image_file_115.json", + "s3_etag": "49fdb8916437c2d00c9362050564f8db", + "sha1": "fb1dc7c2021f1f92193079a4e19f8979ae078514", + "sha256": "405bc8dee78ba33131c71b2a894d10b7a4a49b5adc97b82b3642e27713592b38", + "size": 437, + "uuid": "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", + "version": "2019-04-03T101600.829000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d2232993", + "indexed": true, + "name": "image_file_116.json", + "s3_etag": "7b03afd50c19ea3220af78da012d474c", + "sha1": "5caabb826abcc6449375527d011f46c382c38e96", + "sha256": "475bff5a0b66a5cd85554951a3da5cf9ae03e1d56df2a4fdd8ddec885ea90c02", + "size": 437, + "uuid": "f0cb4244-e19a-46a0-89f1-04143548872d", + "version": "2019-04-03T101600.414000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b381224e", + "indexed": true, + "name": "image_file_117.json", + "s3_etag": "e2ac25c9e4dd4a54c505f071249aced1", + "sha1": "653b892fd869284e0309ae1e25dcd1cf019187b3", + "sha256": "67d977bcfb8d491d430f00162f53ceba85b02a95b71cc5b2dea4fd1ce8d6d511", + "size": 437, + "uuid": "73074f55-d009-41a2-929e-6fd9949bb1dd", + "version": "2019-04-03T101557.285000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "75bd6a49", + "indexed": true, + "name": "image_file_118.json", + "s3_etag": "2c552e3196418b5a5ec891ba0e26ec86", + "sha1": "3126099c6657a585599ee1f7726cd3228cdb46a2", + "sha256": "209e942d61b826433bb3b4cc931166a73c5901c3746d35d590e554fad83f436c", + "size": 437, + "uuid": "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", + "version": "2019-04-03T101603.247000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5b9a0501", + "indexed": true, + "name": "image_file_119.json", + "s3_etag": "974f31e145f872033ab5bc86e050e39b", + "sha1": "519fe892b3a9fcdbb121bc4fa403e353025a236c", + "sha256": "f440dd4a87df90e9bfcddf95095a240ea0de8a20288355eab70bba407296df4d", + "size": 437, + "uuid": "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", + "version": "2019-04-03T101551.101000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "32464a4e", + "indexed": true, + "name": "image_file_120.json", + "s3_etag": "2fad178d730a3fd02138b288f5b7d152", + "sha1": "cef2feb1cbfb9f700567987e7238d9c90303b537", + "sha256": "0d2fa638787455be594ff8c3eba9a1731854eb5224f3b836619ef99ca11aebf0", + "size": 437, + "uuid": "146231bb-1b13-4db5-8157-9d9962cc3a3a", + "version": "2019-04-03T101600.042000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b347303b", + "indexed": true, + "name": "image_file_121.json", + "s3_etag": "45819280077953a7a4043d006c32e95f", + "sha1": "be3950c90eb520df4c0db5bb78bfcf6cdf364a78", + "sha256": "de0ea21220a12139e499c35acd5b4a5a3000e638835fdc772745d3f54fdc2d9f", + "size": 437, + "uuid": "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", + "version": "2019-04-03T101557.650000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f83dbf7a", + "indexed": true, + "name": "image_file_122.json", + "s3_etag": "25fa029b8cc72c3d263016e44136acb2", + "sha1": "8fc55cdceeaaacb6166525a56e0e9be43f8c5d2a", + "sha256": "0ff933b23d7d629e121ed1cf845eee404eea6d8322d609b5b7d16149eaf17229", + "size": 437, + "uuid": "7fe17380-3090-4fc3-9504-02b3f8ed95b6", + "version": "2019-04-03T101600.270000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "20a30aeb", + "indexed": true, + "name": "image_file_123.json", + "s3_etag": "ff0ff40005e08d2ec615286d214798ee", + "sha1": "00b4280000427d5850b6201e603c711910ff5faf", + "sha256": "6b2ae2280f5ff317272091022d49e24e0f82522f85e99f42bba4d5b250645aa8", + "size": 437, + "uuid": "fc405b01-60ca-436f-a06c-2f38f7156a87", + "version": "2019-04-03T101600.160000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3d500e06", + "indexed": true, + "name": "image_file_124.json", + "s3_etag": "765c12fe8aec0b8b560be0caa7d1a1a2", + "sha1": "364cdc9bd7e1289522d53f378f1d31b44494baf6", + "sha256": "ca52cb02fea907aeaf355786658202edf0d186fb1a2accd5ab7b90db40052469", + "size": 437, + "uuid": "bae92b53-c6c7-4712-865e-6cff3cba506e", + "version": "2019-04-03T101600.763000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0a5825b4", + "indexed": true, + "name": "image_file_125.json", + "s3_etag": "ed8f09ad61dd92fe37c3311c0da8e7d7", + "sha1": "90ea8642a77ff2596131e50687db1f35d51f1b44", + "sha256": "5d17f983241619d437110e0ab3cbd20cd4d0cabe26a27ce7695c88db17f6d239", + "size": 437, + "uuid": "83662ec5-a202-42ab-9a47-a701d4f19de3", + "version": "2019-04-03T101600.067000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d283a3c0", + "indexed": true, + "name": "image_file_126.json", + "s3_etag": "41ab5d98dc01456e033ba21cada13967", + "sha1": "28f2f41885c436c12af1316d6d81ae587d587ecd", + "sha256": "0c2a898e93a79cd6f8f79523dd46fb0a31c01d628f9af9660bf0ef1846db4fba", + "size": 437, + "uuid": "a04957c6-8ce8-4fa6-950d-71812ff3d698", + "version": "2019-04-03T101557.271000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "2930ebf2", + "indexed": true, + "name": "image_file_127.json", + "s3_etag": "ffa9e1437330e4ab38b9e35946e3da76", + "sha1": "29e640bc48643e6930ae4615c3b16fbdd4771bb3", + "sha256": "631ee2371f5ca8d15962b29394e5f532be94ebef0abf3fc0cf91e7408fd9dfb8", + "size": 437, + "uuid": "9284d3a4-73bd-4aa0-847c-ab273d14185a", + "version": "2019-04-03T101600.765000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e6f83572", + "indexed": true, + "name": "image_file_128.json", + "s3_etag": "1fad73cf9527342ba01c029eeddc9c6a", + "sha1": "7916b415e145c01bba59c939a1c8caef58672942", + "sha256": "c0267f598a6a8f796bc19637830c6464bc0f88164482408895d232ebffa74f64", + "size": 437, + "uuid": "4d664562-c333-4aaf-bb8b-641e0568733e", + "version": "2019-04-03T101600.166000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0face8e2", + "indexed": true, + "name": "image_file_129.json", + "s3_etag": "c3946fd4f7038ec19522943290a01823", + "sha1": "dccbc72810c9a914396bece0ac056b992d3319ec", + "sha256": "c97f7b03e607af29022647cb841f3eca29e09b23db9ee1d28bfa6e2e31833231", + "size": 436, + "uuid": "b533685d-3c60-4483-841b-a054f0a69fec", + "version": "2019-04-03T101554.188000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "eeb1cf11", + "indexed": true, + "name": "image_file_130.json", + "s3_etag": "50fcbb4d44a132b0c931ddd3850cdb76", + "sha1": "4b167cc718f2a451411dfe8439b290071075d3df", + "sha256": "9916e0dee25d18f691fb03a0f86d11236a31751f74b7f3c012b8c041ccfe04e8", + "size": 436, + "uuid": "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", + "version": "2019-04-03T101557.291000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7d18a70f", + "indexed": true, + "name": "image_file_131.json", + "s3_etag": "09415327b487d9215fbe3a7cd9971c55", + "sha1": "1987b17490c671ae6b951a56fb8ba4f055af4aa2", + "sha256": "c3cc6d03ace371186e69ea2415ea613995215b8aed9dc922dd95e1a35308efbe", + "size": 436, + "uuid": "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", + "version": "2019-04-03T101600.394000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "79c9d70e", + "indexed": true, + "name": "image_file_132.json", + "s3_etag": "e8ce33c0637ad065f3c7c9a78de30385", + "sha1": "b03fef701c5df99332e3d1517a90631aa031b862", + "sha256": "c7608f0bec65265bb64ca7ee2331f9ff640156687b1f01c027acd02aef2930b8", + "size": 436, + "uuid": "3e8510c9-7e31-49bd-bb90-cb55577c2f25", + "version": "2019-04-03T101600.298000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "27ed9a00", + "indexed": true, + "name": "image_file_133.json", + "s3_etag": "ce451ac5cde6b0c2cb1a3adc91d7164d", + "sha1": "4b0a408cbd8cf2f87690fb73cede23de947ca04b", + "sha256": "bb545cc8d1fe58ba58c817538725802ac30511b624eea797cd7c4a1d3ea1d2a0", + "size": 436, + "uuid": "463aff9a-ec7e-40d0-be42-c6686af9130d", + "version": "2019-04-03T101600.374000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "76e8ee5d", + "indexed": true, + "name": "image_file_134.json", + "s3_etag": "cc459b9d7b79e0fef59d42408c20b41b", + "sha1": "982bb44680503ba65a841496e17bbd05a3489c3f", + "sha256": "03110bae90cfe1ee3c1ae30589bb0596a45c44e7b2dcc785fc8f1c9dd717bfef", + "size": 436, + "uuid": "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", + "version": "2019-04-03T101600.331000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "47f5374c", + "indexed": true, + "name": "image_file_135.json", + "s3_etag": "77583cd44f03dd1186a2898b798bb9ca", + "sha1": "5f58a0d3791185ea4bf1ed4ed353f0bd66ce7c23", + "sha256": "e4d5b9e10d9be4235dde88a29f2c56c7d23bfa0f8a23c7d3cb13467f80c0f723", + "size": 436, + "uuid": "868efb99-df36-462b-91a2-bb6ca27e842a", + "version": "2019-04-03T101557.472000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0de6130e", + "indexed": true, + "name": "image_file_136.json", + "s3_etag": "d90a9f70d65ed59bf7277ed6a7372736", + "sha1": "ec158fad497fe8036c5832cb23afb5cd9056f5c6", + "sha256": "455d6ba0201f4cc52da2c2c4c8e7b77ec1863ee9fdbf83e92fea1eba32de30f3", + "size": 436, + "uuid": "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", + "version": "2019-04-03T101557.134000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "80bffdf2", + "indexed": true, + "name": "image_file_137.json", + "s3_etag": "5676ddf939d13e2efe60b272a64c07b9", + "sha1": "23c94945eeb9f001f6bbf4ade8ba9f8737ec3ac6", + "sha256": "d0e1200160461dae6b9f135d8f3675db46bf9f793eff1a443f1580af484ebfce", + "size": 436, + "uuid": "36ded48a-869f-4fa8-971f-56bc28298276", + "version": "2019-04-03T101600.039000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1ce611f0", + "indexed": true, + "name": "image_file_138.json", + "s3_etag": "b63dfe549fefc2224fcfda0c5b7f36f8", + "sha1": "3d0d7637421bceb4e12c3972816c596a05b5849a", + "sha256": "bdaf3af322d92baff7b48b2857bd0b293932e415b28e7c0cb80b37cda4058b55", + "size": 436, + "uuid": "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", + "version": "2019-04-03T101557.347000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5a22cc4e", + "indexed": true, + "name": "image_file_139.json", + "s3_etag": "406308a789dca9a4f1fb3e42c5d0ce6d", + "sha1": "7a7d2ad5df54c464b239128752c9db0abcad8a4d", + "sha256": "d845d457e3e3d5216e807c174e1b6c828785bee4c5caca5c1111f9a59531d040", + "size": 436, + "uuid": "e72742a4-23ba-4e5d-a29b-ad449abe8101", + "version": "2019-04-03T101557.374000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "321edac3", + "indexed": true, + "name": "image_file_140.json", + "s3_etag": "998b50460976c875a91ba2abcbb145b5", + "sha1": "7e428b8ed4dfe7e32680bf3305c715cb008479f4", + "sha256": "5df5e75dbb87f5f393c1849cf8bec18363833c36f17bd4734f3b528c2558dd5d", + "size": 436, + "uuid": "cd6e1096-f8c3-4eda-957d-b09741d60901", + "version": "2019-04-03T101600.117000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "05c21c7f", + "indexed": true, + "name": "image_file_141.json", + "s3_etag": "f7191d8b82990813acdaeb81a3c48e09", + "sha1": "4a54ae7415987a2289cdcc7ec4f52271d6a31687", + "sha256": "5e571a9b994680f3c22dc7602a6d1963968218df6dfe454d31ae7845f4b22bd5", + "size": 436, + "uuid": "903ea376-5153-4fb8-8ffa-e2948951409c", + "version": "2019-04-03T101557.150000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a391fe15", + "indexed": true, + "name": "image_file_142.json", + "s3_etag": "49fa6f1f0f9045e97c687ca7cee1a427", + "sha1": "b598f243e49b4c0038b35ca80c85fa369512314c", + "sha256": "4bfe719bda36737bcfe027391ee51f71d255899c604fc0c7c564caeaa571b79a", + "size": 436, + "uuid": "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", + "version": "2019-04-03T101600.258000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0f6d4dd3", + "indexed": true, + "name": "image_file_143.json", + "s3_etag": "dedcad4d1d420963dda73eaa13de9ad0", + "sha1": "d6d83a8d1e3d9577445635afc6c50f998aaf540d", + "sha256": "761e759e7a00651aec0fac66bbd59ef0aeb36b2557dd1246eda36f8ed69c6250", + "size": 436, + "uuid": "8381d167-c4dd-49a2-b5df-1ae815bbe42e", + "version": "2019-04-03T101557.334000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f5635da2", + "indexed": true, + "name": "image_file_144.json", + "s3_etag": "79b298d6e9509013fa92a009be3060e1", + "sha1": "d9588ae5a7ec0a693dce7526f10c34584d9465ff", + "sha256": "f5a3b61de263bf318c23ab9f56037feb5789a168b8daf4ad3b1d1ae4ab0394f5", + "size": 436, + "uuid": "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", + "version": "2019-04-03T101557.150000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ae023b15", + "indexed": true, + "name": "image_file_145.json", + "s3_etag": "277a167ac421f95409963957f70ec2a5", + "sha1": "b52c00f0005001479cc124d53dcc1cade66cd123", + "sha256": "830a39493a1edcdb9cdd7c760d17bcf246a6793e131700a5088751b9f83ddd6b", + "size": 436, + "uuid": "cf305c60-bb2c-41af-82bf-0631c2a7b0be", + "version": "2019-04-03T101557.290000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "f217da63", + "indexed": true, + "name": "image_file_146.json", + "s3_etag": "68059331cc8eba21ae8da8eec733a92c", + "sha1": "6ae82b609470e7c25a3a7802f3fef1e18cddd91e", + "sha256": "6a35e93e2b0ba923a92cb3feed491152de214cdb71b89481fa756153ad2e892b", + "size": 436, + "uuid": "074290a9-35e1-422f-a3af-e5ed58781b4d", + "version": "2019-04-03T101557.347000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8ff80ff5", + "indexed": true, + "name": "image_file_147.json", + "s3_etag": "234da0f4d86eb03da380ff350d87b410", + "sha1": "397af1eb0ffd0fe65abc7d7d65f81cba7d7bbfaf", + "sha256": "3245c4b347e2614367a0c0e5be0af80e86d79eb25cbbdf3521528db34220faa7", + "size": 436, + "uuid": "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", + "version": "2019-04-03T101600.451000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "54435b96", + "indexed": true, + "name": "image_file_148.json", + "s3_etag": "829f2304a1d66de60eab78bb8de7ff53", + "sha1": "5eb6f2581432a335c2849d90ff63c15e1903088f", + "sha256": "35f0fe08eabe0511e110f9cde3fe8f56c038f14e3ec5f51b1c842c53b8b1a4c0", + "size": 436, + "uuid": "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", + "version": "2019-04-03T101603.144000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1722edab", + "indexed": true, + "name": "image_file_149.json", + "s3_etag": "a1b65af108379e8caa23b206a548984f", + "sha1": "d00d1811fe7c4dca9e85bb4b6835f0739d213aba", + "sha256": "15d1cbf4249524b751f63dd52d2c110c14634e4fbb88657bfaca27cdc6b97ca2", + "size": 436, + "uuid": "5165cc56-ff89-42bf-b000-fec4bd57176e", + "version": "2019-04-03T101600.708000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "685b0cfa", + "indexed": true, + "name": "image_file_150.json", + "s3_etag": "38c369f513b7c2eed7c745328979b76c", + "sha1": "d57ccb510a194f02b991e64e37e651f40c033194", + "sha256": "c5667a1a102c5a80d8b44ef82213da14d545942e30c735bf7dcfb67932384a3b", + "size": 436, + "uuid": "545be634-5893-45e0-93b2-dd4ea93e00db", + "version": "2019-04-03T101600.405000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "fe1bbb74", + "indexed": true, + "name": "image_file_151.json", + "s3_etag": "6062fbf6271c2148b2fd4737b216db40", + "sha1": "5bb0d785da697b28316390ffde3db2b05c38180f", + "sha256": "8231bb5b5cb4c9817d3be93acda16e781368fc3925de5540b513c586094e4a9c", + "size": 436, + "uuid": "2d2e58c6-7c24-4089-bbe9-d47b7482be46", + "version": "2019-04-03T101600.253000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8c4bb73b", + "indexed": true, + "name": "image_file_152.json", + "s3_etag": "5f722ea4baf112069b8a5bf1b01a13b7", + "sha1": "82aef5f80d2e84b65efde395b8da62499ecd9302", + "sha256": "66b544e1348b06907777033d0c4d07af18e50bcde6420125f265bc6f197cb8ed", + "size": 436, + "uuid": "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", + "version": "2019-04-03T101557.292000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "11249b6b", + "indexed": true, + "name": "image_file_153.json", + "s3_etag": "6ef957eddbad0f492996f3f363e8ae51", + "sha1": "ebef3a01f7e15db24021b9a6d19322d37b733a8b", + "sha256": "38c9cc3471db114dc2be54d129a1190008513a77ca65804352efcfe9201cb08c", + "size": 436, + "uuid": "81214e49-318f-4221-bf2c-4ef00cfa916b", + "version": "2019-04-03T101600.761000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "92b0b29b", + "indexed": true, + "name": "image_file_154.json", + "s3_etag": "c90e974cb1b1892dbeca3185a907b500", + "sha1": "1f407c842e06425614a768f8a10266cb007e1e9f", + "sha256": "a8c965392de54d429232efdfed7d0107d7e7a7c6d0686d74b4cfcc0c6bafd90a", + "size": 436, + "uuid": "7fc97754-1121-468b-b1e4-839bde86b6c8", + "version": "2019-04-03T101557.316000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b1505ecb", + "indexed": true, + "name": "image_file_155.json", + "s3_etag": "6cf24b3927d8e13d844f6819a3840238", + "sha1": "f06abd8bbb30f39f06a245ccbe6439b8c766cb6f", + "sha256": "701ebd34ad74580573d6a298bca4519b8b292996ee5141ad602cf6126602a37e", + "size": 436, + "uuid": "7d70d44c-b5d7-47be-9687-e9a775e86251", + "version": "2019-04-03T101600.785000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "efa31258", + "indexed": true, + "name": "image_file_156.json", + "s3_etag": "cec56efbee285fc19c3ee663dc551084", + "sha1": "cfe179f1ea6d3a17d6335ac2894502994e69261a", + "sha256": "be2350182247dc4e96357958ac29aad38fe7f1f5967e219c9bdf60a87d00d41a", + "size": 436, + "uuid": "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", + "version": "2019-04-03T101557.619000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "58022c3e", + "indexed": true, + "name": "image_file_157.json", + "s3_etag": "320217d67eff2c0999400320c4b4c479", + "sha1": "b84b26090099a14047a4d446d3534d8bd86b8f58", + "sha256": "34e8451f895b057d9eb9d78b052315727d0ca27824ce7b802924c14bb56d92d1", + "size": 436, + "uuid": "b7607809-e975-4c32-bff7-375cb2d8276f", + "version": "2019-04-03T101557.213000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "646ebd9e", + "indexed": true, + "name": "image_file_158.json", + "s3_etag": "b0fcc0e0fa26aadba68868c953e95aa7", + "sha1": "4250fadce024c8e572ccae9196a34c3add170bc0", + "sha256": "61126f5fd54652044be1a6024516195d785bc5682f99619e646e75c8e9b4ca09", + "size": 436, + "uuid": "b8a6c863-626d-4fbf-863b-610cffaac37d", + "version": "2019-04-03T101600.707000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ceeea3d0", + "indexed": true, + "name": "image_file_159.json", + "s3_etag": "9c2b629c3f76d3cba6cb9d2cf36f2969", + "sha1": "df803935dbcbbc632fbef8449c4edd8803558da6", + "sha256": "90c270bfa37cefaa0fcc7f60e4bd9cd96c5a7c7e59533cd5c89437e3d85e5ec0", + "size": 436, + "uuid": "45077a5c-ee96-47c0-a84f-9d46cf799338", + "version": "2019-04-03T101557.619000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "07d7c432", + "indexed": true, + "name": "image_file_160.json", + "s3_etag": "c0e3a6c7a3b417eebe7158d0fb4f44de", + "sha1": "b1e56979e1d8ec8ef40bc9ba5577dbdf0c170a4b", + "sha256": "c1e95db63a247249500612b3ac067bfe3fe990b92913a1ec51b9612dc6e4fec3", + "size": 436, + "uuid": "49d82b74-6f1a-415c-93ab-958c60f083b6", + "version": "2019-04-03T101557.323000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "432002e2", + "indexed": true, + "name": "image_file_161.json", + "s3_etag": "96bfcb095d96f58c1aea8ea4b2322dd4", + "sha1": "d8b85fac27de7dcf1258fc4623d0cb465635a89f", + "sha256": "3366f748eaebf43ba8502f4c744a05fe4410b2b8a42b89484f2bf4e9604cf5c5", + "size": 436, + "uuid": "753b51b7-a909-44e7-bb21-cf2cd18328f8", + "version": "2019-04-03T101600.722000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e5099003", + "indexed": true, + "name": "image_file_162.json", + "s3_etag": "e61fcde1c4228360450a575067c4dc29", + "sha1": "5fb6230b4a18e08a79f45d57fafb11450991a3ed", + "sha256": "369173be00544e7db713040ae411dcffc156ffff71ecce67c23b2d6cd76e4c3e", + "size": 436, + "uuid": "c7ab6349-b2bb-4ba3-9c9b-27d270550052", + "version": "2019-04-03T101600.390000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8ef87540", + "indexed": true, + "name": "image_file_163.json", + "s3_etag": "5de5c4488b699a38d35a6cf1a3729ec2", + "sha1": "8812a835916c73d11fbcdce13ec0fceb46104e08", + "sha256": "f68584cf5841a7423b2f39719f7bb250e509062572c116628a2cd764a2fb06ab", + "size": 436, + "uuid": "7be770fc-4a56-4f82-a4cf-3cf908d54dca", + "version": "2019-04-03T101600.789000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "361437fd", + "indexed": true, + "name": "image_file_164.json", + "s3_etag": "41b89d6da480cd0db891c52c634e8815", + "sha1": "387f16272f6a0da030485421d02c3e7921406ddd", + "sha256": "441ace0d1c8b13015277680fdfd7548dae8fd05393bb06be7627c2c5a29844b9", + "size": 436, + "uuid": "3f5f8537-c1af-4d2e-a732-53b6d4275588", + "version": "2019-04-03T101600.749000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b934da24", + "indexed": true, + "name": "image_file_165.json", + "s3_etag": "584d533d0e7bc1df7f178732438ea21e", + "sha1": "ec7aca11af79a1b696f54f0cb1c70606e3fce94e", + "sha256": "0094cb6ffe96d5ee71480e8ea461c94058f9618c078888ccff23a1122cc61686", + "size": 436, + "uuid": "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", + "version": "2019-04-03T101557.145000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "12539dd0", + "indexed": true, + "name": "image_file_166.json", + "s3_etag": "f26054dea0d3b7e8c776a0a55c295c8b", + "sha1": "a0342333a1abb0ff158ba07c7e78118c4a57b0ff", + "sha256": "24fe0898bd7fc8aaa554d7ba22ac6cafd74ee1bc3f0e1b81a77b46e2f24edf9f", + "size": 436, + "uuid": "f986c2c2-2823-45a0-80cf-5e6f67958afb", + "version": "2019-04-03T101600.833000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "22a53208", + "indexed": true, + "name": "image_file_167.json", + "s3_etag": "d2fe9d320c5908fb6b3d0af4616e2189", + "sha1": "6167d04ed23d98345784b5e6191dbd38618b0cac", + "sha256": "09c0968595187999bba9a8eca60c7853abc81a5a005d85ccfb48ccdf022fe3b6", + "size": 436, + "uuid": "7d17d6d6-d038-40c6-b965-6de41ce9c931", + "version": "2019-04-03T101557.652000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "62177c6b", + "indexed": true, + "name": "image_file_168.json", + "s3_etag": "a7a228cdb27db7e6349c86a4f1618922", + "sha1": "954be66ea44ed4b270ddd8d2c518e71f0c0c489e", + "sha256": "6f1db0bbaa75a5c7f8735d06835024fd9b32db984527f4923253aec9cac0ec32", + "size": 436, + "uuid": "3d208b38-62c8-492d-9434-21bb66ead16e", + "version": "2019-04-03T101603.214000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "de89cf68", + "indexed": true, + "name": "image_file_169.json", + "s3_etag": "fe1b4590d57459ce581a7755b8939e79", + "sha1": "7762a76834aea1aacc5b965d70a649004b8b8c67", + "sha256": "a674fdce30a1aab7bc45095518c3b14942bf60eeb6b7873ab5f2161bc014c21a", + "size": 436, + "uuid": "9a982898-77c6-4a56-8e54-9cb83ff0b235", + "version": "2019-04-03T101603.249000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "553133b0", + "indexed": true, + "name": "image_file_170.json", + "s3_etag": "81bfd03ec69d028d623809786583bb08", + "sha1": "39dafbe9e39d05153bab4af4bc81186b716c8158", + "sha256": "9bbc3bf95a7e3c9e15b3204e247cc577c47c21d1ecffb0683878841b7986bbb3", + "size": 436, + "uuid": "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", + "version": "2019-04-03T101600.293000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "16781583", + "indexed": true, + "name": "image_file_171.json", + "s3_etag": "e3db20f24674487c034a21d232110849", + "sha1": "a6598d4672988c579d26a334e2ee3d962ede20ff", + "sha256": "09c65df04747d7c47f3e2b9d2fdc4ac65cad2d5161628b3b4c778ab737a275ad", + "size": 436, + "uuid": "24b6366f-03ce-4e4d-b50f-90687f3e2b94", + "version": "2019-04-03T101600.295000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1a02cf5a", + "indexed": true, + "name": "image_file_172.json", + "s3_etag": "e519eb15144b716f9043913d598d4f16", + "sha1": "7857304e4d0365ad9798a25dd7ab10b5faf98f6e", + "sha256": "fe756824663266bf7ea44ccbfd6e6fc8453e890c7101fdd8e20dfd6b78c4fcd8", + "size": 436, + "uuid": "ec1d0987-fb49-48b8-aaeb-321c659fb67f", + "version": "2019-04-03T101603.247000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "2017fe6c", + "indexed": true, + "name": "image_file_173.json", + "s3_etag": "33310bd4f765e5d9fdfa84391fe65997", + "sha1": "dd891013bd2b86b798c274ea220c347cbdd9beb8", + "sha256": "be299b783b326df47bad2a3888d2143787b66284e4551a8b4e60868e705e1bb3", + "size": 436, + "uuid": "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", + "version": "2019-04-03T101603.243000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "bc9f22d6", + "indexed": true, + "name": "image_file_174.json", + "s3_etag": "bd6f25c52f98f9d018ce3dcac6d5c9d0", + "sha1": "767a201d9dd1b45cf039fd6274eb64b26d58af21", + "sha256": "03b015063dcde1dacc16ffc3b07897c48b2f59a8d7b0c5f046687bfc27b5e380", + "size": 436, + "uuid": "6fbcb1c7-ce98-46db-8054-b451b6bca205", + "version": "2019-04-03T101603.126000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "51932b0a", + "indexed": true, + "name": "image_file_175.json", + "s3_etag": "8df486d3076b276de29d7c61ef658dd3", + "sha1": "ed8d4e51f6746783b1a47aa9362460f88f560a38", + "sha256": "bbdf743a6e804d27b94cb33e8e6b59d6a3413e67559f643e403d411034da8c00", + "size": 436, + "uuid": "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", + "version": "2019-04-03T101600.740000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "352d8c9e", + "indexed": true, + "name": "image_file_176.json", + "s3_etag": "5ee1244cb84cce357b2872f2981824ed", + "sha1": "419870f478eaa3d85e935b759aafcf650f879111", + "sha256": "4f619d3d55398b5a749affa5ae641328d59d1967944794b985a4657c9b2bf953", + "size": 436, + "uuid": "aa6fca0d-6a70-4016-a0e4-307878e9ff45", + "version": "2019-04-03T101600.704000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "460ce4ac", + "indexed": true, + "name": "image_file_177.json", + "s3_etag": "432d0ce1357747d3243cd50cdd5889ff", + "sha1": "ea8383e16d3eb94f20f7df6bd6cbfbfe65382b7b", + "sha256": "efc92103a7b664b3c6b02a7c17066ea9b18b216382c0822a22397d471886d0d6", + "size": 436, + "uuid": "ee62cd8d-fb93-4082-980b-213c7a8a0c47", + "version": "2019-04-03T101603.200000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "8c61b419", + "indexed": true, + "name": "image_file_178.json", + "s3_etag": "e2cb8e6eb869c7afaec442ae0995344c", + "sha1": "5a7072fc808d4fa06e6d8419ba9134df1d811d17", + "sha256": "0770fda7d1a5547dc66457035da318cc219c375a41f39ca46a96e7be9ff44cea", + "size": 436, + "uuid": "bbd60a79-3572-42c0-8e53-b0c566a72f06", + "version": "2019-04-03T101600.196000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d6abb209", + "indexed": true, + "name": "image_file_179.json", + "s3_etag": "6fe43e50969938136da468e2e8894acd", + "sha1": "928483c2c0bc4d342881b2c25545d01f16c7cb71", + "sha256": "e7747c7be140489f48c578f797c0dabd4d5e9c3910e3bc76a23c1e692689a232", + "size": 436, + "uuid": "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", + "version": "2019-04-03T101603.144000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "b7d162e6", + "indexed": true, + "name": "image_file_180.json", + "s3_etag": "65cb49caef64788194172bf4fd7417ec", + "sha1": "c0872b0193ce9e8fc448fe9e94a6beacba1746e2", + "sha256": "437a5501e4310cf20869d13dfc3a8cfddde42934d1bfa8cc0a4cb444ecf6ccec", + "size": 436, + "uuid": "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", + "version": "2019-04-03T101600.186000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ab6d5527", + "indexed": true, + "name": "image_file_181.json", + "s3_etag": "0d1c86f83d065d1343c9e1d5c8369510", + "sha1": "36dd9aa93668a920858e37c85f8c02e719b0bf8c", + "sha256": "d1d7ee9652037db25e4c2656e9a86ed0a760a847db8bf82ffccd4f2d17f9dbe9", + "size": 436, + "uuid": "240a67cc-e827-41bf-8ac8-a66bc2797f13", + "version": "2019-04-03T101600.772000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e8a5c694", + "indexed": true, + "name": "image_file_182.json", + "s3_etag": "e8041e3fc5a4750d673038c51a56cb2d", + "sha1": "82f3db843dda004956f0601eba039e06c73f80e4", + "sha256": "3b5b2116d087aa66be81e7a4cf01aa166b451059644666a5ee9de2853fd9429e", + "size": 436, + "uuid": "7a9b6534-fa1d-4282-a064-11e60e57a322", + "version": "2019-04-03T101557.638000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ebb4c9bf", + "indexed": true, + "name": "image_file_183.json", + "s3_etag": "e36ac86b45f4c7bc73fc805b0f6fa961", + "sha1": "02fbfef61f6e0348e3c951fbf884fdf424580d59", + "sha256": "14cea205be35245bcff2ef4edc06477006e533f2373efea065b9cdcc31c21429", + "size": 436, + "uuid": "b0af6371-4379-45f0-8c09-f6610833fc46", + "version": "2019-04-03T101557.644000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "d55668a3", + "indexed": true, + "name": "image_file_184.json", + "s3_etag": "eadfb043eb2f4e2b9553455bd0626bbe", + "sha1": "3ef44a8184b22183b8a4ce40c6ecdb5988a4dd3e", + "sha256": "dc39ccec6bd7573b1f78c794feaf9a56a6242c450a2cc98d5e2fdec9fcd0ed1e", + "size": 436, + "uuid": "f5ce7a96-cfc0-42c4-852b-386f9a27111d", + "version": "2019-04-03T101600.829000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "53b106a3", + "indexed": true, + "name": "image_file_185.json", + "s3_etag": "f5b281bace437f0502d62470e501693b", + "sha1": "67e6e702d619d4a3512efa44c0cdeb5c8a3a88a3", + "sha256": "a9d796b59974679d51b813ca6c2e08b5871b264c659fe31234a99905d6f317a9", + "size": 436, + "uuid": "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", + "version": "2019-04-03T101600.329000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6ae63063", + "indexed": true, + "name": "image_file_186.json", + "s3_etag": "307348fe8a62a4ec8a32f02d521a8e6e", + "sha1": "cc02d734a6a3432c53491b260975b8dd4846efd2", + "sha256": "77437331eff788ff99d67b5804f15a4347ec9203e4d6f83dc1ff41b250ad5bfb", + "size": 436, + "uuid": "3dff4add-7d6f-418c-afba-e46864af51d2", + "version": "2019-04-03T101600.156000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5a599407", + "indexed": true, + "name": "image_file_187.json", + "s3_etag": "f1339701f3d7b1a9d98143cfcce2a9d1", + "sha1": "98034f929d70572f5e6ab495e589823d17bd2d9f", + "sha256": "a752ff9735b42b9c6b53933327b5e6bb3ffb5a206eec41359e3fbe673543b0be", + "size": 436, + "uuid": "ab2b7c67-8f13-4388-acd7-e2abb0091f30", + "version": "2019-04-03T101600.743000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "31501c3e", + "indexed": true, + "name": "image_file_188.json", + "s3_etag": "25c95839ffa6224c6fcdc4777e508037", + "sha1": "ea040cf44c3033efe8cec73cfca87e8c280ae54a", + "sha256": "eff85621d5f8a8c61d7ad52200b0fdad1012e96f95cb22f9306774f6f412814e", + "size": 436, + "uuid": "d9912d93-3d92-48d2-9f75-826fbba3d94e", + "version": "2019-04-03T101603.046000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0abe958f", + "indexed": true, + "name": "image_file_189.json", + "s3_etag": "bd3f5852479205f5ec532855bad5bee2", + "sha1": "d4e050415bc653c7d81d94964f5a6fbfa5b2f14b", + "sha256": "4303ecc0597efcc9224f0284b47187457b1d22944dd0b9e017c06dfe7cd58524", + "size": 436, + "uuid": "8b37aba2-be5e-4963-8e6f-51a2df8e143e", + "version": "2019-04-03T101600.282000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "943e901f", + "indexed": true, + "name": "image_file_190.json", + "s3_etag": "dd592f9bd23d5aa50b12b7c5267a8cd0", + "sha1": "b189a418690be8517f963e5e667ad41e590f72ca", + "sha256": "10825c134cab0e3102cade1d845de5fddb61e752251230a8f908bb5aa6e1554e", + "size": 436, + "uuid": "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", + "version": "2019-04-03T101600.805000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9647cd7b", + "indexed": true, + "name": "image_file_191.json", + "s3_etag": "9e416c44355791d612ea6267d888078c", + "sha1": "938ffbf6ca9d303d925c986528dc7a8043dc47e1", + "sha256": "a15f99f58fa393134674a570f7f9456092547ad00b9462e6d3d448e67311fedf", + "size": 436, + "uuid": "2d7e88dd-bddd-4289-9556-27d301be0b83", + "version": "2019-04-03T101603.188000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4da02a27", + "indexed": true, + "name": "image_file_192.json", + "s3_etag": "7092c013124e5859bd69b7fe5b339053", + "sha1": "47472c37e3bc6100417316ab38dbfc111a637200", + "sha256": "43bfae4c58e8fdc505b85af39975ea3f7c907f8c1b3c8f83c9429f6902bf3644", + "size": 436, + "uuid": "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", + "version": "2019-04-03T101603.221000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "3256a7ef", + "indexed": true, + "name": "image_file_193.json", + "s3_etag": "d6117a6abe3d50b2dbe264dbe0c73e56", + "sha1": "6bd41d7486a9e6b5f51352b94cacc6781e6b902b", + "sha256": "c0b6f1bb3710d53f0851e894bc72644f11b0b020038661a10522765f1d7753cc", + "size": 436, + "uuid": "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", + "version": "2019-04-03T101600.822000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "9a11820d", + "indexed": true, + "name": "image_file_194.json", + "s3_etag": "d4c556de6670e046839e7cb11437b5e0", + "sha1": "ade1f482e297204d83b95182f816345122a94bea", + "sha256": "3540055a11816fa6f72725db6f5b57e1030229ef05011c8b612a3adb68122c50", + "size": 436, + "uuid": "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", + "version": "2019-04-03T101603.130000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "7355d406", + "indexed": true, + "name": "image_file_195.json", + "s3_etag": "f05c4c34f04b1438d00d90510e0fda2c", + "sha1": "e1de51e42ce3081bebc99823fd2c190b5b23451d", + "sha256": "2e9f75c40aba60a6adb0997169e35dce1849cb7aaddae973bb65fb873c6cceab", + "size": 436, + "uuid": "e834d3df-8432-40ba-b67d-c7cd0bd7328d", + "version": "2019-04-03T101603.234000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "dc6f1f94", + "indexed": true, + "name": "image_file_196.json", + "s3_etag": "a9940009deeab8048002e783153e2b71", + "sha1": "8a3a6ab8350e07f571d41acda03b4d71fcb572bf", + "sha256": "501e2e1a1370a0098b6d49bd30ea0412e409ee4e9c182f2a4d67bf608ec712a7", + "size": 436, + "uuid": "d8908d6d-5daa-454d-9082-726054cfddc1", + "version": "2019-04-03T101603.189000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4da217df", + "indexed": true, + "name": "image_file_197.json", + "s3_etag": "cfcd1856a0c424b0c950898ab7a6a4c9", + "sha1": "bee3506bcb8bc55b73fc2400f44954786cda09cd", + "sha256": "159f167c8f2cff0867dfdec5309f600367c82068a6d5cde76382570f1a8b64a0", + "size": 436, + "uuid": "c5a7142e-4702-4e84-b7aa-239df2a71ba8", + "version": "2019-04-03T101600.189000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "66d308ad", + "indexed": true, + "name": "image_file_198.json", + "s3_etag": "aa693959fee7931afaa88cd8627f2ad7", + "sha1": "0f1599c32f7c0603efe676f42a40aeabb8b89272", + "sha256": "730abec4612c2615243543b5dd7da6343f525bde84a1ec985578cd4e107dd78d", + "size": 436, + "uuid": "f69e44ef-cf23-4571-8dad-e44222697974", + "version": "2019-04-03T101603.186000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "33c37555", + "indexed": true, + "name": "image_file_199.json", + "s3_etag": "16c583f7c947c9e7e46eac026e60aeff", + "sha1": "a880caa603264e4f1bd78248d090d3d38adaf9e2", + "sha256": "f3627a523c3a78aa3c5f4ffa0ef0a10f30ff579886e86d072aa143cee8efcdcf", + "size": 436, + "uuid": "ea72f81c-2c58-43e2-acca-294254f470f7", + "version": "2019-04-03T101603.138000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4f9d0dc3", + "indexed": true, + "name": "image_file_200.json", + "s3_etag": "ea8d055f71652fb993d0a9ba990fe6f7", + "sha1": "6f2ff0c115545528c7f1725bd75130e3f85c8826", + "sha256": "2c63249c5f51b31921220d211469ef230bf17255f2a7b72393274dfb74310a55", + "size": 436, + "uuid": "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", + "version": "2019-04-03T101603.194000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6545d3ad", + "indexed": true, + "name": "image_file_201.json", + "s3_etag": "e44e2552c5f84e6c3e48c786cdf91eef", + "sha1": "334da492b9decfd6f0b6150de4badef3985cb62d", + "sha256": "8c398968ba0ec196d35e5810d2a3d6917cd3267df54753c32656df264f33e11a", + "size": 436, + "uuid": "6928ac1b-fd1d-436c-bfc6-4087c65809d7", + "version": "2019-04-03T101603.234000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5f297898", + "indexed": true, + "name": "image_file_202.json", + "s3_etag": "3f97fb45b0aa9ad15d4b33d2deb13cfb", + "sha1": "5ebd659f8c945b53dadc5bb8387b844193d1564d", + "sha256": "65bdb91e69ce438a2619d7b9ada56b427ee9af08d11fd88f74f7eb2583211b04", + "size": 436, + "uuid": "07a7b938-435b-4804-b140-c255957b6532", + "version": "2019-04-03T101603.185000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6309ce75", + "indexed": true, + "name": "image_file_203.json", + "s3_etag": "802ddc31415f6844ad5edde301277bab", + "sha1": "46dab9b40a059b07b66c20460d78fb339865cef3", + "sha256": "10e080dccc25d94be0fe7c5965f6e2279f3d60dd418151c16be14893785c4b3c", + "size": 436, + "uuid": "3d532a7b-55e7-4461-afbc-65ef76403384", + "version": "2019-04-03T101600.225000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ecf8ad3f", + "indexed": true, + "name": "image_file_204.json", + "s3_etag": "d1bb8cc02f277b89318e522871cf25b2", + "sha1": "3b5f585065998897b105712dae34566fe88e6ac7", + "sha256": "260fdb27cc3ea57d0bb08c40485463158f3013d01d871089b3c510875a810649", + "size": 436, + "uuid": "bab40245-28bd-49a2-8be0-ba109fe41c91", + "version": "2019-04-03T101603.171000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "09a90cff", + "indexed": true, + "name": "image_file_205.json", + "s3_etag": "14e0ccdb5b77a8414129aa62f61fc78c", + "sha1": "0cb0c0271bd3500212e632500061289b56a3cc9e", + "sha256": "bd4382ac05f05d6808cbb00d20a73511fa28a78236e5a9a6bd1113bda3e128c0", + "size": 436, + "uuid": "9d577bd4-3a27-48be-ad7c-8c44cf803cda", + "version": "2019-04-03T101603.221000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0ab1069a", + "indexed": true, + "name": "image_file_206.json", + "s3_etag": "ebad1a9676f5cd8ddd76b59469365f25", + "sha1": "a02f2712de9609164c787eccccb401a0fc2422b1", + "sha256": "70f034e93920e9e72e3c5160af51973ca06d56313aced23c6d07c9b8af0733b6", + "size": 436, + "uuid": "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", + "version": "2019-04-03T101603.221000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "4f6d7b32", + "indexed": true, + "name": "image_file_207.json", + "s3_etag": "674fa2f644dc280e8874fd77c67b65b0", + "sha1": "6a3ead886a2cecf569e76c38e6e16743a892b430", + "sha256": "6a65d8d223e8f5ddb9b72dbcbb39cdb41f7e334f85c7e80c84166e63265f72a9", + "size": 436, + "uuid": "21a043b6-6dde-41b9-b20e-74b961da8b88", + "version": "2019-04-03T101603.210000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "6fd7c500", + "indexed": true, + "name": "image_file_208.json", + "s3_etag": "fad6c874b12fdf861b2ee1c4bd36bb5a", + "sha1": "972861c7b3c8c6b833ddffc2102c188d0c9e7668", + "sha256": "dfb12987a66cbd856c6122ff9ffabc66b110bd3794447584b2e4e042f0439931", + "size": 436, + "uuid": "11280200-1803-4110-aa84-2808776c2d50", + "version": "2019-04-03T101603.231000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e44d37d5", + "indexed": true, + "name": "image_file_209.json", + "s3_etag": "8b7df9541519a143b24a6efbabe04592", + "sha1": "86e91b50dc2cf55b43fd27c372ddbb5be77f49a2", + "sha256": "143846cd99c35193269dab6470281b9a54f5ba2e40abd20c91f355ccfa1cab0d", + "size": 436, + "uuid": "86df5269-576b-4d18-a0ce-6e2b2a36d51b", + "version": "2019-04-03T101603.201000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "aed7c6c5", + "indexed": true, + "name": "image_file_210.json", + "s3_etag": "1dc957991f3dc47a4292858e839ddc56", + "sha1": "16fa84a5f08af175dd92bb47811a6abd839bfafe", + "sha256": "f27ec531816c73687775c4e23383360b391ebb49ad0c88744bbd223f3b1fd66d", + "size": 436, + "uuid": "e524ff4e-95fa-4561-bfd3-276cba79e664", + "version": "2019-04-03T101603.251000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e11997ed", + "indexed": true, + "name": "image_file_211.json", + "s3_etag": "0b1f1ff61c989b5a5c685d3ccbc60476", + "sha1": "f82c40bd3683f5849104f7f4aae6f72d73661bfd", + "sha256": "7b748dc98d840bfd0a139c9f0de4a1a53f6f692d3f136578d03b78659a4f0320", + "size": 436, + "uuid": "3d5737da-b1ab-48cb-a26f-d420e53edccd", + "version": "2019-04-03T101603.057000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "65ca1c77", + "indexed": true, + "name": "image_file_212.json", + "s3_etag": "99580b225944a0d096deabaf5279c470", + "sha1": "9b33db6b3c9e8fc952933e0b82defa4401c2c71e", + "sha256": "ed1cfc8d52b5c9fa19d2ea0531013c7e9d01f4bf9492687d53925255ea6dada8", + "size": 436, + "uuid": "44cf15ec-3d4e-4698-bb14-107c34891191", + "version": "2019-04-03T101603.206000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5097e346", + "indexed": true, + "name": "image_file_213.json", + "s3_etag": "033e7fb4d352e321525c0514b6532a80", + "sha1": "1976d07dce9994fdb19a7fe110263c2090fdeaa5", + "sha256": "7a684c6ff1f586c22ddcc29274708e8dd39243cef585e7c23b6f3ea3b83e5d36", + "size": 436, + "uuid": "6242cdf3-fd6d-4479-a08a-1747818fd978", + "version": "2019-04-03T101603.054000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "eff8f3f2", + "indexed": true, + "name": "image_file_214.json", + "s3_etag": "8a816b32f72ba899fb407dcac8be12fc", + "sha1": "3dae82c6a46778cc78344fcf46bdc6e00561892a", + "sha256": "ff7884099be508aa2e7dd90e1f1ce1d5067281e4427e3c4a757b71f4f1f75eb2", + "size": 436, + "uuid": "bc60bbd4-8b09-425c-b507-9da24a84f412", + "version": "2019-04-03T101600.270000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a1e3c2c3", + "indexed": true, + "name": "image_file_215.json", + "s3_etag": "f0c377795388b4af6e641f3ba4bd3908", + "sha1": "24403be8640fc36abbc6eed905387655b2b635ec", + "sha256": "2ef2610b443952e5efd36f3d9f3c818fa99d7a3517db805c96328764bd3a42fa", + "size": 436, + "uuid": "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", + "version": "2019-04-03T101603.187000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "0af643cf", + "indexed": true, + "name": "image_file_216.json", + "s3_etag": "8e04eb323bc027d710b7a802932d7f8a", + "sha1": "e26338c1059ec6209839b573757cc5a7b65a265b", + "sha256": "b42e6be60f48d35430fc399eb63b72c42f8f9ab11c079aea8bef9cabb1892167", + "size": 436, + "uuid": "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", + "version": "2019-04-03T101603.267000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "28d5149b", + "indexed": true, + "name": "image_file_217.json", + "s3_etag": "c6c0e3633316132ba255324a87789704", + "sha1": "b4744014f0b1b83ebfd0a755121353902abc7928", + "sha256": "50b685e95463faf94c400143815a574cc4aa9b984488ccd03cee33c755e02cc5", + "size": 436, + "uuid": "5f67c32c-a154-4620-8603-0b64979b04a4", + "version": "2019-04-03T101603.116000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "a6f81947", + "indexed": true, + "name": "image_file_218.json", + "s3_etag": "c492a023e43c8177d018251d68946fba", + "sha1": "0016109014a7e6b8742a0ff4443714f9401d5439", + "sha256": "d6447e02ee2ff36d7d42071b32ee1e814ec64c4335210fe48a1d36e2f29d7eb2", + "size": 436, + "uuid": "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", + "version": "2019-04-03T101600.148000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c1671858", + "indexed": true, + "name": "image_file_219.json", + "s3_etag": "a92c3bb219668bd6fe9ddd387e5fd6a2", + "sha1": "6c57f300b7ad0ac6ccf40cbbd7791bfd25d4a825", + "sha256": "4aa21e087622ab8cbecb91e80202e0fe6eca02bc40114a7229847f6686a366e3", + "size": 436, + "uuid": "dcee6df0-9e87-4935-8873-f8d30d449d76", + "version": "2019-04-03T101603.250000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "142f74af", + "indexed": true, + "name": "image_file_220.json", + "s3_etag": "73f043c5fdf69f67755b00285193fc6a", + "sha1": "51a41a28e7cf05df69ada6c13a55e9ed1880802e", + "sha256": "baa5d34971192d61678bdd15863c1bbcfd3ab80c0b9062b09a9f2308cac4602b", + "size": 436, + "uuid": "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", + "version": "2019-04-03T101603.126000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "1cf00c3f", + "indexed": true, + "name": "image_file_221.json", + "s3_etag": "59b0cbad2c4d14d7f35e0ca97d354e18", + "sha1": "db9399669c6f640f57cd49a33604000cb213fe39", + "sha256": "403dfcc537a0878b1ff87616de9a953e5abd92dff4b01ab36b43f9ce27aa1f85", + "size": 436, + "uuid": "e6d00b0c-3641-4ec4-a553-8fd742193dba", + "version": "2019-04-03T101603.321000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "e549eec8", + "indexed": true, + "name": "image_file_222.json", + "s3_etag": "725ed7a4c652c8ab3ff4fedb778bc727", + "sha1": "69521b67baefb86d6469c97e0310bd964bd776d4", + "sha256": "d60c19c0cff56667cd7db55fd969347184aec7d9e742727e2e1c92d6a8e9af94", + "size": 436, + "uuid": "e5034863-0528-4f55-be95-c8501c29f9fe", + "version": "2019-04-03T101603.187000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "075c3661", + "indexed": true, + "name": "image_file_223.json", + "s3_etag": "425b40a916d858690c908accd215e8da", + "sha1": "9172f676906e65b3bf699df63d8070d1134d7a10", + "sha256": "ef9b0b23c97b0a5845a9d70e823a131e5e13cb2f998ff2443c7b8b7c90eb57c9", + "size": 436, + "uuid": "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", + "version": "2019-04-03T101603.190000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "c44ddd7f", + "indexed": true, + "name": "image_file_224.json", + "s3_etag": "d45b1b18711dd1b99070f27b3af3281b", + "sha1": "459fbb025f924c9ef5e1f422c1ad408ac61624cb", + "sha256": "f31b35f3fd69b056e5a66d50f2e6fbf51ab9be28d420c8bdfe96a7ec013c26ba", + "size": 436, + "uuid": "33d332c9-aefe-4db5-8830-b8daddaed0d2", + "version": "2019-04-03T101603.189000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "ed7d68e3", + "indexed": true, + "name": "image_file_225.json", + "s3_etag": "dbbc913443606f9d8b1c43c590c2d7c3", + "sha1": "af4e4450bc7144799d8f581375e2a3a0dd5761eb", + "sha256": "4feaddde2e62cd14f4a67dec0e6fcba07373c3fa2a3cf3466695d35b1c06b979", + "size": 427, + "uuid": "bb3b6fc7-0902-432d-bad1-6b3f61951314", + "version": "2019-04-03T101551.086000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "58093cc3", + "indexed": true, + "name": "image_file_226.json", + "s3_etag": "c1e51b6c77c9d208626ddf5e7d3951d7", + "sha1": "d30dd623586c97c563fa5f4fd12aa79a706351a4", + "sha256": "31a35a35da5f28cccd7ea6dd5a0e810235bbf3787a80965c7652e591513592ce", + "size": 419, + "uuid": "2b734e88-3a33-4c73-92bb-82e0b8f8c13b", + "version": "2019-04-03T101600.280000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "e6c51cf6", + "indexed": true, + "name": "project_0.json", + "s3_etag": "b6d170f857fa7fd8b13e03079e2f15fb", + "sha1": "ae7695391f2f364c04107af9b529cfbfba92c051", + "sha256": "7ae0b7e40be3a5cbd41ebebce232811ce29360d8407bfad4f9ae553e163a138d", + "size": 756, + "uuid": "ae5237b4-633f-403a-afc6-cb87e6f90db1", + "version": "2019-04-03T101345.439000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "e3ef942b", + "indexed": true, + "name": "imaging_protocol_0.json", + "s3_etag": "3a882352a630779046f9b4bf64e933f0", + "sha1": "db393c6e709a31d7b8192fe94b2024bd4a74711e", + "sha256": "9be854f39a2b314701c87a34d84f0cbf1f43c9af55a6e9eddd7364d7a4ec52e7", + "size": 96127, + "uuid": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8", + "version": "2019-04-03T101345.902000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "1ad2ebc4", + "indexed": true, + "name": "imaging_preparation_protocol_0.json", + "s3_etag": "ea9b7320dbaa133b33485c777be89dc1", + "sha1": "d5f6f071aeaaa7035190ae0a0429c4290d7ce67c", + "sha256": "57c5cb7e10be8475a6ae84669d6779d1943b35e8152a3e39caaeda5f1e412a7d", + "size": 728, + "uuid": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38", + "version": "2019-04-03T101345.426000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "ea6081b8", + "indexed": true, + "name": "collection_protocol_0.json", + "s3_etag": "91d9e560eb9460461b962c9f92770fdd", + "sha1": "be3b0f1d567f4c05c94e729d12393ff809916c67", + "sha256": "e1406be5355ccc4a2b7b083a4b30bd1ab5425e6eec14ebd74d16b336a1effd6b", + "size": 754, + "uuid": "caf94c25-8327-4379-b88e-2a6642cd7513", + "version": "2019-04-03T101345.505000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "571fe4a7", + "indexed": true, + "name": "process_0.json", + "s3_etag": "3145cd2fb4d819d6f269cc3e1c45d828", + "sha1": "64d4fbfb0a9b95a936e56491d2aa10fb3f3848b7", + "sha256": "4ef95348502eb3cc1dac9f871fc6923192e0bf24c794d5ff8173097b60951a4d", + "size": 395, + "uuid": "da265acd-5601-49c5-855e-d792d51b4042", + "version": "2019-04-03T101403.513000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "d871679a", + "indexed": true, + "name": "process_1.json", + "s3_etag": "f19d5dd5447b3c3ae71e7a8c53036810", + "sha1": "2ee999381c4537f4ab99341609278f54274f188f", + "sha256": "980ae82ccc6b879a6730b0196617611bc997446ec6d3153761e4d7a2b814f641", + "size": 389, + "uuid": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", + "version": "2019-04-03T101353.863000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "3f78937c", + "indexed": true, + "name": "process_2.json", + "s3_etag": "6b8172e9d10c70772a48378b6a175440", + "sha1": "c52486236d65aaee58015639115ce13b0a272fca", + "sha256": "c1bc257d37abcb9d1de6cee118cbb211e1dcddeb4c0ce88ef740b425fd873381", + "size": 389, + "uuid": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", + "version": "2019-04-03T101353.834000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "70bbc6b8", + "indexed": true, + "name": "links.json", + "s3_etag": "7385add25e1c482b4d9b4881fb3e196f", + "sha1": "df323c0304644ec6c9cc94694198f568fa43ca86", + "sha256": "3cec4e10f26331a01ccea9741267a9d5a59a00a39b5a67059cd3f18eb3030663", + "size": 14532, + "uuid": "48f0d8a4-fd04-4fee-8301-7441b6efcf48", + "version": "2019-04-03T105534.952135Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "d1fbf93a", + "indexed": false, + "name": "codebook.json", + "s3_etag": "f8b57fb434c840df94b55a56c77450d3", + "sha1": "0af7a2aca946bb2c8680932196ebb9020baa414d", + "sha256": "87ca14c8e7dfe4dcce1ac4d8a14423babdb74763ce13c59a755da3f6719ce8e8", + "size": 832, + "uuid": "34d230e7-dd9f-4a47-8d5b-23043fe43bc0", + "version": "2019-04-03T105535.336469Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "88def662", + "indexed": false, + "name": "experiment.json", + "s3_etag": "f67915ee4d014041844dc020d29e4ddf", + "sha1": "9153498094d2a7c53998168de9211e951bad523a", + "sha256": "82464691f44b4f0cafdcd3e9854a03074432bb36547fcc7184b3810c644d8bcc", + "size": 186, + "uuid": "3db743f3-8235-4553-9a70-37dee987dd64", + "version": "2019-04-03T105535.723353Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ad2281ce", + "indexed": false, + "name": "nuclei-fov_000-Z0-H0-C0.tiff", + "s3_etag": "d2daf199d12d7b04320e4bb052f53986", + "sha1": "82dca7b68d4860c565668be2d6b044476e4095c4", + "sha256": "0589dd5b928af541e1659017e95ba6d9785749a3f4f476d294f0c93df240b121", + "size": 1600269, + "uuid": "13ce8b32-13df-411e-8874-810de85a6d51", + "version": "2019-04-03T105536.220197Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d8b5d806", + "indexed": false, + "name": "nuclei-fov_000-Z1-H0-C0.tiff", + "s3_etag": "67cc6b7a2a8d677c159de350edef6bcc", + "sha1": "ee20d8d4e134e893394a1a03bdc866f397dd6687", + "sha256": "1f5a3012c9ef4a4770308912f8f46607182e3c38a3ab8a3bacb22f292d1694e1", + "size": 1600269, + "uuid": "1eb42fec-c278-43a5-b3a3-b68d998b3a2a", + "version": "2019-04-03T105536.479486Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3b0cdc15", + "indexed": false, + "name": "nuclei-fov_000-Z10-H0-C0.tiff", + "s3_etag": "1753dbb2290e609761ce3f84dd0afc24", + "sha1": "95e12c876c352476ea4edb096ee6dc1796bac431", + "sha256": "23e8f06cae4c966865c79a2191cd5a681ec2ed7b02f20e790b0c229c8d548465", + "size": 1600269, + "uuid": "fe9c7709-3a1c-4548-9578-01e4a63cc9d3", + "version": "2019-04-03T105536.745978Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d1935fb2", + "indexed": false, + "name": "nuclei-fov_000-Z11-H0-C0.tiff", + "s3_etag": "b35770d5b97ec9b27fd308d80061b72e", + "sha1": "7d5e13f9db6b1cce6c416daf66bec1a337d8a4d1", + "sha256": "07977366ff55e8863a6df4924d16d7cf9ae7f94b8cfc638ba004c5817b7ad22b", + "size": 1600269, + "uuid": "508e6ec1-6693-4ffb-aa0c-53940a9b1a30", + "version": "2019-04-03T105537.018211Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "817e676f", + "indexed": false, + "name": "nuclei-fov_000-Z12-H0-C0.tiff", + "s3_etag": "116d31fb34c9fc4690871fabb44148c3", + "sha1": "a49d6792ecb9c0bb71c8529045ea1e3241e08b2b", + "sha256": "d8b766da53f216a594da6ba833c99bd8213bee52058cec0d48647602c97de377", + "size": 1600269, + "uuid": "9d66777d-7af9-4cf2-bcd7-6d4b0cba8fab", + "version": "2019-04-03T105537.249443Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b3be7c25", + "indexed": false, + "name": "nuclei-fov_000-Z13-H0-C0.tiff", + "s3_etag": "6ee57a84a94c6092903e173a2d1a9aca", + "sha1": "fe2a6ea83f6bcc3a1f5da9bcebf375e6f65556ac", + "sha256": "0a4051c4b023501f0c82111379daa4b4763b7428f37ae0e609acfcfdca96dfd1", + "size": 1600269, + "uuid": "50b7b8e6-16fa-4e0c-999a-42cab234b1db", + "version": "2019-04-03T105537.599532Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "acf4da3b", + "indexed": false, + "name": "nuclei-fov_000-Z14-H0-C0.tiff", + "s3_etag": "e4f1a1d854cdc849172788991e2e53af", + "sha1": "f19b5381231a32d27a71777f93042e66cbf7e4ea", + "sha256": "80e1471ea76d4e4ef929130494ca206c1f3e42600936d65cfb4347d5764d1678", + "size": 1600269, + "uuid": "c4be485e-8f30-454c-a641-7d0ff3cafb4a", + "version": "2019-04-03T105537.940591Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "527eec28", + "indexed": false, + "name": "nuclei-fov_000-Z15-H0-C0.tiff", + "s3_etag": "d68135d3e69d3e53f2823c88c443a8cf", + "sha1": "83c3ed3a8fe54080394881357653bd7c0fe179a2", + "sha256": "934dc0c464a532d89bf0d5f29004466a64c648561ffe56945faba7f63bba0679", + "size": 1600269, + "uuid": "23fad5c1-d704-479d-b8cc-a629fee2b340", + "version": "2019-04-03T105538.199379Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "60e20c9b", + "indexed": false, + "name": "nuclei-fov_000-Z16-H0-C0.tiff", + "s3_etag": "7145c8a469f01dcd600febdd94e10591", + "sha1": "27dbacb8100155e78851842f0eee89b5ccd91542", + "sha256": "822a57a48974c1f0fcaf5b0565652876ec1b4265558942222830ab9d246bfe26", + "size": 1600269, + "uuid": "4a9702b6-04e4-409b-a241-42540df7a07f", + "version": "2019-04-03T105538.500545Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c031ab08", + "indexed": false, + "name": "nuclei-fov_000-Z2-H0-C0.tiff", + "s3_etag": "6164a16c6ea593bf5ad7527860c155eb", + "sha1": "c783cb51f109af91225f99ea3114e918f6b0564c", + "sha256": "ab38699d9d1abe447b38225d70490aa0ba7a92cd02bffd4a3a18d8ac1bd13d5f", + "size": 1600269, + "uuid": "bb22c7d2-a22e-4e97-ab75-5bf44d95aa47", + "version": "2019-04-03T105538.750403Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "46b7935c", + "indexed": false, + "name": "nuclei-fov_000-Z3-H0-C0.tiff", + "s3_etag": "8222dac4e29d16a650ad20a1a1a8c5ae", + "sha1": "45b2fbe7405043b09a6e93d3cb2ef7f7c1d8bb6e", + "sha256": "e7ee71cf986302b3466c2c19d0a00403d381ded671bf3a8b631582d35a2177f0", + "size": 1600269, + "uuid": "3047eca0-886e-4989-a220-c35ee497ed62", + "version": "2019-04-03T105538.997194Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6571f990", + "indexed": false, + "name": "nuclei-fov_000-Z4-H0-C0.tiff", + "s3_etag": "4654641a3711f09ab256f7617f558162", + "sha1": "23383caa829a08b3a05cbd76d7a41de87417e0a0", + "sha256": "28a01a55f7889ff47606ac9c785092231908f3418c3821da3be58b03c410d7b3", + "size": 1600269, + "uuid": "86df917c-0969-4e27-8f29-ad2b73837818", + "version": "2019-04-03T105539.261002Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6c5755bd", + "indexed": false, + "name": "nuclei-fov_000-Z5-H0-C0.tiff", + "s3_etag": "4284d4f412a74007207bb3a7592ecec8", + "sha1": "69e9b6ab402527be214cd08732a0d8190948d11b", + "sha256": "d8e7819f4dff7d2ef181c459f3ec538d38fe43a093706772e02c42d2aa28fb0f", + "size": 1600269, + "uuid": "25ce5f57-b9e8-4403-aa8d-6e0d69044683", + "version": "2019-04-03T105539.480189Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2e614198", + "indexed": false, + "name": "nuclei-fov_000-Z6-H0-C0.tiff", + "s3_etag": "0395c6734209a2fb9e4b2b507528555c", + "sha1": "829b3ccaa580580a94675e08c5a42a8f29f8ae25", + "sha256": "240f3bb6f1614280f772073723d721c4e92f379b7e1db3a866884c2ef32d8333", + "size": 1600269, + "uuid": "2f887578-9f16-4dcf-86ad-b8967c32b7a5", + "version": "2019-04-03T105539.720912Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5ce077ba", + "indexed": false, + "name": "nuclei-fov_000-Z7-H0-C0.tiff", + "s3_etag": "8f1f102df1957b494923fc5d170c1d71", + "sha1": "d039df202d60522d38ccdb9a0605472a755e7558", + "sha256": "7632def6e8897eea870cb47f2d1925bbe24ece886696c646dbec63835fe44636", + "size": 1600269, + "uuid": "275513cc-14aa-4ea8-9da8-f47ef8524e37", + "version": "2019-04-03T105539.960131Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "40df3cb1", + "indexed": false, + "name": "nuclei-fov_000-Z8-H0-C0.tiff", + "s3_etag": "bcc7c062ffb6535c2d14b9e25b26786c", + "sha1": "644f28b846c88d16391cbb0cf8ec9ffecc2e5f84", + "sha256": "d1a1c9dfd8422ac2c0dc965ac6ac44ed6c008b4529c4f11c61c54f2245aa1b76", + "size": 1600269, + "uuid": "1f9c2a23-a564-4fd5-9682-7c7d4a68b436", + "version": "2019-04-03T105540.220248Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "95200df1", + "indexed": false, + "name": "nuclei-fov_000-Z9-H0-C0.tiff", + "s3_etag": "d7d0114775507a0500a0f0ba78424d38", + "sha1": "6da2cf3544c519fef20e267b649a5f396eaec045", + "sha256": "43fee434f3dcadd88f911f64b64611f66e56ae4ba428827fded65babfdcf3ebb", + "size": 1600269, + "uuid": "6c37dc76-a843-4009-986e-90f28512e5ef", + "version": "2019-04-03T105540.469870Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "4e149113", + "indexed": false, + "name": "nuclei-fov_000.json", + "s3_etag": "b1c2b59d6f156cd2b0f8d5a660627411", + "sha1": "0256b1daed586807e3aca60f080f68387047ab7f", + "sha256": "648c306a1d4dfb9641f4def7efb3ad3fe299f0c459b83bdd6f88fbc9adc53219", + "size": 4690, + "uuid": "4ed6be97-90ba-4e59-b81f-6432a13ce7da", + "version": "2019-04-03T105540.859515Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "f456645f", + "indexed": false, + "name": "nuclei.json", + "s3_etag": "8c3355f66685fcab73eaf5c7030fa178", + "sha1": "846d7f68755d488e57701c01c1e19ff76398fee2", + "sha256": "fcd7959c7a5df652934f5866aaacb44675bd6bb643d2ce0dbe66139a50048b06", + "size": 112, + "uuid": "d79a3b8e-7031-43a3-9ac3-0f93dbd3228c", + "version": "2019-04-03T105541.199977Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5919ffe8", + "indexed": false, + "name": "primary_image-fov_000-Z0-H0-C0.tiff", + "s3_etag": "a1c6a5e8fa17ebdf33eb0ca5659f1ac2", + "sha1": "1c0256e517b262f98f75ae9473de02275fa88b85", + "sha256": "85c5be8c3b6e4242837162f693f5d1bfce5300a32dc6ff5c30db24f1372e9c25", + "size": 1600269, + "uuid": "4777d5a6-1e0e-4041-8a30-b95a0e98d95c", + "version": "2019-04-03T105541.479157Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "dc899808", + "indexed": false, + "name": "primary_image-fov_000-Z0-H0-C1.tiff", + "s3_etag": "092438df9d1c75434c86b3a44abd3e34", + "sha1": "b815d45333f98a6e415f409f7f1f7646c50d98ae", + "sha256": "48c8b06f40fb077a3afe1089895fbda21ccca2111fe85c39b7b575fd39fa47f2", + "size": 1600269, + "uuid": "6309bae1-2138-4507-8a39-33bb19030090", + "version": "2019-04-03T105541.754003Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ef95e538", + "indexed": false, + "name": "primary_image-fov_000-Z0-H0-C2.tiff", + "s3_etag": "b8d01ac3aeb362bba01f7cebc3970c4e", + "sha1": "599979a65ef48582469bc5d7e16a72645da874d5", + "sha256": "a540dc4a9ccdcfeb2b1ba4061f7735747e776c3b2d1f9bac758d13173a34315f", + "size": 1600269, + "uuid": "30263603-56cd-48da-9694-8b4bacaaf7bc", + "version": "2019-04-03T105542.029318Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "41667304", + "indexed": false, + "name": "primary_image-fov_000-Z0-H0-C3.tiff", + "s3_etag": "ef267373bca39f6c022c1363b4014fa5", + "sha1": "3aa293167e534c86eb86e9603e655e8db1a344fe", + "sha256": "27e04905020b0b33e62f0bee4e1ef338cf24c1114ca58a71af7444d41fe55a9f", + "size": 1600269, + "uuid": "516cc5f6-45ae-4b5a-94ca-bc8a6ece4510", + "version": "2019-04-03T105542.261771Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6de2e7a5", + "indexed": false, + "name": "primary_image-fov_000-Z0-H1-C0.tiff", + "s3_etag": "37e50c5142ba89b0fee52882b441c2a3", + "sha1": "d3e006a7573788c42b24a9d1a7bf58677b1fa3ab", + "sha256": "baad4bcb11c43438f20f8e478666e7ec40ccd74c0b8d37e7119acd7dabb4dab5", + "size": 1600269, + "uuid": "e9a2424f-12b0-4ce8-b61e-29d859a1af3c", + "version": "2019-04-03T105542.605503Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b94c15e4", + "indexed": false, + "name": "primary_image-fov_000-Z0-H1-C1.tiff", + "s3_etag": "a14109d34d7467c1f367c36df26e3488", + "sha1": "d9883b3112b42265aaaf02f00b34de45b010dda5", + "sha256": "13232371857789fbb26be5f783f2df61e65064dad45d495e4c7c5eaf89f4a1ee", + "size": 1600269, + "uuid": "80269cb6-3de5-4818-97b2-fb3748d8facd", + "version": "2019-04-03T105543.080155Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "57641644", + "indexed": false, + "name": "primary_image-fov_000-Z0-H1-C2.tiff", + "s3_etag": "a843d6e5142dabe4d2ee18737fced212", + "sha1": "be5e106fa634516f0987016c58e99c43b5abf74e", + "sha256": "6033c84accb8aeaa13c1d120e18f3250961eefd15501628893fe80eb60861c82", + "size": 1600269, + "uuid": "06862bf0-7add-4177-9d3f-d95aec58c436", + "version": "2019-04-03T105543.440368Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2ef0631d", + "indexed": false, + "name": "primary_image-fov_000-Z0-H1-C3.tiff", + "s3_etag": "8dc65ccb1a30f1196a2619c75c001a6a", + "sha1": "52b27d8337b17bee034add31aa9f320331172719", + "sha256": "c8e712cb8d7c982fc222f4ebcda04a2f75f4dbc9808f77e71ee296ec8b900b47", + "size": 1600269, + "uuid": "9e9be46c-708f-4931-ad11-4fed782e3949", + "version": "2019-04-03T105543.739247Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "e84829d0", + "indexed": false, + "name": "primary_image-fov_000-Z0-H2-C0.tiff", + "s3_etag": "41ed5a93744a943d8fe70f2f3f17b96a", + "sha1": "cab05b18334080557b77701ab0550482feb7c2d1", + "sha256": "5abe3360206c21d661aeeee347e1e9bf3a65218798986c50b52328bd5c218845", + "size": 1600269, + "uuid": "6bfdc846-e6f8-4786-ac75-9fb7ac241778", + "version": "2019-04-03T105544.019854Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "0ad5372d", + "indexed": false, + "name": "primary_image-fov_000-Z0-H2-C1.tiff", + "s3_etag": "9aea02b0c75eb4e67c9f9fc43d5d3491", + "sha1": "272b6b0db0808768ca0719295bfc2fb296acf011", + "sha256": "f1d06980228acb649ce21b0ef38736ec78d04c4cbd07117f7d2c798633271cab", + "size": 1600269, + "uuid": "8d3f44f7-00a0-4fab-adec-401781b783e5", + "version": "2019-04-03T105544.392532Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8f903d20", + "indexed": false, + "name": "primary_image-fov_000-Z0-H2-C2.tiff", + "s3_etag": "6e8f2af5b0a2d3fc5025595ef1b2c2ed", + "sha1": "23489e202e34cabd7d9d61c46cfb451cdbfaaa2b", + "sha256": "a9200607a382651d0a0f8c74fe30b2c470f3004a6e3ccb7aa80394e905a89e17", + "size": 1600269, + "uuid": "b102d32f-1140-4ede-8813-8ed053f350df", + "version": "2019-04-03T105544.670961Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f419bc60", + "indexed": false, + "name": "primary_image-fov_000-Z0-H2-C3.tiff", + "s3_etag": "81d22aa6eada5862f67fc2f6aea4b90a", + "sha1": "fe091ab324b0c644d1c29bde67fd4f7e5cd84132", + "sha256": "c9d2705aa363a24172108e1951134e8272d251ca1e3c82c9aef40e90f059c75e", + "size": 1600269, + "uuid": "e4ba18e1-b072-41cd-a091-32b51b5078f4", + "version": "2019-04-03T105544.961246Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "0686a5ad", + "indexed": false, + "name": "primary_image-fov_000-Z1-H0-C0.tiff", + "s3_etag": "3c2fc50883f92b0b76e252ff12acaa52", + "sha1": "e041d31c5ca58e22c8fc16c2e4b79724517c9374", + "sha256": "c8ebf8c62c728145e8802ba9cf396ae5f5706ca1ca33602d2ea2287ad9df4988", + "size": 1600269, + "uuid": "c296fb80-3fb8-476b-b8ff-eae9e8c75388", + "version": "2019-04-03T105545.187187Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "68f4056c", + "indexed": false, + "name": "primary_image-fov_000-Z1-H0-C1.tiff", + "s3_etag": "aa85587e50c61f3c880f811af83589b3", + "sha1": "be1b220b93033b9f9cfffedb624017b5cfa0ee66", + "sha256": "2eb6cb0132ea1571b590522a167bd60479c7bf52cd671b0763df3178e87853e3", + "size": 1600269, + "uuid": "399445e5-b4f6-4f3e-8b65-bfc76f0e078c", + "version": "2019-04-03T105545.522173Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "533d7018", + "indexed": false, + "name": "primary_image-fov_000-Z1-H0-C2.tiff", + "s3_etag": "fac114b1689dd0fca29af6d3636fbdde", + "sha1": "ba56f9680075f5677ed7294406fe53b5553207f3", + "sha256": "ea883a274715c627c3a2615a1340c22d88f8c5417de3106a9aa666f0c02b851c", + "size": 1600269, + "uuid": "fbefb123-cf54-4eeb-9ec2-d826e44ad953", + "version": "2019-04-03T105545.766611Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c69cd6f6", + "indexed": false, + "name": "primary_image-fov_000-Z1-H0-C3.tiff", + "s3_etag": "816a7f3754cb7c2932ac7e0ccd3b72ba", + "sha1": "81551338a2440f0189af43a590750fdcd999c47f", + "sha256": "7c1d52008fd944b34aa86fd0a5d56a2c0d0360bd6c7939fcc86a5ca28312c024", + "size": 1600269, + "uuid": "8bf3db8e-e9cf-40e8-916b-b1e24449d79d", + "version": "2019-04-03T105546.280407Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4ee7d925", + "indexed": false, + "name": "primary_image-fov_000-Z1-H1-C0.tiff", + "s3_etag": "dea6ad5eef4899e73f04c8f4690d40b6", + "sha1": "5013191d6a7ab184c73a492f80075e994a1a4fd9", + "sha256": "37665c56980c1c395bcf89548565b40d44bd1a6e84bc31ba101d2e83818fe89e", + "size": 1600269, + "uuid": "2207ffb3-4f5a-47ba-99c1-b7d81b56168b", + "version": "2019-04-03T105547.016718Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a8a836cb", + "indexed": false, + "name": "primary_image-fov_000-Z1-H1-C1.tiff", + "s3_etag": "5e0e4bc2b50cc746ff593818d3eec6b4", + "sha1": "555c67dadbbfd481b3137d4a4a5ff6cfde52edf6", + "sha256": "5eebc95b1f0daa116d73359a0c653759910a84e2a086239105fd31cc2c463d6e", + "size": 1600269, + "uuid": "6b04d393-7852-48b4-ae14-8cfa4543c5ca", + "version": "2019-04-03T105547.282294Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1debd71b", + "indexed": false, + "name": "primary_image-fov_000-Z1-H1-C2.tiff", + "s3_etag": "068c894051c2c8b83133fdb7098a10be", + "sha1": "ced49b3e129ebb7516e2719ed98c90b9176065e5", + "sha256": "ab3b43d91b8106b24f550afb6b04e4ff06c29703b8b7c03b62b5ded3e3562bcf", + "size": 1600269, + "uuid": "d2859680-0fe8-400a-be0e-e04a3d832d1f", + "version": "2019-04-03T105547.626243Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "170b0997", + "indexed": false, + "name": "primary_image-fov_000-Z1-H1-C3.tiff", + "s3_etag": "d4bf941909636e00f4e65df0f937c3cb", + "sha1": "f368d9c51c85353f576504ce351dbe5f7c9abc20", + "sha256": "51a22aa82eda457911b822c3a67a6c3d2169c54b7204b66711ff6113d45114e6", + "size": 1600269, + "uuid": "467e4b98-519f-430b-8c59-57270f0e1259", + "version": "2019-04-03T105547.939813Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7fa1a6ac", + "indexed": false, + "name": "primary_image-fov_000-Z1-H2-C0.tiff", + "s3_etag": "fb985f9815313f8178cc81bba8e6899a", + "sha1": "44d97a67583454e7b540bf23634b635ec77273e6", + "sha256": "2783f3179b06e80ae1b5a0f45c40afeae45b8da41930d0c1e3e050d7e9698344", + "size": 1600269, + "uuid": "f7f95a37-370c-459f-bf84-19691fb195a5", + "version": "2019-04-03T105548.236748Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c57cc4b9", + "indexed": false, + "name": "primary_image-fov_000-Z1-H2-C1.tiff", + "s3_etag": "bfb6be8b742f97e57548a08c2f520360", + "sha1": "2de2a3814a9dbc094c76fadcad41a234fc6bc51b", + "sha256": "9055d0b3f83ba41e98c9105cb806e216b0d14a24f50c88489fa06e207f046f3c", + "size": 1600269, + "uuid": "dbf2dbfb-2470-40db-96c8-eab439922ceb", + "version": "2019-04-03T105548.520165Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5b3ff3f3", + "indexed": false, + "name": "primary_image-fov_000-Z1-H2-C2.tiff", + "s3_etag": "51231d0f2eaf546c0530395a18067409", + "sha1": "e111abd73a379d0adb85398ed96e8b21c7e8a023", + "sha256": "5e4028907526a099ee4b685a15a583e000c0164c14ecfcd41118b48cc3c05bc4", + "size": 1600269, + "uuid": "cbb74511-25d3-431a-83e5-96d8746b7b13", + "version": "2019-04-03T105548.859536Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "316b67c4", + "indexed": false, + "name": "primary_image-fov_000-Z1-H2-C3.tiff", + "s3_etag": "d99c136ee57c7e24b55ce51a10a849eb", + "sha1": "ee5b76ef47b16398d5ee3d4e1c3125f32ceabffc", + "sha256": "c72b7a15560b7ab0419e223ad09ded3e3f182263c0c7ae4a6596246e8960b1c0", + "size": 1600269, + "uuid": "8feb1eb5-aae7-49f3-8a50-ca08fc6cd9ae", + "version": "2019-04-03T105549.143186Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8776fda9", + "indexed": false, + "name": "primary_image-fov_000-Z10-H0-C0.tiff", + "s3_etag": "53114fb78c0083e71676e1f5df07c223", + "sha1": "5d9ca067634e35d3c6d2d9c42343551c600757cf", + "sha256": "148e60401f58fffa7ec7e17ef68b45e712114e52d1e33a79b849773f3a5cd5b3", + "size": 1600269, + "uuid": "c24714bc-d736-44b9-80f7-226178093cb0", + "version": "2019-04-03T105549.500027Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a7bafd39", + "indexed": false, + "name": "primary_image-fov_000-Z10-H0-C1.tiff", + "s3_etag": "609844220fd3b593ee0caccac529202c", + "sha1": "9a6a05000bf0851e9469c5a582d04bf716cbe7f1", + "sha256": "1abb6241a8357ff244d86c8352bd1e713ef343fbf15dec7157ac533152d92a0d", + "size": 1600269, + "uuid": "f2f917fb-0729-43a9-8b91-badc7768e23c", + "version": "2019-04-03T105549.865712Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "23d93904", + "indexed": false, + "name": "primary_image-fov_000-Z10-H0-C2.tiff", + "s3_etag": "4dd7610181826f6adf9c563c901e0fca", + "sha1": "dfc98d2e436aef7982fa4241d774aeb6b9aa0ff1", + "sha256": "499483d49cd71506c7095f30a39c64a556ce63902cdbf375b613c495de56e733", + "size": 1600269, + "uuid": "3b548656-b0e1-4fd0-8ed8-0002a5a618ba", + "version": "2019-04-03T105550.106030Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1439edf9", + "indexed": false, + "name": "primary_image-fov_000-Z10-H0-C3.tiff", + "s3_etag": "629e25a7c5a804cda8c849843844076c", + "sha1": "be5ce9eb8bd863dd596a98f4150ab661e01147d4", + "sha256": "d2d0f8b5f1ae031f26adb3a579be5cf845b0c0a0468fe0f0f71ecfb8d3db7e28", + "size": 1600269, + "uuid": "07db36b4-87d4-4fa1-8a85-b85701d5a9f8", + "version": "2019-04-03T105550.478983Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "23dfcc29", + "indexed": false, + "name": "primary_image-fov_000-Z10-H1-C0.tiff", + "s3_etag": "f4a1a90d44cff0e07b1b2d7b9aefcf8c", + "sha1": "2b3ded69a6c35ed47e325fe661482929f4dc4cb4", + "sha256": "4e13cfd76ea5e4b52c9316fbbd563e5bbd9673a708c71bbbfb45b789c6759cd0", + "size": 1600269, + "uuid": "49ada68a-c5b7-4e03-9449-3684e06db4fd", + "version": "2019-04-03T105550.739481Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b8797e65", + "indexed": false, + "name": "primary_image-fov_000-Z10-H1-C1.tiff", + "s3_etag": "98a99be632b58130697636723e4bc732", + "sha1": "638bb19206f156858aebb94110483a0dedcd79ce", + "sha256": "e6bd3d5c56ed7b408a4096a224efd0f09a861674f14991f3c1fcee26aea63d5a", + "size": 1600269, + "uuid": "dc2076bd-19ec-47c7-8ac9-6c6503386cd6", + "version": "2019-04-03T105551.111778Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "387caf6a", + "indexed": false, + "name": "primary_image-fov_000-Z10-H1-C2.tiff", + "s3_etag": "bf79470aa23df7680bc3dab20bc9fdeb", + "sha1": "30b2559ccffd430ab301d0181b7a016fa68a8b39", + "sha256": "28a08c2edb7044af26e5732fe991643c1fb97851d35ad18658b6ff75e9a9e2e7", + "size": 1600269, + "uuid": "2f5d576a-9e48-4f98-b19b-11e0bbd86615", + "version": "2019-04-03T105551.335466Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "94de8736", + "indexed": false, + "name": "primary_image-fov_000-Z10-H1-C3.tiff", + "s3_etag": "c4406f061e2d8b568d72b2d8bba598ee", + "sha1": "cfc78b40a3a786933d7e46b3808cb4fadd1b275b", + "sha256": "621cd72144807a88513d47937d763ac4b665ae144f364f4c69ed0ab6802c9985", + "size": 1600269, + "uuid": "56a4a357-0c62-4058-9362-1ae9b928a38c", + "version": "2019-04-03T105551.680479Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ef84dc08", + "indexed": false, + "name": "primary_image-fov_000-Z10-H2-C0.tiff", + "s3_etag": "4fa41de358086361a329422e9eb9c045", + "sha1": "f50094df26c7aabc9a83d46b85fa59badc5586cb", + "sha256": "e54c2e4b5a5d10ae3be6b91d08415b3fe463c3ccd9f86f7ebf9b2bf9617ffbdc", + "size": 1600269, + "uuid": "ab9c2448-9e9c-4847-ab2a-7e65333c7795", + "version": "2019-04-03T105552.080625Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f901ef1b", + "indexed": false, + "name": "primary_image-fov_000-Z10-H2-C1.tiff", + "s3_etag": "28eb33b0ea77042d1e5467e78ba4a9ee", + "sha1": "162fc33e51482e60820e4c51c5705e10c7cccaa2", + "sha256": "02324cb2dc6975d11959c1694c534654ef48aeae1086128362bd554c92bd4a25", + "size": 1600269, + "uuid": "5b961510-975a-44ee-82c4-47fb7a1ef69f", + "version": "2019-04-03T105552.339328Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a7975ec3", + "indexed": false, + "name": "primary_image-fov_000-Z10-H2-C2.tiff", + "s3_etag": "1f322edc3014aa0637924a3fcf4c7c14", + "sha1": "c7f8bd8e320ae18fc3443dd06e596d2d1468c8c4", + "sha256": "c48167caf74695965ea023cdb713253ea866d0970eb40c0fe23df266c7226917", + "size": 1600269, + "uuid": "db9d6d77-a51f-49ce-946f-21038694b549", + "version": "2019-04-03T105552.640285Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3c89e00e", + "indexed": false, + "name": "primary_image-fov_000-Z10-H2-C3.tiff", + "s3_etag": "16ca9c5b30cf10887d69732d835cef73", + "sha1": "d697fdf4b12a4e4f1f562f90b9347a3a6597d34b", + "sha256": "5a8338ac1fda0c1554f616d4501369f07f7de1d0ea4e3e17ab682e314dfcde98", + "size": 1600269, + "uuid": "5146d165-1eee-48ad-8327-174d1817dfac", + "version": "2019-04-03T105552.942022Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c5ceab43", + "indexed": false, + "name": "primary_image-fov_000-Z11-H0-C0.tiff", + "s3_etag": "6ceae755ed9aeaebb963364ec7a90d1b", + "sha1": "fa929971df1181934df9282fc6f1db41e8f79d88", + "sha256": "6dfdab9d07ef4c282a65d2e6f0f6b0b3f65993ad10100c7c4e92c1f6b5c8bc3f", + "size": 1600269, + "uuid": "78dc3350-0cb6-4731-b0fb-fa0088f7dac7", + "version": "2019-04-03T105553.200291Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2e42a5e7", + "indexed": false, + "name": "primary_image-fov_000-Z11-H0-C1.tiff", + "s3_etag": "06ed8b773024d7146d717791f414ff10", + "sha1": "e5926a496daa980fd009cf259c1d09d60ef88af8", + "sha256": "755a673f5eac78d48792f777ab04e352814e75596625a9331b9e5af7c199d7a3", + "size": 1600269, + "uuid": "213981ed-c5de-40d6-8d09-ef4354fed57a", + "version": "2019-04-03T105553.480733Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4e0d8d92", + "indexed": false, + "name": "primary_image-fov_000-Z11-H0-C2.tiff", + "s3_etag": "11563e56e169852a5c3a993b476de480", + "sha1": "7e4ab718e0abd53edaa1db559eea3a63784e6e8c", + "sha256": "840268313bf93809cf0f6d546a4d24152fe1514a472d4c2715df3904e397f835", + "size": 1600269, + "uuid": "4f19bb8b-95d6-4dfd-8c58-6bf557cf7e8e", + "version": "2019-04-03T105553.790586Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ae3e068c", + "indexed": false, + "name": "primary_image-fov_000-Z11-H0-C3.tiff", + "s3_etag": "a9a16146242832c0defa79e41ae59204", + "sha1": "d6370db80b250ed05858f6eaff1e1b4b95006cca", + "sha256": "b6500f6c5ece4770f0299a3145253b99a012eeba9c451e68e1a887b8f454c2da", + "size": 1600269, + "uuid": "b735a8fe-4d8b-43dc-856b-5376aaf8e7f2", + "version": "2019-04-03T105554.038843Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "27ad1cac", + "indexed": false, + "name": "primary_image-fov_000-Z11-H1-C0.tiff", + "s3_etag": "bfc0e583fb4ddbf764b5cbe65aab35b7", + "sha1": "5d833a37af8766382fabd4337b7e8ccbcad60815", + "sha256": "d1ec35fd392cf3d718332fa54250ecf8efd284f3120a1c8d60074e15b84f5377", + "size": 1600269, + "uuid": "6465a79b-714e-4286-835c-f510fcc744e8", + "version": "2019-04-03T105554.264803Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "73c913f4", + "indexed": false, + "name": "primary_image-fov_000-Z11-H1-C1.tiff", + "s3_etag": "bee5e534a6183e9308bdeb31977a213b", + "sha1": "49eb9d3550635011759d0f5c18ca341bf72a20b6", + "sha256": "3f952c140d5afa90976992b1a5c729b4603648bd12d19e601cdc91427d0cb49b", + "size": 1600269, + "uuid": "9a77ba3d-6773-4e07-ac91-61f0b9203183", + "version": "2019-04-03T105554.539793Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c026823a", + "indexed": false, + "name": "primary_image-fov_000-Z11-H1-C2.tiff", + "s3_etag": "89cee9ee67610a67152ecf11612fea08", + "sha1": "b5e4908efff59dcd7ad788bfaca249425f528af8", + "sha256": "ac1ffe203eb3ec5c71c7b75ed3fd052a99d8d1161f7ace904b6860ad7c82b129", + "size": 1600269, + "uuid": "fc091e1c-afc8-46e4-b9d3-68341242512a", + "version": "2019-04-03T105554.778615Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "44c7966c", + "indexed": false, + "name": "primary_image-fov_000-Z11-H1-C3.tiff", + "s3_etag": "0c1fb1c4fb4c8e371fae1aae894c0135", + "sha1": "a2a83424533f08979828792bb6fd54836a7a7b21", + "sha256": "8c06e4f22cbd47302f82585d2134b1230c4062e03215a7d83b801bbb72900e6d", + "size": 1600269, + "uuid": "e4021199-842a-489e-a65b-fc3160446904", + "version": "2019-04-03T105555.379342Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d7b7bf7a", + "indexed": false, + "name": "primary_image-fov_000-Z11-H2-C0.tiff", + "s3_etag": "d5e9649396c9c7f1f98f0672dcee3864", + "sha1": "b6ce1d39b6b2399b96af8eeb8bab755586acb152", + "sha256": "fdb06d5ef69715919d7ea4bdeeda0c7a81b838a0ef28268a87bf6abe4af8c898", + "size": 1600269, + "uuid": "1aa253f9-b137-4fd9-b65f-c307420bcfc4", + "version": "2019-04-03T105555.600718Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "88ae4d73", + "indexed": false, + "name": "primary_image-fov_000-Z11-H2-C1.tiff", + "s3_etag": "dd2287f120520149e017c264e72f3de6", + "sha1": "887e3e928d8afcdfda17e64a56f6bebef141d2e8", + "sha256": "30f20720e23acf0caff1ff1bdbe582de254d3a8ab93188a44b63d5cdd597fc28", + "size": 1600269, + "uuid": "22be2eb0-32f3-4b49-884a-e2d28c01706d", + "version": "2019-04-03T105555.855632Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4ae105be", + "indexed": false, + "name": "primary_image-fov_000-Z11-H2-C2.tiff", + "s3_etag": "72c1259fa055687565fc81b8cfa196e5", + "sha1": "342a81768acd7d32ba4b7f92f3ca11e7f17e0691", + "sha256": "8c1bb26f1be6c9196ef0e074a968bfee34806079e57474577fd3ba8947a07173", + "size": 1600269, + "uuid": "c99e944a-475c-4df4-9e6d-9ea50057cfb6", + "version": "2019-04-03T105556.233992Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ac587eaa", + "indexed": false, + "name": "primary_image-fov_000-Z11-H2-C3.tiff", + "s3_etag": "18fe5ebd9f1da1734d7e233b29b4f39e", + "sha1": "1db0756bba2080c9e1a91bbb6abc7b7fda196869", + "sha256": "30b35d9ebce19e936ca156ccc1669700a28819a57082b28b9390e863c21b9f6f", + "size": 1600269, + "uuid": "2a5f4fda-058f-4478-94dc-c12130be8969", + "version": "2019-04-03T105556.579317Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d02a9c3c", + "indexed": false, + "name": "primary_image-fov_000-Z12-H0-C0.tiff", + "s3_etag": "887f41fc2ff12774fef02765785202d1", + "sha1": "490d14a6d94736b991639b06b5a5690e68f03488", + "sha256": "616f5e816d18b75695af9ae3ca6bf250730ebaf7de10b43be96cdbb96d9c54c6", + "size": 1600269, + "uuid": "cca66a40-ea4e-4d2e-a9a5-084a9dd6241a", + "version": "2019-04-03T105556.968010Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "9b9bae44", + "indexed": false, + "name": "primary_image-fov_000-Z12-H0-C1.tiff", + "s3_etag": "b4adeb99c5cc807251a7c41114cb2ffe", + "sha1": "d804db3cc63cd09b7ede0a4706b4abd2b2d633e5", + "sha256": "add26fb8561728ddcc1da5b8019bf30c34a1a4724680eb8f4f297867123b6054", + "size": 1600269, + "uuid": "ab43f67c-1352-4344-9ab2-164ec39d5b23", + "version": "2019-04-03T105557.260494Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1aecea4a", + "indexed": false, + "name": "primary_image-fov_000-Z12-H0-C2.tiff", + "s3_etag": "789c4f2bf1ef3b375f0804110a733d7a", + "sha1": "749897eaf2fc13f1a61b2277d91173c3ac04bc18", + "sha256": "400a32e254cc7e8ff63c0f7ecbb06f46046180447674d1192404dab8d37a1202", + "size": 1600269, + "uuid": "78046a68-90a9-4761-85fe-bb8f1059a75e", + "version": "2019-04-03T105557.518156Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3b5afbfa", + "indexed": false, + "name": "primary_image-fov_000-Z12-H0-C3.tiff", + "s3_etag": "5a4deb28c50b741404bdbf9b482731b6", + "sha1": "d13f3bbade8b67796a019f3163b697a4de1f9f6f", + "sha256": "7bfd376a2be4d88c67c8d175c52423ea1391402a062b7a0392b0dc2dbfccfdb6", + "size": 1600269, + "uuid": "fbb1d9de-baca-44fd-82b4-1b5f9b76e126", + "version": "2019-04-03T105557.760815Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "16ce63ca", + "indexed": false, + "name": "primary_image-fov_000-Z12-H1-C0.tiff", + "s3_etag": "f4f92e4d0fe49222df6715b1eacfc860", + "sha1": "89495f8ee49f756930b7f9699716d720eff0250e", + "sha256": "2202bb6788f971004969c17f5d5013579ac627048d6bd25ad7c63e671e3687f2", + "size": 1600269, + "uuid": "d33aac64-f261-46d0-8712-543ccdc219c0", + "version": "2019-04-03T105558.079130Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8ee8eacd", + "indexed": false, + "name": "primary_image-fov_000-Z12-H1-C1.tiff", + "s3_etag": "b3986a3a15c69644873dd204270a63d2", + "sha1": "384ee670a45003c385d732abb08ffe4b5054b2b3", + "sha256": "3e99efc1c84bdf4f3022a35b02d6a310924388f5a64d245322abbb39179bac14", + "size": 1600269, + "uuid": "ea165ff1-76d8-4fc4-b5b1-46e13a92d61a", + "version": "2019-04-03T105558.419178Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b653f9f2", + "indexed": false, + "name": "primary_image-fov_000-Z12-H1-C2.tiff", + "s3_etag": "d9d98464887e0fd0e375a7ce2035fde6", + "sha1": "2f9ed661847addb7a1e508f7a64551d56e71055b", + "sha256": "91d3a98042a86c79996b0cf5713812607de53519f3b9c7227fcb5667fba95831", + "size": 1600269, + "uuid": "fbfd8b5e-6818-4204-8a1d-af17f654c63e", + "version": "2019-04-03T105558.880203Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5d2ad397", + "indexed": false, + "name": "primary_image-fov_000-Z12-H1-C3.tiff", + "s3_etag": "ead473980cdf361a40efde6487b5812e", + "sha1": "ee103d84ace151c7dfe68e579546b4445ecd0c89", + "sha256": "9ac81cb46bb7244b76dbec83afa406653bc80e5f50e8cec14bcf52da96f53a46", + "size": 1600269, + "uuid": "88045284-69d1-49a5-951a-ce861ed0dbee", + "version": "2019-04-03T105559.179305Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1b57836e", + "indexed": false, + "name": "primary_image-fov_000-Z12-H2-C0.tiff", + "s3_etag": "dc98cbd9f2ed861f4839edee92c741ac", + "sha1": "ee94e5cf8c841bba7be2a55582d83bf336b25b2e", + "sha256": "b0559f19893372f5d1e2eb022c8de33afab9460c5bfdc3fa43a1d132a553080c", + "size": 1600269, + "uuid": "29982631-185e-43c5-ae8c-daeba6e26c2b", + "version": "2019-04-03T105559.659913Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ab93140f", + "indexed": false, + "name": "primary_image-fov_000-Z12-H2-C1.tiff", + "s3_etag": "27f70fe14e7e3b07edd0dbf20bc14d9e", + "sha1": "ea798bb2f189c427a46b4d80219fc6d16e7e2818", + "sha256": "d18bcb7369e1a4c3fba02e006c593aeb12d3baf16115db0d5324404ee403db77", + "size": 1600269, + "uuid": "083944c0-37af-4c9c-80e1-2c101b95acc3", + "version": "2019-04-03T105559.998865Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "402e893b", + "indexed": false, + "name": "primary_image-fov_000-Z12-H2-C2.tiff", + "s3_etag": "05a62cd5712c3eeba56bfe96f267bb9a", + "sha1": "497da012af65c6fcaf0be9986227d77d45b94e80", + "sha256": "f19fd7d959fb5c7a48fe8cd776a0e4d7706bde6f11d8fec837ced211b64eca29", + "size": 1600269, + "uuid": "40cbb7e6-b5f1-48ad-825a-5159197c6803", + "version": "2019-04-03T105600.308174Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f843bf4e", + "indexed": false, + "name": "primary_image-fov_000-Z12-H2-C3.tiff", + "s3_etag": "a3ced1c2e181c3ae3b6c0175d034d4f5", + "sha1": "ac3087f9eb2e5a42b61bef858f5ff15cf7bdc36f", + "sha256": "88bd33e3488dffad8404a0dc27afaef8dbe5bada2d88ad5a59ddf43c3e8c0597", + "size": 1600269, + "uuid": "ebe33ee1-8e0b-4412-abb1-b26c5ead07e1", + "version": "2019-04-03T105600.586805Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "052f06bf", + "indexed": false, + "name": "primary_image-fov_000-Z13-H0-C0.tiff", + "s3_etag": "bcc9167532fe6d4332a6042181df7d1a", + "sha1": "d66ea4b0cb0b34be2de8e9e5a12926f49145dff3", + "sha256": "2b078043f0c405d3cb989c43456e5b7ac835f416bb620ea3c85e16c8962b3433", + "size": 1600269, + "uuid": "a94e0444-861c-418a-a338-16ed56e9b430", + "version": "2019-04-03T105600.867025Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d6ebd4ee", + "indexed": false, + "name": "primary_image-fov_000-Z13-H0-C1.tiff", + "s3_etag": "34c1ff12c674255cd44d44d5e7201890", + "sha1": "190094d40dfa2f357d761866860d24d687a8158d", + "sha256": "871f6921cdd3d12ec7b1670a59eb2c8e123a376e391e59f434efce751661da40", + "size": 1600269, + "uuid": "2e39b6d1-7755-4265-a044-f74cac9943a1", + "version": "2019-04-03T105601.179469Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "584d986e", + "indexed": false, + "name": "primary_image-fov_000-Z13-H0-C2.tiff", + "s3_etag": "2dfbbfab11c2528ce2f4beafdfdbe1be", + "sha1": "6403da61835d4362a70a2e5dfbd112984cd22d81", + "sha256": "dd7b8ec3c8a18855a787d282efaffe9b9c5927d29046b194bb405586fc0f4a6b", + "size": 1600269, + "uuid": "fcab0b60-14e5-441a-b5ab-492576785bfb", + "version": "2019-04-03T105601.420192Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a9ee4bc6", + "indexed": false, + "name": "primary_image-fov_000-Z13-H0-C3.tiff", + "s3_etag": "b36579dc19eb793dab6d74b099b3c094", + "sha1": "bdf15acace826820eb39fab732fc21b1c9b71ba5", + "sha256": "7c822e36225c6ae1ae17eeae2c3d8d036386e57b7c4a096e2f5412af9441a227", + "size": 1600269, + "uuid": "45caa165-0ccb-424e-a454-da6ee8c3debb", + "version": "2019-04-03T105601.721498Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6ff498a1", + "indexed": false, + "name": "primary_image-fov_000-Z13-H1-C0.tiff", + "s3_etag": "263ae72ab8c5b07cdb67115ead4b0581", + "sha1": "0b1851977e68f57322a9b9b610e28ad2a9ca59c2", + "sha256": "e2160976c70adaa0cbbe30ad556550978fb8e179c5c2c01d43e51eaf392fd8ec", + "size": 1600269, + "uuid": "cd27dad7-cd62-442b-ac93-1a492df1045e", + "version": "2019-04-03T105602.039781Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d3808e49", + "indexed": false, + "name": "primary_image-fov_000-Z13-H1-C1.tiff", + "s3_etag": "9825ecfc61e68ca25e40bef25e59ccfa", + "sha1": "ff0a443f513db573f55cc98e5ee1a37296bfae97", + "sha256": "bef348b002b6d232a391fb0d3f9c31506dbb24eaca6a82ea255e8e362affc71a", + "size": 1600269, + "uuid": "60dd0c9f-00a5-4d05-9e03-d3d9ed094144", + "version": "2019-04-03T105602.303691Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "559258c8", + "indexed": false, + "name": "primary_image-fov_000-Z13-H1-C2.tiff", + "s3_etag": "f36dfa34f3494ced8619bcf41f50b609", + "sha1": "8b42c0a67ebb80242e695de36af2704240a43541", + "sha256": "d122a74a78ee74b8ec52ad8c0e8c91a0da215f9ccaa8997d97ac19312792f3ec", + "size": 1600269, + "uuid": "c6feee87-37de-465d-b860-b9bd70da69c9", + "version": "2019-04-03T105602.620006Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7da89022", + "indexed": false, + "name": "primary_image-fov_000-Z13-H1-C3.tiff", + "s3_etag": "b8911343150f670d61645fc8a8d33ae5", + "sha1": "5bd3d9288289f0c69a6d4f56d3361d3743b423f2", + "sha256": "2170b2d5225a5c06b8e6a0d4c7baf98fedc829c55cf39384836319dde5cfd27b", + "size": 1600269, + "uuid": "bf2d918b-0a45-4f42-83b5-e38dd2c77084", + "version": "2019-04-03T105602.924316Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7855861f", + "indexed": false, + "name": "primary_image-fov_000-Z13-H2-C0.tiff", + "s3_etag": "adee3752465a14bac55600bb2ba15d49", + "sha1": "6ec29fd007cae668ee61a9fb88415817247f59c5", + "sha256": "8c8299f5933f6546bbca375bdd0258ccf642bae8cbed6cbad569037a21477389", + "size": 1600269, + "uuid": "31896233-7b29-42a4-94b0-208095c99f5f", + "version": "2019-04-03T105603.161708Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "aa188246", + "indexed": false, + "name": "primary_image-fov_000-Z13-H2-C1.tiff", + "s3_etag": "8a7c1094a104a9a7cc40ed6178fcb752", + "sha1": "0035dc38e3f4276b3442a308d0d7418a6eb24614", + "sha256": "cf7f002f384c6f5491b164dd7a571d9c768be9bf3e019401015b6dc69b957696", + "size": 1600269, + "uuid": "55001751-e224-4825-87c4-bd786345faef", + "version": "2019-04-03T105603.421325Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d735689c", + "indexed": false, + "name": "primary_image-fov_000-Z13-H2-C2.tiff", + "s3_etag": "6312ba6081f851b6a62ecd624764cad3", + "sha1": "53f3a2a46803321bfa6b0271c887130a4d87a94d", + "sha256": "4de7ef1850de8d30f292f26d5df973c15a37d0f09fcec7e36206c1380e74abcb", + "size": 1600269, + "uuid": "9e4aa7a1-045c-448d-9506-9f180646f31e", + "version": "2019-04-03T105603.652981Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3ede4f1c", + "indexed": false, + "name": "primary_image-fov_000-Z13-H2-C3.tiff", + "s3_etag": "c6cd4cc027b68101cdebd5cd9c8b4a67", + "sha1": "745fd35a8b5509b852148f57dbd9a4dbb4bd355a", + "sha256": "42173d6b156f00f205f92f20f694b7392ce3d7619033122df8388e1a45acdc73", + "size": 1600269, + "uuid": "54ddc5aa-4b48-48e5-a955-2f969478eb8d", + "version": "2019-04-03T105603.939697Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2567a82f", + "indexed": false, + "name": "primary_image-fov_000-Z14-H0-C0.tiff", + "s3_etag": "23d4e877ecb39a2bb4b4323ee3560bd9", + "sha1": "076ae34880e7546836d365851668aae082501850", + "sha256": "2c9e806302eecfe1fa003b8ed15beeed08d6cb6e93b2552c30c7d48a8253386b", + "size": 1600269, + "uuid": "9ab3b14e-52eb-45fe-8473-b166185732fa", + "version": "2019-04-03T105604.189833Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d89a7999", + "indexed": false, + "name": "primary_image-fov_000-Z14-H0-C1.tiff", + "s3_etag": "733724cfb40992f157c06a21429ce63b", + "sha1": "f81644e79659aa85009d30b5747126a4a4c3bf52", + "sha256": "c5554bc09b3722f4b63a015ccd5f952778d60b0e5c5b11e8e6850028cd41f4e6", + "size": 1600269, + "uuid": "e877a847-80aa-4d68-a069-6da3015bb19e", + "version": "2019-04-03T105604.480375Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6a6f2b31", + "indexed": false, + "name": "primary_image-fov_000-Z14-H0-C2.tiff", + "s3_etag": "caf29bdd34d04d56efa7ffe4e69bdf15", + "sha1": "178b19662651333bcd83ee5c979c5fb21a24ee3a", + "sha256": "8c77ea0a4a7e17738c3f1148a63b37d068acc1ffc8fc2d5c9e9f0dbcf88d02ce", + "size": 1600269, + "uuid": "f30fb34c-ea78-4c55-8342-666e028b1ec7", + "version": "2019-04-03T105604.725431Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8e7e28ba", + "indexed": false, + "name": "primary_image-fov_000-Z14-H0-C3.tiff", + "s3_etag": "50d4a2b1c64d9a6091118b0f3ba69082", + "sha1": "904cedf9d6d62d129da6d3a1d30fd7c74e21bdfe", + "sha256": "a6d97e21fea1d3cc28be720bccb70f9f2a0e3fca6ffbce383ade7612ed90ea13", + "size": 1600269, + "uuid": "a800e1a6-58b9-48ea-b33b-b2c58627e5f0", + "version": "2019-04-03T105605.006005Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f31ac427", + "indexed": false, + "name": "primary_image-fov_000-Z14-H1-C0.tiff", + "s3_etag": "8ffb788e265f2f239b5b23fa695e1119", + "sha1": "087a91c220f450a4baee76b805e81170384a1e63", + "sha256": "2f3af86421a5d9ec2101ff3943a8157d3ca2b257d04676bec5a1608241b9e93b", + "size": 1600269, + "uuid": "4971ef5d-cd50-48e1-a7f3-91e1ebf27dda", + "version": "2019-04-03T105605.420646Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "71e66e31", + "indexed": false, + "name": "primary_image-fov_000-Z14-H1-C1.tiff", + "s3_etag": "8c328a7008b42a8ca4dd7cea274cb679", + "sha1": "7da5e8987204a4abb4329c45a04e79eb5181006d", + "sha256": "c87288170e297bcacb92a8b685251eb3b8b5f61cd14cbf569ba7473e33bf289d", + "size": 1600269, + "uuid": "0fe0425a-1371-42d6-a6d2-36962c8a22f7", + "version": "2019-04-03T105605.641366Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "bb067245", + "indexed": false, + "name": "primary_image-fov_000-Z14-H1-C2.tiff", + "s3_etag": "072dfe78e868a7886774cb3aa04a0a7f", + "sha1": "04486bf2cabb0f3ce29603ce8605d0bbb5b36aa8", + "sha256": "9a1b23dff11928fe74e4779a3e9865b9cb732683a0bee85da64e5afb38959383", + "size": 1600269, + "uuid": "25ff77de-95eb-4737-9ba2-fff2969eca73", + "version": "2019-04-03T105605.904789Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "69c233e3", + "indexed": false, + "name": "primary_image-fov_000-Z14-H1-C3.tiff", + "s3_etag": "ab66d0e958e7ae0cd9f7de7b21edd2ee", + "sha1": "149743809ed468c9878334e4deabf25b5f0de6ff", + "sha256": "3afe34c5645c4c6ed4e8fd71882f8e84d62544eea7b926de3eddc31a81084854", + "size": 1600269, + "uuid": "f1bdabbf-13ed-483c-8492-a6c9c2f65db6", + "version": "2019-04-03T105606.322160Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f98fd263", + "indexed": false, + "name": "primary_image-fov_000-Z14-H2-C0.tiff", + "s3_etag": "1a39d83cd8e12cc23e42c24f6668dc33", + "sha1": "eaf2b358ed990a93bae6c6c2bcb9a462673901a4", + "sha256": "304439ad4583424ef116b6ac98a44c1d43a7622472b2a3a89677b54392acb577", + "size": 1600269, + "uuid": "5b57e6a7-e098-4605-b00a-d58652698580", + "version": "2019-04-03T105606.659307Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "9db56d08", + "indexed": false, + "name": "primary_image-fov_000-Z14-H2-C1.tiff", + "s3_etag": "dda12be46aeb27da4da7ecf1cbb44dd5", + "sha1": "9e1e7ad1c9c013feba08c3ed48c29e3b81f4469a", + "sha256": "9158ddf94cd4395252a02c2f61a4e2f3b179593839a2c22a2c89066dc053e5de", + "size": 1600269, + "uuid": "5cadfa19-ed60-4ba2-b04c-c23b6c0495f7", + "version": "2019-04-03T105607.139632Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7a76cc49", + "indexed": false, + "name": "primary_image-fov_000-Z14-H2-C2.tiff", + "s3_etag": "424a333527ec9d3651d09f2ae01ca8bb", + "sha1": "ab8ab11f26ccdeb60dbda96f689ff38939ef585e", + "sha256": "e49b7f981478d3e32fe3ffde7a952a2361d22a6df1cc55b8f6d364646149d425", + "size": 1600269, + "uuid": "f2fe8c9e-6ed6-4999-a98b-4fecf57da55a", + "version": "2019-04-03T105607.380785Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1ad0ed69", + "indexed": false, + "name": "primary_image-fov_000-Z14-H2-C3.tiff", + "s3_etag": "91f0b66a436c7f9a78827c3a3ccac38d", + "sha1": "49f4f1cc2731e44d68b362d30535d674a02b9e1c", + "sha256": "24612939c544d89c59e974d0283cafae98528f56a9e52d5761f70e7b8757a5fa", + "size": 1600269, + "uuid": "b8ab79bd-28c8-448b-9847-f8f10d3ccc45", + "version": "2019-04-03T105607.648634Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "0b2929e7", + "indexed": false, + "name": "primary_image-fov_000-Z15-H0-C0.tiff", + "s3_etag": "2f41176517472845c1720f78d268af09", + "sha1": "8c432af92536a457fbacd9f78a8c8591d6c116ca", + "sha256": "67b14eeac471ed074ca1063bbe78845143390c42914e8908ea4ef7341b10fb13", + "size": 1600269, + "uuid": "dcc63bdc-2c05-488c-98ce-905b6b1fcfe4", + "version": "2019-04-03T105607.955180Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "004524d0", + "indexed": false, + "name": "primary_image-fov_000-Z15-H0-C1.tiff", + "s3_etag": "9d4f239273a8134f9a0f3496f3fa931e", + "sha1": "5512afc374fe1b4acd0d7bfd009d33885bf820cd", + "sha256": "7652e6b69da6660427c7a985344ed04eef6970f43ad69af6e52bd92d90cceec0", + "size": 1600269, + "uuid": "f3926330-cfa4-4f64-b12c-3e50e06a7153", + "version": "2019-04-03T105608.221439Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1d122a71", + "indexed": false, + "name": "primary_image-fov_000-Z15-H0-C2.tiff", + "s3_etag": "aeb11c110398d407c6c2a4266d8c3349", + "sha1": "84198102a0a6dc4cf9b96da68ea81ef165ff8df6", + "sha256": "0551b9abc860383650a0fc551ee22f876d3041924377eeb5ec079917718fa75d", + "size": 1600269, + "uuid": "b134deb9-6a03-486f-a603-955348d1cb67", + "version": "2019-04-03T105608.540867Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ced5e43d", + "indexed": false, + "name": "primary_image-fov_000-Z15-H0-C3.tiff", + "s3_etag": "93e4975a342f3f4bd9e540e466807eba", + "sha1": "f488f82f0865e633c467aa3d807d3bf3b785a36c", + "sha256": "0d40beb93999b640ac48a7aff74214eb0e17fd80e40303be16f0d04f232dfaef", + "size": 1600269, + "uuid": "b9aef9b6-f326-4d1a-b912-41030791bc78", + "version": "2019-04-03T105608.782580Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "9621a4da", + "indexed": false, + "name": "primary_image-fov_000-Z15-H1-C0.tiff", + "s3_etag": "2e7af9b5ba0712fa9823898c582b1171", + "sha1": "592bc4308878410f03ada6e6c8ea5a7d39ff87cc", + "sha256": "42ed249546e37d66f631498a848e02d183fa919bc242d810333ac5b2ca94e7e8", + "size": 1600269, + "uuid": "e9f28e2b-b63c-4819-8385-18062c5411aa", + "version": "2019-04-03T105609.057230Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4f9f2476", + "indexed": false, + "name": "primary_image-fov_000-Z15-H1-C1.tiff", + "s3_etag": "caa6bab888b91f870d1dfc5eb758f541", + "sha1": "7304181ad037514a180bf43a1a79254c86301b42", + "sha256": "4c9493782169ea02a632b1d911b9b026c680569c1d87cada888458f025962129", + "size": 1600269, + "uuid": "a7309326-5690-413e-8b73-1f33f8897dab", + "version": "2019-04-03T105609.289499Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "570dd01a", + "indexed": false, + "name": "primary_image-fov_000-Z15-H1-C2.tiff", + "s3_etag": "626956c92c5187481a0c0276c7839812", + "sha1": "33752130b76286f50bcc5873000dd9613faaa16c", + "sha256": "dcdc7393bfb9721c8bb3062e1ddbfb6e5f6ea1108ebdca1afca0a797d05697c7", + "size": 1600269, + "uuid": "6bd9329f-5602-4c75-92c8-84882ba69685", + "version": "2019-04-03T105609.542553Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "84defed1", + "indexed": false, + "name": "primary_image-fov_000-Z15-H1-C3.tiff", + "s3_etag": "51ad1fb9bcded0393d1a2995c5861df3", + "sha1": "2ea4671d25ab754b32c564caa28ab7823d8d6ad2", + "sha256": "6b311490b4b187aa705716c5facca6e74d2248638d95af9be1b8fff6d0afccb4", + "size": 1600269, + "uuid": "0c9f682a-a5dd-45ed-bcaa-be4e5342771c", + "version": "2019-04-03T105609.824711Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d96c5e2a", + "indexed": false, + "name": "primary_image-fov_000-Z15-H2-C0.tiff", + "s3_etag": "92545335007f347406aacdbf892ebfdd", + "sha1": "86094e1e453f5831cf76f320aa3975ed986e8f86", + "sha256": "2bd656d393d3d3337ed6258b1e5e61f799370f6a5958a9fc5f816f1407adca4f", + "size": 1600269, + "uuid": "36063754-9a8a-4815-9783-1508974a6ca3", + "version": "2019-04-03T105610.096845Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1b71539b", + "indexed": false, + "name": "primary_image-fov_000-Z15-H2-C1.tiff", + "s3_etag": "027dfa4d7f544005e04f75be47ae1cdb", + "sha1": "9eedcc5e6e5bab401388effd57769e35ba897ee6", + "sha256": "8597d134ccea0e906080b36f8717c8be936bf90b682434d23c9eca0649bea27f", + "size": 1600269, + "uuid": "a601ed00-aadd-4ac3-95ef-25fc052c37db", + "version": "2019-04-03T105610.401438Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b7fd53a2", + "indexed": false, + "name": "primary_image-fov_000-Z15-H2-C2.tiff", + "s3_etag": "bf901bf83745da9c9c53c26e8852938d", + "sha1": "45a4b73120e37579508e9e6a9719e5944bbe0c78", + "sha256": "da60f26d4165e3fa29819338ce470d2101c02df2657b8b1272fd56be0919c280", + "size": 1600269, + "uuid": "e9da4b39-a542-4f3a-85af-c9da97172715", + "version": "2019-04-03T105610.683603Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7944dc17", + "indexed": false, + "name": "primary_image-fov_000-Z15-H2-C3.tiff", + "s3_etag": "ffd7b80c10d1e2654181a38485f457a8", + "sha1": "6708d5c43e6742546aca16c0ba9cd5585b72e56b", + "sha256": "b80a54f1e3efafb5aa6de7d3f0d6e309dc3973c957c91245e790cc36c08482b9", + "size": 1600269, + "uuid": "215ebd60-69d7-4509-8575-301f28d841b0", + "version": "2019-04-03T105611.022078Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6af55e11", + "indexed": false, + "name": "primary_image-fov_000-Z16-H0-C0.tiff", + "s3_etag": "a88aa7b3a586d4d26b8be621167c5b94", + "sha1": "66da568c0925617e3b3c6825fd6a541fdeea6f7e", + "sha256": "516ccfdda5551806152d5f3de11fc1f14ec21ca2b5452dc53e98416f5f47daea", + "size": 1600269, + "uuid": "47c1ab01-7bb9-4cc6-949e-aff889b78bc4", + "version": "2019-04-03T105611.559338Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "89ab529c", + "indexed": false, + "name": "primary_image-fov_000-Z16-H0-C1.tiff", + "s3_etag": "46fc4422fe7b8dc81ff4e5c614263b1f", + "sha1": "aad78416ba051f4e2d6b406292b8d7e0265e89e9", + "sha256": "68c9dfe824f02f572aa39d5dfc16d5cc92a0664ce4ec7fce21b513a5d5120400", + "size": 1600269, + "uuid": "bbaf020d-e851-4259-8784-832fc85b6c83", + "version": "2019-04-03T105611.801366Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "771e1a24", + "indexed": false, + "name": "primary_image-fov_000-Z16-H0-C2.tiff", + "s3_etag": "9fada1d9ff3394e4b113f8ad2bdba081", + "sha1": "6e43f11f0a5ca2f28378d8770e9af3d356fd644d", + "sha256": "1494d456f4a227f28525a90eaa34a68e76b852aee12b8e010331f6908dc73904", + "size": 1600269, + "uuid": "6c0ffe0f-19a5-4ed9-92e1-316f3d8cc1f9", + "version": "2019-04-03T105612.278469Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "77615d8f", + "indexed": false, + "name": "primary_image-fov_000-Z16-H0-C3.tiff", + "s3_etag": "40fc5c6cea15336a43a4dc4711a4ae00", + "sha1": "da32bedc5eeb2ce47908ded5a770610cc07f8c30", + "sha256": "33a6cd371f88a33bf0f1daa0345e47f414af1636f420e4fb1a1edcdd6687563b", + "size": 1600269, + "uuid": "60edf99d-ab78-4bab-b3de-801fabbb7116", + "version": "2019-04-03T105612.622653Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "735764c8", + "indexed": false, + "name": "primary_image-fov_000-Z16-H1-C0.tiff", + "s3_etag": "fdc28a410e4b61d3264243827629e74d", + "sha1": "75cd7a485c26b1559eb0ead8f71e3892037b9f38", + "sha256": "061cb156a427a7277fe5bfdada22068981a75546e1cb8cda89b6259a359e4c8a", + "size": 1600269, + "uuid": "bbb92406-a0df-4de1-97fa-fa10457198d8", + "version": "2019-04-03T105612.859568Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4043af28", + "indexed": false, + "name": "primary_image-fov_000-Z16-H1-C1.tiff", + "s3_etag": "a587f1d6e7b711ed13cec30e69c0c1b2", + "sha1": "37ae6779436a6a258606562697fa6d7ddfe44fc6", + "sha256": "bd0be59413d859115ff7f265726c32a303dacdd3660f5f70eecd9a9511db0ec1", + "size": 1600269, + "uuid": "0d38ed8b-ccdd-4a32-9be3-bfa62f535c5c", + "version": "2019-04-03T105613.080125Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a88f3cf2", + "indexed": false, + "name": "primary_image-fov_000-Z16-H1-C2.tiff", + "s3_etag": "b4e387ce74fcb5a511fd92cdfef07e13", + "sha1": "fee047cab4461e58350bc44a07aab0c5a067784a", + "sha256": "7c9e194ae38ba112afb630d03d686135c13cedbd0dca0a6a287b91a82af1ad9e", + "size": 1600269, + "uuid": "0bdded17-864c-4c7a-a499-24a4267b4dc8", + "version": "2019-04-03T105613.344358Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "261d6caf", + "indexed": false, + "name": "primary_image-fov_000-Z16-H1-C3.tiff", + "s3_etag": "fcee02cab9e177c39658cd9313183445", + "sha1": "f888e61fba8808efe439bda90dd47a06009a35a8", + "sha256": "f7833d340e6ba0fcfa3082241e16e54444576db840d73a911a2d40c62e6c7c42", + "size": 1600269, + "uuid": "e61824cb-b2e3-4131-a93c-0f809407e12a", + "version": "2019-04-03T105613.584363Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ffeec2e6", + "indexed": false, + "name": "primary_image-fov_000-Z16-H2-C0.tiff", + "s3_etag": "9961c3c49217e32c5ede426cf5171155", + "sha1": "2fc56166144927399d9e3e5d39c873e242580388", + "sha256": "341648c0b44a819c34a6c27d213e5d252d5edcef5e88d842f817832b09bfbcba", + "size": 1600269, + "uuid": "1cab431e-680b-491e-9f8a-9503230a602c", + "version": "2019-04-03T105613.859236Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b0e8ea39", + "indexed": false, + "name": "primary_image-fov_000-Z16-H2-C1.tiff", + "s3_etag": "0102cca9defd31c65585f717a10d5bda", + "sha1": "d5c57eff3c4be5edd22e442408c8231393bed2c8", + "sha256": "1360f3f3c583137c692923cc6b1fb416575482e6e248196a6bb1fecd5e27cd97", + "size": 1600269, + "uuid": "c8f06cec-ac9f-4241-8f0d-86daecbda3af", + "version": "2019-04-03T105614.120757Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2d57a1e1", + "indexed": false, + "name": "primary_image-fov_000-Z16-H2-C2.tiff", + "s3_etag": "c17ba6739bc7684046bfe0bb9ae5b549", + "sha1": "a0100b495ba6b92a6140a9483abe9e396dd79089", + "sha256": "144d25544bf2995a01f834cfe7e71f696d1cec67ff4ff355216189c25696301f", + "size": 1600269, + "uuid": "0fb666f0-0331-4532-8ed6-9ee27b383f96", + "version": "2019-04-03T105614.469912Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4c624098", + "indexed": false, + "name": "primary_image-fov_000-Z16-H2-C3.tiff", + "s3_etag": "d99948dce1012b3533fc8d8807372c4f", + "sha1": "eb2b7fc4b7c3c5e39fc623add18d5755173355a7", + "sha256": "9c4ffe1988df43cf7718d61790392096a85d294aabf389c177a3caf31df8e8a0", + "size": 1600269, + "uuid": "ebcf808e-8039-4d0f-9c6a-82ddf9bd6dc0", + "version": "2019-04-03T105614.720103Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1b85888c", + "indexed": false, + "name": "primary_image-fov_000-Z2-H0-C0.tiff", + "s3_etag": "8c3c48e91e7ae78c3ab1c7c64e764aa2", + "sha1": "d617c969390d82f651fe9fa0243ccf3ffe0c6686", + "sha256": "e4eb56824253d3871a1255644aacbc8a00214b68d774463d87a0a4913f61ac25", + "size": 1600269, + "uuid": "ae06e940-6a8d-44a1-9e5f-de404f802e0d", + "version": "2019-04-03T105614.967111Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "52c76c82", + "indexed": false, + "name": "primary_image-fov_000-Z2-H0-C1.tiff", + "s3_etag": "78532080864bd984fd9893f40046b488", + "sha1": "677b6148a4420ee93322f9d716b55e5a6df96450", + "sha256": "cd54522df1f749716b726df51c45563c3d7be47d9bcce9b5ac97576062e9f720", + "size": 1600269, + "uuid": "a3001444-768b-45bd-82f8-ffd492f8a9ff", + "version": "2019-04-03T105615.221216Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "49c661d3", + "indexed": false, + "name": "primary_image-fov_000-Z2-H0-C2.tiff", + "s3_etag": "85a90e2603bf8881499014d78c07a9c1", + "sha1": "72c98cb505fd875344a522431e5132e0e00e3f8a", + "sha256": "f280463e13ed0c1804280dfe839aeafc31978f5aa22fef71f998c05fa3981e1a", + "size": 1600269, + "uuid": "fcf35fc4-c4da-4643-9b4c-46ae410160ea", + "version": "2019-04-03T105615.545209Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c52334cd", + "indexed": false, + "name": "primary_image-fov_000-Z2-H0-C3.tiff", + "s3_etag": "c70b5e8025a12c00f90d64da288e0666", + "sha1": "f36222db39a0600e497c8547c40e057d69cce655", + "sha256": "1bf0530559802b92677858e96a43be30c77ba94dd170630b3bb2702b740eb5e2", + "size": 1600269, + "uuid": "a454ef32-a818-48bb-8986-59c91a3582d6", + "version": "2019-04-03T105615.780166Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "83b7b009", + "indexed": false, + "name": "primary_image-fov_000-Z2-H1-C0.tiff", + "s3_etag": "1477e3cfd21e5661b4f38c0002d622f3", + "sha1": "63188f3bcfe791d5e7ac797662c764857bbfb7a5", + "sha256": "04733ed9c6df06e23b249b23f985e61c66927e8be780f691e87f23b5cb01ad66", + "size": 1600269, + "uuid": "514c1928-88b2-4ee4-9a36-6df3a1ea6ad6", + "version": "2019-04-03T105616.144108Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a90594d4", + "indexed": false, + "name": "primary_image-fov_000-Z2-H1-C1.tiff", + "s3_etag": "cc4644e2e6ceeafae8135a4d6f9a8d0a", + "sha1": "2326bc68eee158ed0a04d6d985c18a75d18ad15a", + "sha256": "7300a8d3a2a5b2e2104979e3740320ee9595bba2483ef225e6d35134d1284d9f", + "size": 1600269, + "uuid": "7334d870-d87a-42c5-a56d-cad22755b2c4", + "version": "2019-04-03T105616.706622Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7f7b23b1", + "indexed": false, + "name": "primary_image-fov_000-Z2-H1-C2.tiff", + "s3_etag": "1dbebf9b99808edfb51ae30baff92a4a", + "sha1": "6117c5ba6b63412656028968a4a840bc68d0573d", + "sha256": "188f587144c32af04e345736189d8fe2ff0d937fcad34cd4245ab39df87f07d3", + "size": 1600269, + "uuid": "8f9a873c-db55-46f0-ac21-2675647a2553", + "version": "2019-04-03T105616.941310Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "548dcdb6", + "indexed": false, + "name": "primary_image-fov_000-Z2-H1-C3.tiff", + "s3_etag": "769b4c4c76ffb3bce4b616db20d034d5", + "sha1": "a08d40f28616ef6ae142b4c37b4d84c591efe435", + "sha256": "1fd2a0467af9e35362571370a84a6b64815813f78b265c2dd52f5def6d096f3d", + "size": 1600269, + "uuid": "6d2fd5c1-91d8-42b4-9958-41b9b7be2ee5", + "version": "2019-04-03T105617.319136Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "29d61c42", + "indexed": false, + "name": "primary_image-fov_000-Z2-H2-C0.tiff", + "s3_etag": "57c05571d8b8821b13e556be93da0d84", + "sha1": "fc0fff1511e1e4d84669d57033b6ffc39ed4405f", + "sha256": "b650b9e0da3106417bae5b48d9eb37eac1fce1448ec94f5c71be1ac7062fda2f", + "size": 1600269, + "uuid": "909dd3ed-d856-4a87-aa6a-7f5e0d390d2f", + "version": "2019-04-03T105617.543209Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f72a81a6", + "indexed": false, + "name": "primary_image-fov_000-Z2-H2-C1.tiff", + "s3_etag": "cce75b96e44777a01f2ad68299492f6d", + "sha1": "59611c72b8d9fcf13669eada705254fcdefdc7ff", + "sha256": "d2b61894955a168fb0ac7829cc9ee733143524604b1e80530485ea8e5011360a", + "size": 1600269, + "uuid": "b70a3092-a8b6-40ae-9cbb-34cbcb5a2cf0", + "version": "2019-04-03T105617.821595Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f5c2377d", + "indexed": false, + "name": "primary_image-fov_000-Z2-H2-C2.tiff", + "s3_etag": "67a34e735ffd103e596353c26fee3c3f", + "sha1": "792ba03c85920df2ce38be9c03eec054caa1047c", + "sha256": "650bf866b8fb87ab9cafe2bbfdee1efb65c72f63e95428af59c5e8c41d95ebac", + "size": 1600269, + "uuid": "b9efda80-7e16-4e5c-ba35-6129b824b553", + "version": "2019-04-03T105618.200496Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "d6429d4f", + "indexed": false, + "name": "primary_image-fov_000-Z2-H2-C3.tiff", + "s3_etag": "9296ab3ee1b462b5a5d65a56f214b997", + "sha1": "e49c58ddc0fb9e6290520a2f60d1ef891b56206f", + "sha256": "2386bc3553f1f52628afebecf6ea96b17f3312340de1a7b9386a4dcbb4d8fd10", + "size": 1600269, + "uuid": "8c4f42e5-8544-46a9-9744-7540c07e040e", + "version": "2019-04-03T105618.586702Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5aafd070", + "indexed": false, + "name": "primary_image-fov_000-Z3-H0-C0.tiff", + "s3_etag": "d062ee9eb1e0c4e80b71eef975768106", + "sha1": "e6d768504b4a0a608de93df16912d44b44da0e7b", + "sha256": "3d3c0fbe3d11decaacf6c24eed84bcf915c9cf6714962d290e12dbada9f3abd3", + "size": 1600269, + "uuid": "c9b04d1c-02ce-4db6-bfd5-b69edef36c55", + "version": "2019-04-03T105618.841432Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ef964528", + "indexed": false, + "name": "primary_image-fov_000-Z3-H0-C1.tiff", + "s3_etag": "9194049a53022defccc87e6e373c702e", + "sha1": "8dacd7cc7ccec6a231a1c2ef9ab8fc6ca5b1d567", + "sha256": "f53aff93086e8ff3abd65c5bdf385d44cda29bfd5cfb71bb2296a3e3bd0bc48c", + "size": 1600269, + "uuid": "70c7781a-b4b2-49db-b818-9582ae41c32f", + "version": "2019-04-03T105619.399696Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4820d355", + "indexed": false, + "name": "primary_image-fov_000-Z3-H0-C2.tiff", + "s3_etag": "9d48c889e143511f4ca118d57244795f", + "sha1": "b3c27cdfad9eb8676658dbe431aa25b084fe051e", + "sha256": "83a46a8f63f65099bb24b3a2ca046d0bb138915d48069cb1d598fb14418774ce", + "size": 1600269, + "uuid": "8a21baa6-cff7-4807-85f6-2815522f2305", + "version": "2019-04-03T105619.679038Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ad76dbb5", + "indexed": false, + "name": "primary_image-fov_000-Z3-H0-C3.tiff", + "s3_etag": "f4f641752b8c92b5e33846f971e2bb99", + "sha1": "54f1de46504eac499d5da453eb8fc09787c800f8", + "sha256": "48ed76ac22ccd6d9b378b605a2e6fd92618d49c684b7ba4e5a656dc94b825aa4", + "size": 1600269, + "uuid": "8ddd205f-c13f-4001-93ae-c9b834c762bc", + "version": "2019-04-03T105619.959849Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "da30f7e2", + "indexed": false, + "name": "primary_image-fov_000-Z3-H1-C0.tiff", + "s3_etag": "73ff3d828f234c4a34e41c43cb1b8e1a", + "sha1": "688dea42d4d0341008af68033eb471047d7448a0", + "sha256": "862916d173844e00fa7c89f2f569127dc9b4ea40ffced0685ba1f6c0366b6ec1", + "size": 1600269, + "uuid": "318fcac8-e540-4c30-840c-9baf19dd8ac1", + "version": "2019-04-03T105620.515721Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4acc4110", + "indexed": false, + "name": "primary_image-fov_000-Z3-H1-C1.tiff", + "s3_etag": "ba6d37a8269a9bf6c3788d52031b29bb", + "sha1": "913541ed4d6e6c3cb87e40e7c479f2520eb489df", + "sha256": "2dcba4d4d5519f97c2eca00e9840d3e16a585760fa5768dff9aa464d1c70b025", + "size": 1600269, + "uuid": "76690f93-b774-4a5b-8e44-ed1a15463d28", + "version": "2019-04-03T105620.763724Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "43cc3f48", + "indexed": false, + "name": "primary_image-fov_000-Z3-H1-C2.tiff", + "s3_etag": "97b6d5bf0fd61b5f513efa2b409b9edf", + "sha1": "315da7494e53e2b8017b5a83f6add784aac12d6b", + "sha256": "e3632c252f3e5ed30bb19bf77c1a9689e68d4e62749a22903eba05181f6b118b", + "size": 1600269, + "uuid": "a5c6ec42-6651-416f-8bf2-a75d19067701", + "version": "2019-04-03T105621.035316Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ba844c65", + "indexed": false, + "name": "primary_image-fov_000-Z3-H1-C3.tiff", + "s3_etag": "dc45a53df4bcdbe0f43c5413905aba1f", + "sha1": "87120245035e23c44389cb116f9cb669618b9f0d", + "sha256": "572b1a336be5579f17ba32ae2100148ac7375673f8e44b9d23e27fee815b861d", + "size": 1600269, + "uuid": "08360384-d64d-423c-b393-ac77e55f5b54", + "version": "2019-04-03T105621.335645Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a22c482c", + "indexed": false, + "name": "primary_image-fov_000-Z3-H2-C0.tiff", + "s3_etag": "762d5e4141197e0c63b8b038de8d6782", + "sha1": "5ddf8c065eefec37b866ac74b577fe05638c18f7", + "sha256": "5d614db01b19b9ca8cd948080d29026bfbdaa175e49cdf9e2f7462525b640d20", + "size": 1600269, + "uuid": "9fced6a6-70df-414b-ac73-dff271a5dbf5", + "version": "2019-04-03T105621.654577Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "93e07072", + "indexed": false, + "name": "primary_image-fov_000-Z3-H2-C1.tiff", + "s3_etag": "e3d9685615d21051daa9b834083d3d96", + "sha1": "1b8656a4a26eca4adaba32a328e1963cd6296a61", + "sha256": "3ca858c6ec4f2703e14b6b32f8823c108155400b89ee6bed925a7ae8185ee2f3", + "size": 1600269, + "uuid": "a05d672e-b664-412e-a050-a57c205edabe", + "version": "2019-04-03T105621.895551Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f3907f41", + "indexed": false, + "name": "primary_image-fov_000-Z3-H2-C2.tiff", + "s3_etag": "a9632bd5ab7fe1c532115b21830bcf93", + "sha1": "4b47753bfd6d202f885abb97da2533b7bd333a9d", + "sha256": "a0529f39e6739c75a7967c08cf06f3368676fee4ad8608e7fb44807583116479", + "size": 1600269, + "uuid": "186d9626-1b8b-4bc2-ac7c-745ae7479019", + "version": "2019-04-03T105622.164338Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1dafc649", + "indexed": false, + "name": "primary_image-fov_000-Z3-H2-C3.tiff", + "s3_etag": "619b8ccde9982a5537734b1ce393368e", + "sha1": "ac208729e50fb9db5975b6451093f635cf38d2f1", + "sha256": "dcacf37924188294b6f2ec83cddb037ed8477a4500ac8ece18e1499863a3f87c", + "size": 1600269, + "uuid": "db870673-6390-488f-998f-c96d02a17238", + "version": "2019-04-03T105622.575382Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "e812fa56", + "indexed": false, + "name": "primary_image-fov_000-Z4-H0-C0.tiff", + "s3_etag": "b86ff8c077a32dc884738059d569152d", + "sha1": "d768db2b3899d10c260b912d87160d27de8aa1a9", + "sha256": "fbdbe7a0b4a3a51e684b5a1bacb0ac4a993133d784f9eebcdaf20643396a0142", + "size": 1600269, + "uuid": "56ecf18f-2cf1-4db1-8acf-a82a04b55ddd", + "version": "2019-04-03T105622.895893Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "daa4be7d", + "indexed": false, + "name": "primary_image-fov_000-Z4-H0-C1.tiff", + "s3_etag": "059da13f286d8489c3cb3dbaa28a3f8b", + "sha1": "85115eaeed5919dce2dbfd3177377032850caab3", + "sha256": "868c1a7e2880dfc0018ecd373afe8dbb4a7d99288abb66443153f49641c631b3", + "size": 1600269, + "uuid": "a79ce39b-a4ed-4b97-a047-afb96e4ce398", + "version": "2019-04-03T105623.199025Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5cedc9de", + "indexed": false, + "name": "primary_image-fov_000-Z4-H0-C2.tiff", + "s3_etag": "4d963c867351acbb456f9058467b5a39", + "sha1": "d113362b2d7d9b8270b27b255c5fac598548cf86", + "sha256": "1bd2f114e642e4fba400ed901f4a45bc6c7b4eff683a36f9ad66d693c5234385", + "size": 1600269, + "uuid": "4f29d438-3acb-4a71-af29-e3191f071a44", + "version": "2019-04-03T105623.525898Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "a618c91c", + "indexed": false, + "name": "primary_image-fov_000-Z4-H0-C3.tiff", + "s3_etag": "df6da4b2926b1d8f8f89a2032651a430", + "sha1": "3d35e6e7ea83ab7c2e3cf11d002f89a8ecd483f4", + "sha256": "236595504636b01cc3493f1191584b64b12b79f4471938f8b5da36aa41ce6048", + "size": 1600269, + "uuid": "9578fe1c-6623-49ee-afd7-8e6c4d85d8fd", + "version": "2019-04-03T105623.779296Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b92778d5", + "indexed": false, + "name": "primary_image-fov_000-Z4-H1-C0.tiff", + "s3_etag": "453f91d8dd3b445904d6f0f85ab6becd", + "sha1": "54d59f36669cc295891467c014cd4f69cbe6253e", + "sha256": "bb52f37c1253132ca1f2575e0dd3cbd445cfb2ae821967968de96530844dc17a", + "size": 1600269, + "uuid": "24fc3772-5e01-4a34-8bd8-98d745595571", + "version": "2019-04-03T105624.055806Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "aedae183", + "indexed": false, + "name": "primary_image-fov_000-Z4-H1-C1.tiff", + "s3_etag": "fd1d5c55761ad8e46e70a8c49e2252e8", + "sha1": "ba3212180c1c65ce661492c22140c9781049ddaa", + "sha256": "b46abde44f1fb374d8d796c7bf1e5ecd3f65b80eef3229107cfc975b60407c30", + "size": 1600269, + "uuid": "af10a2c0-5f84-448a-a429-7e88bcf8d2d4", + "version": "2019-04-03T105624.344848Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "53cd4995", + "indexed": false, + "name": "primary_image-fov_000-Z4-H1-C2.tiff", + "s3_etag": "a7d7945c407b8d014f92a2f292dfbe65", + "sha1": "6fa31c4a9d846a353a5149a538a1ceb6b48293d7", + "sha256": "b39e60b7133221fbc35eff41ca912aaab4c7492bfe8197ada75fb5c5ae81ba8f", + "size": 1600269, + "uuid": "ceb1e477-69a0-4fa0-90c9-ee35e16c6d33", + "version": "2019-04-03T105624.610737Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8579d287", + "indexed": false, + "name": "primary_image-fov_000-Z4-H1-C3.tiff", + "s3_etag": "fa4ef541c7993436f3cda78604b8b5b6", + "sha1": "0dbd02794fbb3b7541f22220e8f882baeee12b2d", + "sha256": "bd1775fa1eaeab9ca466e3cdfc758760d43e3c1f866138f62965ab94a6f69725", + "size": 1600269, + "uuid": "be9b7636-fbb5-462b-af38-a351e006b334", + "version": "2019-04-03T105624.895931Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "8a9835bb", + "indexed": false, + "name": "primary_image-fov_000-Z4-H2-C0.tiff", + "s3_etag": "ae02ec63016b9abdd620536f859d69bb", + "sha1": "d5d346e6aa8fd1ceda276aed39620fd326da934e", + "sha256": "67f9709da7392cfcc65d8e6460d9b353617de5b56e3480573e5ca8c7bd582037", + "size": 1600269, + "uuid": "a01e972b-5d55-4816-9589-0c016a8eceef", + "version": "2019-04-03T105625.257370Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "98a57d8d", + "indexed": false, + "name": "primary_image-fov_000-Z4-H2-C1.tiff", + "s3_etag": "e84bc9fd5931d981c7ade8b43df6cd77", + "sha1": "ac170164ac57262e00deab61c41757b410cda006", + "sha256": "878d36ccf128a83cf8bba81022d55d30fc4781ab16f0c92952938dfd6eac5a54", + "size": 1600269, + "uuid": "e2ec1f14-7d7f-4693-bb0c-ec5a6f417803", + "version": "2019-04-03T105625.515250Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "aaa60b26", + "indexed": false, + "name": "primary_image-fov_000-Z4-H2-C2.tiff", + "s3_etag": "f4debfc643dd4c87c943390f9f0927b8", + "sha1": "c60896cd90c6eba3f25b3ad43809e9e4b0e175ba", + "sha256": "0e097b54b24ddce69cecd5b38e194c3b8bc501f7557b8641f90268b84711b109", + "size": 1600269, + "uuid": "707f043c-a115-45ee-8fad-2962f55ff58e", + "version": "2019-04-03T105626.011308Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "03952f13", + "indexed": false, + "name": "primary_image-fov_000-Z4-H2-C3.tiff", + "s3_etag": "fb57bffe031aac808b3f763a95b55a19", + "sha1": "be462c01298c1cc2c37e6f3e36775fd36514f179", + "sha256": "5d7170e3cf1805663408e69eed861a2dd604cefe911cc1887575252210147770", + "size": 1600269, + "uuid": "0bf3e1df-6d4e-4fe2-b608-95a23ed4e5a0", + "version": "2019-04-03T105626.396309Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "428ef5bb", + "indexed": false, + "name": "primary_image-fov_000-Z5-H0-C0.tiff", + "s3_etag": "a142720da87ce8c6ada038aa5d49a169", + "sha1": "cd4a508c87fe959f211edb71c11bbd7fbfafd37e", + "sha256": "a0ce165b659ef69ad056ad76b6e93d3dfa999f7845762c3d6d305dcb835885ed", + "size": 1600269, + "uuid": "d90b7354-47b4-4aec-8d4c-ac8805467b6a", + "version": "2019-04-03T105626.655715Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "39397452", + "indexed": false, + "name": "primary_image-fov_000-Z5-H0-C1.tiff", + "s3_etag": "4707b7fa9f888219b829054ca0be4c14", + "sha1": "a56b208676f6a45450b96c5708672d809bb7cdba", + "sha256": "0d77858e76d5a1f29df86674f4732744cd22ebe67739ee0f73430e15124e190c", + "size": 1600269, + "uuid": "dfb213e1-e9c1-4996-a0fb-1da6ea5e6992", + "version": "2019-04-03T105626.976077Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "73578068", + "indexed": false, + "name": "primary_image-fov_000-Z5-H0-C2.tiff", + "s3_etag": "425d807333615faee9e53384c99d1525", + "sha1": "33ca4a69c8fb9c36678b6f43165c22594f4470f9", + "sha256": "b06202c2da34f93e9888e7b227ec8bc955d0a7eb655f43605272fe8d3f76f8e9", + "size": 1600269, + "uuid": "58d7e9ca-9c4f-4a92-8335-d03a007b4b3a", + "version": "2019-04-03T105627.218596Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ce40d3ac", + "indexed": false, + "name": "primary_image-fov_000-Z5-H0-C3.tiff", + "s3_etag": "38ea4d04b518aa2faebfab95c00879ca", + "sha1": "1a0876b3528a7c5a979e0b3f8593989c09ccd060", + "sha256": "8f2919c5a7a173b660fdb1a268f6a8b501e725b1cc4014c46c17900a1c7b40ac", + "size": 1600269, + "uuid": "a7e2a1b2-a3b0-4c19-9baa-17da6bfc9c60", + "version": "2019-04-03T105627.502876Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ab01a9d0", + "indexed": false, + "name": "primary_image-fov_000-Z5-H1-C0.tiff", + "s3_etag": "b7b0f23db471b2ba161a37bbbb49dacb", + "sha1": "a5335cd38929f7454e0661780b49b4c8d3e4c3ef", + "sha256": "10965856cd7ff817b66b2770367587844c69cf3897907c422b9285f5a5240b43", + "size": 1600269, + "uuid": "a2366fa7-fba6-4899-a2da-d297f781ed4a", + "version": "2019-04-03T105627.790236Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7ea6bda4", + "indexed": false, + "name": "primary_image-fov_000-Z5-H1-C1.tiff", + "s3_etag": "e15f3bdc49f3eece05d6b91c433e7f56", + "sha1": "62b7d1490a78d98165468dbe5bb2f3a6424dda14", + "sha256": "bf275b7057317795046a4371e0da5d060dd7db54b43f8af451b6f69dd6d9d179", + "size": 1600269, + "uuid": "3f058b01-c8fc-43e8-b4f9-9c10449bf12c", + "version": "2019-04-03T105628.115924Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c11084d8", + "indexed": false, + "name": "primary_image-fov_000-Z5-H1-C2.tiff", + "s3_etag": "15c1b90d42d37afd77efb11c5dece01c", + "sha1": "ecf9e80d36eaefd41ffb2b2c8cc338a7f65af317", + "sha256": "95b7f3c4382bc8230e8e7497150cdabcdf6a979bf05e469ecdae77c6ce996d6e", + "size": 1600269, + "uuid": "b28492e5-5b71-4048-8261-82b20ef55540", + "version": "2019-04-03T105628.372925Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1e451967", + "indexed": false, + "name": "primary_image-fov_000-Z5-H1-C3.tiff", + "s3_etag": "0898d4a1d00f1aa862dc33cced7b0c9d", + "sha1": "ba2f5515bceff182e8bb2ce6b1fe644e865fb5be", + "sha256": "723f48bc1a4bac1847199bdd6709ea7531c0bf1d4f53d812923f3fe3ef56f0c2", + "size": 1600269, + "uuid": "c5684e6e-6461-4360-bae9-fab162dfe7da", + "version": "2019-04-03T105628.797211Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "dbab5433", + "indexed": false, + "name": "primary_image-fov_000-Z5-H2-C0.tiff", + "s3_etag": "ae3f68ee7ff45d011ca9c39e96f92093", + "sha1": "24768b34064040f3e115af28c05bfbd60c8ae118", + "sha256": "6de64340a14313461ca2cbe4a30c368cb82566f77909afd64beed0048c1aed87", + "size": 1600269, + "uuid": "97b5dded-4ea8-4404-8c9a-449ba9fb8269", + "version": "2019-04-03T105629.135928Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c12f70f8", + "indexed": false, + "name": "primary_image-fov_000-Z5-H2-C1.tiff", + "s3_etag": "15b094ffd10bf74d2dbf06c63afce6f0", + "sha1": "1a3a7e964c90e3330ef6934e27ad20a6b74f5d1c", + "sha256": "acb8c3fe3a17d12b5354c2ccb7625d132140a15af70dea14288e627d54ce2c96", + "size": 1600269, + "uuid": "e879b6b4-3fc2-4436-b8ff-eb9df73d3ed2", + "version": "2019-04-03T105629.377960Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b524a465", + "indexed": false, + "name": "primary_image-fov_000-Z5-H2-C2.tiff", + "s3_etag": "abce483fa1f38c6eff3adc8c139838fe", + "sha1": "4f51deacf61528b2c5e913cc7b90a27b27fbd07b", + "sha256": "11f0f0fc92c2d30e0c5f6113b542e2642f7311db72775ae75d9104e963f5bd7a", + "size": 1600269, + "uuid": "53781f5a-928a-451e-addf-57873b35b752", + "version": "2019-04-03T105629.795795Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1def4990", + "indexed": false, + "name": "primary_image-fov_000-Z5-H2-C3.tiff", + "s3_etag": "4978c445486bca4c2448ef12aa04ca51", + "sha1": "a0c842723a0445c494ec6893045e3e5af44a4634", + "sha256": "f1e583acebdebb6c0fa20e100eb1cd5d6489c8aafd5e1090754dd45bd1dc6901", + "size": 1600269, + "uuid": "e6f008b0-bf18-46bb-be73-2705c748a25d", + "version": "2019-04-03T105630.050748Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f0c87133", + "indexed": false, + "name": "primary_image-fov_000-Z6-H0-C0.tiff", + "s3_etag": "f81727967edfe177a6d063a95dd36e00", + "sha1": "30fe4f671719c78fd7de1b0f28938142fc5990fd", + "sha256": "4f52e11e66b921de450714aa0091d3fec21f96fbc62dade12de2a69dd5438746", + "size": 1600269, + "uuid": "4f5e3c36-fd75-4ee0-8b18-cf54422d037b", + "version": "2019-04-03T105630.396132Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ed8bf4f8", + "indexed": false, + "name": "primary_image-fov_000-Z6-H0-C1.tiff", + "s3_etag": "ecfc2fda1eabe6b5276007a200fdcc11", + "sha1": "ae1728de3c363dff7e8e776c5b74f12109745958", + "sha256": "976128eba622c8b5f5ec780f37ae7ac1410f32130a518bbd1e595c2cfe5da14f", + "size": 1600269, + "uuid": "4ffb1482-0d3c-4796-9a4d-e714d6b943fb", + "version": "2019-04-03T105630.713724Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "bdf3643f", + "indexed": false, + "name": "primary_image-fov_000-Z6-H0-C2.tiff", + "s3_etag": "f9a9614b6742ae7b70059efe0faa4f1e", + "sha1": "3269e888f787f08a92bcf8f641918ddf7dd7363e", + "sha256": "dc35f4a49dfcb2d1b8d1381612dd19651ceabca0b69f18279a96d8d40e76584e", + "size": 1600269, + "uuid": "a173a354-3997-4205-83f2-19e37e174996", + "version": "2019-04-03T105631.296167Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "02ca92c5", + "indexed": false, + "name": "primary_image-fov_000-Z6-H0-C3.tiff", + "s3_etag": "829b50d687a0edc863b03dec0e62c83b", + "sha1": "709535f9930c30f8c2d77112f0039eb0878204c2", + "sha256": "8e489fb561fbd17c7a72f577038dd2be247ec95e8d72dce76a3f59abe8e9ccc6", + "size": 1600269, + "uuid": "410082ea-b30c-410a-9aa1-9dc4d7c16346", + "version": "2019-04-03T105631.687118Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "cd171abf", + "indexed": false, + "name": "primary_image-fov_000-Z6-H1-C0.tiff", + "s3_etag": "5ecfab98c0ffd40322de4c4096a7af18", + "sha1": "7a42648e778cd5c5cf562edefb283b9b9e4f3613", + "sha256": "686dea8aa0155de53310fb9717465eb88f5435c676e2561bdb5bbd17f1ada351", + "size": 1600269, + "uuid": "ea4feacf-2273-4faa-bccb-16e694e14de0", + "version": "2019-04-03T105631.942387Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "653c9b7a", + "indexed": false, + "name": "primary_image-fov_000-Z6-H1-C1.tiff", + "s3_etag": "36d6f6dd8df14136f191373a7af2f4c1", + "sha1": "9da58900ca057df2c53738723dae3b66eb0f717b", + "sha256": "4c684d7b345db1d204134bd77a4b536134d3c2abcebe677e292c0a503d104bf9", + "size": 1600269, + "uuid": "7e6e78b0-a7a4-4b5d-9217-76780babe1dc", + "version": "2019-04-03T105632.208582Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "e148b974", + "indexed": false, + "name": "primary_image-fov_000-Z6-H1-C2.tiff", + "s3_etag": "599e4babff80285e97242bd4cd08f7e3", + "sha1": "d564342f4a3c0cdadaf0df852f0e197e972d82a6", + "sha256": "1a4a4d532775f1fb0df3a7808db2fb297dce720e6fdbafcaa4e0ff382193c998", + "size": 1600269, + "uuid": "ef0dbdf9-5adf-4503-b48b-c59cf84f30f4", + "version": "2019-04-03T105632.536420Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "553155b3", + "indexed": false, + "name": "primary_image-fov_000-Z6-H1-C3.tiff", + "s3_etag": "0e1a664c446d81fb18223b4149e8b2ac", + "sha1": "7fe65a76887149fb1f50c86f27859d689311674b", + "sha256": "c5d5c84a9c0efd4abf05b4dd557dae8cafe485608a1b62f3d565d772fd1158fc", + "size": 1600269, + "uuid": "4ad6424c-538b-4387-b54a-70aaac5e0a01", + "version": "2019-04-03T105632.798766Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f4752a9d", + "indexed": false, + "name": "primary_image-fov_000-Z6-H2-C0.tiff", + "s3_etag": "168337b82e797db619902e906292bb14", + "sha1": "efedb0f65e78da53fc026c6275b60695e30987de", + "sha256": "37e84417d3876f66a9d669d401977fe0efd36d538b95047daa57ae3d88773593", + "size": 1600269, + "uuid": "e54926ec-cfc5-4a80-952a-961a98d01264", + "version": "2019-04-03T105633.035247Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "62f80682", + "indexed": false, + "name": "primary_image-fov_000-Z6-H2-C1.tiff", + "s3_etag": "b280fa6859fd8571e68682c0d3d6f181", + "sha1": "0c70628b53eaeb6d425583bce2f98b085bace46a", + "sha256": "72f7df5e3c5965bd88315189329887ba47bf8d51e3f9464646e5faebdab1b1a7", + "size": 1600269, + "uuid": "1a98673d-9d2d-4083-a0d5-b128c5d267de", + "version": "2019-04-03T105633.297846Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "978bc625", + "indexed": false, + "name": "primary_image-fov_000-Z6-H2-C2.tiff", + "s3_etag": "d87a672aaa65722044eec823981cbaf5", + "sha1": "f90814c037f00b4d41efed7d9e1f2e00efd69205", + "sha256": "49b58722e29ddd4a2468439e672dccc23e171f283232e13f98ca5f1475f618eb", + "size": 1600269, + "uuid": "a9477ea9-35a8-449c-a157-4ec3b9057989", + "version": "2019-04-03T105633.619365Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ed432bf7", + "indexed": false, + "name": "primary_image-fov_000-Z6-H2-C3.tiff", + "s3_etag": "440b9064ae05440988d3ffad8e9b629d", + "sha1": "e9463d9b903587304016899a06170eb7323cd381", + "sha256": "bba29e16735e9620268b88bc2db40d656771c3b30948489e84add2bda58ce0a5", + "size": 1600269, + "uuid": "ca573914-fead-42c2-acc3-3a9536d720a4", + "version": "2019-04-03T105634.196322Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "7f1c78ad", + "indexed": false, + "name": "primary_image-fov_000-Z7-H0-C0.tiff", + "s3_etag": "cb0c4a925ce2e8464672ad3053ddae1c", + "sha1": "1210c56cddbb77d129a2e3bdbb6ad45ea318c191", + "sha256": "6e044a88160ce6f2480840525804b5fc7f115f3d787e15594ae2b9d3d635a354", + "size": 1600269, + "uuid": "03e3dcc3-d45a-4c83-bc0b-817e563e19a9", + "version": "2019-04-03T105634.597173Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "f5f7ed24", + "indexed": false, + "name": "primary_image-fov_000-Z7-H0-C1.tiff", + "s3_etag": "1b2683b7a2ee7678f79731c3cc75690d", + "sha1": "86964dff4fdc8cf47e6a873b3baab70e4d933718", + "sha256": "9efe951da0f64c505dabcd815234e3960626ebc09bcbb31c26ae9885fd573892", + "size": 1600269, + "uuid": "202940df-87ab-4deb-9ee3-565408ba1316", + "version": "2019-04-03T105634.889498Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5cd6ee04", + "indexed": false, + "name": "primary_image-fov_000-Z7-H0-C2.tiff", + "s3_etag": "e196eb320d1fdb6cb9924932fcd91e6a", + "sha1": "bbef2157f75133fa93b1da4c130fb4c25384502b", + "sha256": "e9435a040e8d6a92506516e18edbf5017effc9e5d60358f0bf91fa7c9ad4a094", + "size": 1600269, + "uuid": "3a044d9b-72cf-4c00-a331-b920f8bbef8f", + "version": "2019-04-03T105635.152162Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "217ea5dd", + "indexed": false, + "name": "primary_image-fov_000-Z7-H0-C3.tiff", + "s3_etag": "a908d34dbf74e09c25de5b9f7273ff21", + "sha1": "6919b4ef62136cf8056f10c9035eaf34350be210", + "sha256": "bc27ec72db5a5da93908b49865f479cafdd06e54a5ea02145cf5fc437bcf8c1e", + "size": 1600269, + "uuid": "9ca4cd36-67c4-4a19-9e65-82b70a73f820", + "version": "2019-04-03T105635.416620Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "be84f068", + "indexed": false, + "name": "primary_image-fov_000-Z7-H1-C0.tiff", + "s3_etag": "a0ea29c8f6b4ed700405d0b7b9f25508", + "sha1": "74769dc49f9243e25fe628f7761cd68d943c0a52", + "sha256": "d4700ed483bb7a10c940c309765d07f28e25897d67d9890636a0ed9a9b89ea11", + "size": 1600269, + "uuid": "62d38039-7672-472b-8847-c63bf52bfb6e", + "version": "2019-04-03T105635.669528Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "bf3a8200", + "indexed": false, + "name": "primary_image-fov_000-Z7-H1-C1.tiff", + "s3_etag": "72c4457ab957a85df4a9115a34f109dd", + "sha1": "5c44bb630300766ff7b359d96dbec03f4db98b5c", + "sha256": "a112cd97673c1085b02fe6a9efb24f643ee42cc12a5e6d226aac67531451ec1d", + "size": 1600269, + "uuid": "c0fe4ea4-1562-4402-80fb-78cec6415fb6", + "version": "2019-04-03T105636.216303Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "177eb23a", + "indexed": false, + "name": "primary_image-fov_000-Z7-H1-C2.tiff", + "s3_etag": "bba07940f0a5aaa5957f81c9e0065e61", + "sha1": "3db85d8e823b23f1aa680053951e9c33ff485aa7", + "sha256": "552e403f54a98bb55ff0803f6b58ad6270ac38b7a39d1a0763bb2120b0b92985", + "size": 1600269, + "uuid": "92351261-9885-477b-8d2a-227901e6ffc7", + "version": "2019-04-03T105636.729218Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "0c632a10", + "indexed": false, + "name": "primary_image-fov_000-Z7-H1-C3.tiff", + "s3_etag": "d3179c0a7294de7f691d8c7db3666e3e", + "sha1": "7c3d00508196f32958021c50778fb38a6082d357", + "sha256": "e3dc5487b384395b8f935206ed5b6a95afd4cc6e3c4815bf9483ed47c156a1b9", + "size": 1600269, + "uuid": "bdf53fbd-fb66-456a-976c-d97414d1ab3b", + "version": "2019-04-03T105637.056125Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "aa061cbb", + "indexed": false, + "name": "primary_image-fov_000-Z7-H2-C0.tiff", + "s3_etag": "b3dbbd62b9b385661d35955aae4b9513", + "sha1": "5aace9b7444f82c5b3640fc9ed2a79b1a9e12e27", + "sha256": "3d7b47e0d89808e906e6fa93b41cddafa38a3b2886441a8bcda381f0f44d06e4", + "size": 1600269, + "uuid": "f76cf7a7-8ae0-4cc2-8c49-497d8eeb4bd5", + "version": "2019-04-03T105637.312587Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1321fee4", + "indexed": false, + "name": "primary_image-fov_000-Z7-H2-C1.tiff", + "s3_etag": "dc1eadd4622eeba183ce61f908d093da", + "sha1": "1b1f67ce1f6db8cc0249b9f499734d01b9dc9519", + "sha256": "a62a5092a92c76327e49883c2652e3ebaea9953c2a48afca5c165a47b10e4f90", + "size": 1600269, + "uuid": "ccdd0669-ecf0-42d0-9eed-e6f32f4e2137", + "version": "2019-04-03T105637.562208Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "65556d46", + "indexed": false, + "name": "primary_image-fov_000-Z7-H2-C2.tiff", + "s3_etag": "29efa087a59c0d3e0a180290bea0bf7b", + "sha1": "f7f4cd42d06294f61ad5fef654a0406618b95f49", + "sha256": "fcefebbbbb13678824196b57eecdf5a290d936dc8809f8fbc1ccdd29d1b96e18", + "size": 1600269, + "uuid": "599e9909-55d0-4d43-bef2-c94997a9b5ed", + "version": "2019-04-03T105637.875619Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3193e54b", + "indexed": false, + "name": "primary_image-fov_000-Z7-H2-C3.tiff", + "s3_etag": "08175c1691b34c11dc647d01d1c3065f", + "sha1": "813943f84b4375657844bef235fdb2ddc6e1b830", + "sha256": "3a277e268ebdbd068dc4513ba21820455b81ba7c06a0172210a91706ddddf8c4", + "size": 1600269, + "uuid": "b6642034-460c-4628-8995-959aed6daf4c", + "version": "2019-04-03T105638.140553Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b20225fc", + "indexed": false, + "name": "primary_image-fov_000-Z8-H0-C0.tiff", + "s3_etag": "d82f9b12e1c2ae0df138faa1ea08d33f", + "sha1": "174399a0891dfebe57176fb5852103fa69513ea0", + "sha256": "9788637a05eb6abaf9202ce9f80219686edb82669af2d5f53bee50b35f430126", + "size": 1600269, + "uuid": "43a3a428-155b-4174-b22e-8fa69be8d792", + "version": "2019-04-03T105638.472919Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "592b9781", + "indexed": false, + "name": "primary_image-fov_000-Z8-H0-C1.tiff", + "s3_etag": "bc52bd93291f0673d856257761ea8252", + "sha1": "2d734ec0a0cf384feb7de9d08b984da7b41fc24f", + "sha256": "7dc04a42f36d4535311bccefc01ac3c3993c52cd9fd900f556cf943705ed0e88", + "size": 1600269, + "uuid": "12b0c950-9687-4b28-979c-6b370ace1cd3", + "version": "2019-04-03T105638.747128Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "22ecfc52", + "indexed": false, + "name": "primary_image-fov_000-Z8-H0-C2.tiff", + "s3_etag": "e1af122e50eea65daa022f8571517bfd", + "sha1": "0c0b67437f1e48770ddc9002c09d5e281bc97d1e", + "sha256": "39c47edd52b1c74758d90dbc21977a9fda7ae4de554cb9238e7bf0903b8fdea2", + "size": 1600269, + "uuid": "d0d46791-b50d-4622-a375-300d35ef1ba4", + "version": "2019-04-03T105638.999068Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2b09e4ff", + "indexed": false, + "name": "primary_image-fov_000-Z8-H0-C3.tiff", + "s3_etag": "ccfc7c9f94dd6e47d59c20e2e76d0f16", + "sha1": "1b5c3493b162347b528a4f0e22a9879e4c7d766a", + "sha256": "5c86130e5dc26548c71301779426353401667b0b373fd5b2fa0886d8ecb54328", + "size": 1600269, + "uuid": "6cfbdd29-5799-40c9-9329-917cfe98fb3a", + "version": "2019-04-03T105639.334527Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "42e96812", + "indexed": false, + "name": "primary_image-fov_000-Z8-H1-C0.tiff", + "s3_etag": "60febe6a957ecea63058bfb412e570a5", + "sha1": "94a507aa40e4b3f93f17ad8d15d9e4780571a914", + "sha256": "56a67c43ffb995edaa30ce0ce151f0df38ea08827d93c1e57b902bebe78e1cc7", + "size": 1600269, + "uuid": "c665c520-397f-4410-abed-1cd9e23fe942", + "version": "2019-04-03T105639.905452Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b18acdbe", + "indexed": false, + "name": "primary_image-fov_000-Z8-H1-C1.tiff", + "s3_etag": "09f753ef93d7ae051a784a327cc79e95", + "sha1": "ae87ab3d3d51095ea4cc74dda5475b47d344875b", + "sha256": "49f068eaae48dbfa68b9f63876e10fa94a613115a7285dd0fad6ee7438d1624e", + "size": 1600269, + "uuid": "fdac5e58-f0bb-40b1-9a58-b49f43bc4238", + "version": "2019-04-03T105640.178722Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "af59c8a5", + "indexed": false, + "name": "primary_image-fov_000-Z8-H1-C2.tiff", + "s3_etag": "3ae21db88d4c1d098bcf3354adc846f2", + "sha1": "801f806cd3df94b5d4038b4441a8854e065682ba", + "sha256": "b16291cd500218be60bc2069d6e58dbe4f81cabb070f130aedb7ab04612a2465", + "size": 1600269, + "uuid": "bf5e1454-492c-4748-811b-b8ef68548d79", + "version": "2019-04-03T105640.476175Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "c323197b", + "indexed": false, + "name": "primary_image-fov_000-Z8-H1-C3.tiff", + "s3_etag": "75d5ca11e181f3120f46ac2c12be6d5f", + "sha1": "c53ecb067ac777473317f7e19440495bfdc305ab", + "sha256": "ae4b6948a3008f08f364741085ad1cec433765c359e69736fc4097557d43edc7", + "size": 1600269, + "uuid": "37a2c628-29f7-4845-ace9-62ed637c7c74", + "version": "2019-04-03T105640.730992Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "e7e994f8", + "indexed": false, + "name": "primary_image-fov_000-Z8-H2-C0.tiff", + "s3_etag": "3da7df800a70d2d6e8726bcc76b3b24e", + "sha1": "9ee95d06a5b17fd363fce5c4fed6e8fbb0f05258", + "sha256": "25aede1f80b6e87f0333cd85db66008ef1034eda88ca645fc15a4d0a6b00f675", + "size": 1600269, + "uuid": "1e18aaa0-df92-4bab-81dc-7e225e2c8a09", + "version": "2019-04-03T105641.356591Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "e62e1b96", + "indexed": false, + "name": "primary_image-fov_000-Z8-H2-C1.tiff", + "s3_etag": "ab7076ebad2e8ab1fe3a2ba36c9d4a05", + "sha1": "5f72db56bea0fbfe4060b03644c49ae514013a01", + "sha256": "f61291d855a579b62e4b92f6119c8682c2784bb5e60cddf3ddc016b1bf9c2543", + "size": 1600269, + "uuid": "682e7e32-5795-4fc3-ad31-5c5f5e737c55", + "version": "2019-04-03T105641.597762Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "eb94ca22", + "indexed": false, + "name": "primary_image-fov_000-Z8-H2-C2.tiff", + "s3_etag": "b19708d148c785414fd0f61e7fd497d0", + "sha1": "80e40c2765dbcd3874274020fed22714a4675a38", + "sha256": "745c2423dd6f6a0c53b0be8b4d3f01fa4f52e09e499fb3400885ebe61562eb59", + "size": 1600269, + "uuid": "3b5bde9d-8af7-4253-9013-61bc6917eac4", + "version": "2019-04-03T105642.155558Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "30148627", + "indexed": false, + "name": "primary_image-fov_000-Z8-H2-C3.tiff", + "s3_etag": "8d555490d25c9b375e1f798726f75c8e", + "sha1": "c97a2af4b2500b157661443dbde450170b7be1de", + "sha256": "887cc80db875bf5d704c18bea2ecde0e311f94a1db43e96ad2b71fbae2228ba5", + "size": 1600269, + "uuid": "e6f193a6-c235-4357-b1c8-bd075e0be111", + "version": "2019-04-03T105642.455372Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "01ece1c6", + "indexed": false, + "name": "primary_image-fov_000-Z9-H0-C0.tiff", + "s3_etag": "0ad31b3db47ab0cc64feab103cd95c06", + "sha1": "1011cca6dff2b136733eaa0fc9ed427dbcbd724f", + "sha256": "33afd30928b802f9b37e1761eea55b04aa17d9c246bbf015174fc46e6ffbbc6d", + "size": 1600269, + "uuid": "33b9e890-93dd-46bf-a464-0b293605ca13", + "version": "2019-04-03T105642.695635Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "3a56f81e", + "indexed": false, + "name": "primary_image-fov_000-Z9-H0-C1.tiff", + "s3_etag": "6463c0af4aad289aa06ab596accd7f72", + "sha1": "0e55731c16adc0a5423f2476793d2c423b1deb6a", + "sha256": "5337ba319da091c05651d7da158e1cd3719f9befb1f2f6db1344338e0ac70449", + "size": 1600269, + "uuid": "1a57ba61-0aaa-4a98-8714-44ef51295163", + "version": "2019-04-03T105642.933998Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "4f573958", + "indexed": false, + "name": "primary_image-fov_000-Z9-H0-C2.tiff", + "s3_etag": "662e5f08087f7cc4ee6454f6ed734c66", + "sha1": "96feb27dc74eb05d307d6d5f8a66826962cb037b", + "sha256": "8e7b543d6baf164527bb6ec8b391acd79cd52d61a88ecba8b72db31ade03ff95", + "size": 1600269, + "uuid": "e1a484a8-5557-440d-8196-38a39c8acc3e", + "version": "2019-04-03T105643.266340Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "5fd73b1d", + "indexed": false, + "name": "primary_image-fov_000-Z9-H0-C3.tiff", + "s3_etag": "b89d1752986854195217fda6c5f7c246", + "sha1": "f0b6ea2f3b8c3f166db793d6f02498041141a527", + "sha256": "3a328ccdc6f19fa663c1e703efe15cb80fd8f5c260eb679ac64222aead8fa19c", + "size": 1600269, + "uuid": "4a836a20-3f30-4e33-8374-c9837de94790", + "version": "2019-04-03T105643.598363Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "2335b62b", + "indexed": false, + "name": "primary_image-fov_000-Z9-H1-C0.tiff", + "s3_etag": "a45f76cccdd8e3688c03f9afb3a48e42", + "sha1": "5acfa2d86b69216cb8b25dd5e0ff44e2353a7a2a", + "sha256": "89c07cd8d4d7a47f7d7c85c4e9918e937b9dd248275c3597b520bb29685fd275", + "size": 1600269, + "uuid": "fa8e2052-2f21-420b-84bb-dee4e2ce79ab", + "version": "2019-04-03T105643.915023Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "61289ac4", + "indexed": false, + "name": "primary_image-fov_000-Z9-H1-C1.tiff", + "s3_etag": "859abbee84741bc542fd3c1916e6c76f", + "sha1": "e0a1535468297319590ac1edea0f9f17b1fcbbc3", + "sha256": "3f15a6b5d60834705355dfe79c38f4a8cae0a1fcaf3dbf61bdd2be8eeadf213b", + "size": 1600269, + "uuid": "c605b91e-3b62-442d-bd3e-2d58a213a4bf", + "version": "2019-04-03T105644.156708Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "081bc6e9", + "indexed": false, + "name": "primary_image-fov_000-Z9-H1-C2.tiff", + "s3_etag": "154e0e39f4e0598830e28c466f606604", + "sha1": "095bcb4c03fd228f69c2cff4e55d75a55f3de86a", + "sha256": "ceb0e9ae90e00e9fe53a63807eac2bb319974203ac92a4ca7ebd9c3287de2284", + "size": 1600269, + "uuid": "d6621482-70a1-42ac-895d-8398aa0bb2b7", + "version": "2019-04-03T105644.436640Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "b65a523e", + "indexed": false, + "name": "primary_image-fov_000-Z9-H1-C3.tiff", + "s3_etag": "44e91c2235e2933c382881c9260e729e", + "sha1": "98be3ab0b504f834c06b8cff450da4d2f27ddb93", + "sha256": "4a722651fc388de26b1dbfcffa7be65c448b26a31d1738e5363857dfea81ea61", + "size": 1600269, + "uuid": "1d051231-9ed8-44fd-8086-93da3a04dd0b", + "version": "2019-04-03T105644.954210Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "6e9add20", + "indexed": false, + "name": "primary_image-fov_000-Z9-H2-C0.tiff", + "s3_etag": "89384b0fb6345d99cb41c07570b88ac9", + "sha1": "27cc8de22a7967083534b80d11537d38e1adfb2a", + "sha256": "d19fd3d6fececce2aaa3877f38d1c775f76419ec07374b7cff010b9867a12854", + "size": 1600269, + "uuid": "bba231df-4b9b-44fe-a9e9-df314fc8f75d", + "version": "2019-04-03T105645.222571Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "bd266ca9", + "indexed": false, + "name": "primary_image-fov_000-Z9-H2-C1.tiff", + "s3_etag": "59d0ae52331b02c2ad8c8868f7ef97c8", + "sha1": "931b276a47bc715902e1a06f3ed7a264756b1e62", + "sha256": "e1144263f89f3b3b2c4812ca0599274d78057636dcca1d09fdebc30e0d327ced", + "size": 1600269, + "uuid": "6c85c7e1-832c-476c-add9-e2cc509f8de0", + "version": "2019-04-03T105645.515825Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "1285ec2c", + "indexed": false, + "name": "primary_image-fov_000-Z9-H2-C2.tiff", + "s3_etag": "9952c98d3f77cce10a633a2b7af2ad10", + "sha1": "d88ae8998890e877ff4bcb7d9c901ebf6c0f87fa", + "sha256": "b66e916f703c1bccfccb6ad7fcc95fb3af42ac4e6868bbdcea424de9e40a12af", + "size": 1600269, + "uuid": "9a71aa79-aa5e-41ca-89ed-2d5eaea98840", + "version": "2019-04-03T105645.832519Z" + }, + { + "content-type": "image/tiff; dcp-type=data", + "crc32c": "ee12e15f", + "indexed": false, + "name": "primary_image-fov_000-Z9-H2-C3.tiff", + "s3_etag": "34fa837a2fb39db2dddfabd84e6a560d", + "sha1": "e0ff15a11a35119aae3feb4e2afb3a0708daa28f", + "sha256": "9f447baf510beb7f942054f980818c6819a12bf9b12e5cadc2cff30af37d9674", + "size": 1600269, + "uuid": "bec2697f-31b6-4db5-888a-024379f3d13f", + "version": "2019-04-03T105646.096587Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "d148a0e3", + "indexed": false, + "name": "primary_image-fov_000.json", + "s3_etag": "c9bae9cb31bf1356ad858eba63ca3cb8", + "sha1": "bf49d7043b7e4c528a3ec7fdd1d80a49913125b6", + "sha256": "b7d0787c0f9b656331d4e56c4249dc2762ae8bd04f87995910e5ce3c30cde8d2", + "size": 55640, + "uuid": "194db0d1-dfca-44d7-9ad7-194a9e091d32", + "version": "2019-04-03T105646.365296Z" + }, + { + "content-type": "application/json; dcp-type=data", + "crc32c": "3c1c81b7", + "indexed": false, + "name": "primary_image.json", + "s3_etag": "512105655a1319dc48a63ce1b6034d61", + "sha1": "d623f185225a0edd5334fde5eba07204bf9891dd", + "sha256": "23e8dbd4385ec7be7ce90ba0fdcd00f5357735e8dc77538caa993506e0ce0307", + "size": 119, + "uuid": "57e036f8-063a-47fe-b668-499222390e95", + "version": "2019-04-03T105646.657106Z" + } + ], + "metadata": { + "imaged_specimen_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/2.0.7/imaged_specimen", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "420508-10-1", + "biomaterial_name": "420508 coronal sections slice 10-1", + "biomaterial_description": "mouse brain coronal section 20um", + "ncbi_taxon_id": [ + 10090 + ], + "supplementary_files": [ + "point1nissl10x.tar.gz" + ] + }, + "slice_thickness": 20.0, + "internal_anatomical_structures": [ + { + "text": "V1, Provided files are Neurotrace stain and DIC images of the half brain slice imaged at 10x" + } + ], + "provenance": { + "document_id": "87f58f88-ef8b-4323-bd19-cde1a2497b59", + "submission_date": "2019-04-03T10:13:40.000Z", + "update_date": "2019-04-03T10:13:50.866Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/9.0.0/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "420508_specimen", + "biomaterial_name": "fresh frozen brain", + "ncbi_taxon_id": [ + 10090 + ], + "genotype": "wt" + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090", + "ontology_label": "Mus musculus" + } + ], + "organ": { + "text": "brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "preservation_storage": { + "storage_method": "fresh", + "preservation_method": "fresh" + }, + "collection_time": "2018-09-18T10:00:00Z", + "provenance": { + "document_id": "edd1d525-a6ae-4658-a6bf-6c31d7ab6948", + "submission_date": "2019-04-03T10:13:39.992Z", + "update_date": "2019-04-03T10:13:45.512Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/14.0.7/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "420508", + "biomaterial_name": "C57BL6J-420508", + "ncbi_taxon_id": [ + 10090 + ], + "genotype": "wt" + }, + "mouse_specific": { + "strain": [ + { + "text": "C57BL6J", + "ontology": "EFO:0000606", + "ontology_label": "C57BL/6J" + } + ] + }, + "death": { + "cause_of_death": "euthanasia under anesthesia", + "cold_perfused": false, + "days_on_ventilator": 0.0, + "hardy_scale": 1, + "time_of_death": "2018-09-18T10:00:00Z" + }, + "genus_species": [ + { + "text": "Mus musculus", + "ontology": "NCBITaxon:10090", + "ontology_label": "Mus musculus" + } + ], + "organism_age": "56", + "organism_age_unit": { + "text": "days", + "ontology": "UO:0000033", + "ontology_label": "day" + }, + "development_stage": { + "text": "adult", + "ontology": "EFO:0001272", + "ontology_label": "adult" + }, + "is_living": "no", + "sex": "male", + "provenance": { + "document_id": "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4", + "submission_date": "2019-04-03T10:13:39.984Z", + "update_date": "2019-04-03T10:13:45.427Z" + } + }, + "image_file_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "codebook.json", + "file_format": "json" + }, + "provenance": { + "document_id": "6baa3aff-b2a5-4e49-82f7-25c108a6107a", + "submission_date": "2019-04-03T10:13:40.056Z", + "update_date": "2019-04-03T10:15:44.995Z" + } + }, + "image_file_1.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "experiment.json", + "file_format": "json" + }, + "provenance": { + "document_id": "06dcfc33-21da-485f-8e50-49d294713a9e", + "submission_date": "2019-04-03T10:13:40.066Z", + "update_date": "2019-04-03T10:15:44.993Z" + } + }, + "image_file_2.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z0-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", + "submission_date": "2019-04-03T10:13:40.076Z", + "update_date": "2019-04-03T10:15:51.032Z" + } + }, + "image_file_3.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z1-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", + "submission_date": "2019-04-03T10:13:40.085Z", + "update_date": "2019-04-03T10:15:47.812Z" + } + }, + "image_file_4.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z10-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "76e52f76-ede7-4088-b7f6-d6e5f6152292", + "submission_date": "2019-04-03T10:13:40.093Z", + "update_date": "2019-04-03T10:15:51.115Z" + } + }, + "image_file_5.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z11-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", + "submission_date": "2019-04-03T10:13:40.102Z", + "update_date": "2019-04-03T10:15:54.073Z" + } + }, + "image_file_6.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z12-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "be66141d-84a3-457d-a8d2-2f0da8c91dff", + "submission_date": "2019-04-03T10:13:40.111Z", + "update_date": "2019-04-03T10:15:51.125Z" + } + }, + "image_file_7.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z13-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "680cf532-ef0c-4155-b44d-a6ec3920743a", + "submission_date": "2019-04-03T10:13:40.120Z", + "update_date": "2019-04-03T10:15:50.982Z" + } + }, + "image_file_8.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z14-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "08609f14-cf43-4188-b743-4a0b55b17347", + "submission_date": "2019-04-03T10:13:40.128Z", + "update_date": "2019-04-03T10:15:47.817Z" + } + }, + "image_file_9.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z15-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "d10827a1-38f7-457d-9c9f-695f2fc7689c", + "submission_date": "2019-04-03T10:13:40.137Z", + "update_date": "2019-04-03T10:15:44.996Z" + } + }, + "image_file_10.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z16-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6f8eb2e5-7a0c-4c98-8da0-276457357071", + "submission_date": "2019-04-03T10:13:40.145Z", + "update_date": "2019-04-03T10:15:47.821Z" + } + }, + "image_file_11.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z2-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ca480df3-71bb-4634-8f71-b6a75aeb9f05", + "submission_date": "2019-04-03T10:13:40.154Z", + "update_date": "2019-04-03T10:15:47.796Z" + } + }, + "image_file_12.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z3-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "03ae5f5e-65ac-4491-b0ce-eefc940e0224", + "submission_date": "2019-04-03T10:13:40.166Z", + "update_date": "2019-04-03T10:15:48.018Z" + } + }, + "image_file_13.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z4-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", + "submission_date": "2019-04-03T10:13:40.176Z", + "update_date": "2019-04-03T10:15:51.040Z" + } + }, + "image_file_14.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z5-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "887f3d73-94d2-44ac-9047-67aca5225882", + "submission_date": "2019-04-03T10:13:40.186Z", + "update_date": "2019-04-03T10:15:51.029Z" + } + }, + "image_file_15.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z6-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "896dfacd-206b-4e4f-a846-ba5b070060d9", + "submission_date": "2019-04-03T10:13:40.197Z", + "update_date": "2019-04-03T10:15:47.819Z" + } + }, + "image_file_16.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z7-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "23303c88-01b1-47d0-b770-dca6802caa13", + "submission_date": "2019-04-03T10:13:40.207Z", + "update_date": "2019-04-03T10:15:47.812Z" + } + }, + "image_file_17.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z8-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3c1a388d-0577-4417-9cd2-ff33bfed9140", + "submission_date": "2019-04-03T10:13:40.217Z", + "update_date": "2019-04-03T10:15:47.821Z" + } + }, + "image_file_18.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000-Z9-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "67e71b34-7157-4a37-b495-0d740772b480", + "submission_date": "2019-04-03T10:13:40.227Z", + "update_date": "2019-04-03T10:15:51.111Z" + } + }, + "image_file_19.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei-fov_000.json", + "file_format": "json" + }, + "provenance": { + "document_id": "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", + "submission_date": "2019-04-03T10:13:40.236Z", + "update_date": "2019-04-03T10:15:51.054Z" + } + }, + "image_file_20.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "nuclei.json", + "file_format": "json" + }, + "provenance": { + "document_id": "5fbcb75e-3ee3-4429-8ede-b243afa0789f", + "submission_date": "2019-04-03T10:13:40.246Z", + "update_date": "2019-04-03T10:15:51.028Z" + } + }, + "image_file_21.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "09226b24-6b11-4e4f-8052-2b544be461aa", + "submission_date": "2019-04-03T10:13:40.256Z", + "update_date": "2019-04-03T10:15:51.126Z" + } + }, + "image_file_22.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f67473fd-fbf8-4d69-9db1-556938ab5b87", + "submission_date": "2019-04-03T10:13:40.266Z", + "update_date": "2019-04-03T10:15:54.317Z" + } + }, + "image_file_23.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", + "submission_date": "2019-04-03T10:13:40.276Z", + "update_date": "2019-04-03T10:15:50.940Z" + } + }, + "image_file_24.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "017a2c88-4f6e-418e-bb96-f42f3a220f87", + "submission_date": "2019-04-03T10:13:40.286Z", + "update_date": "2019-04-03T10:15:50.977Z" + } + }, + "image_file_25.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "30305240-004d-4632-84d4-37d7e7378782", + "submission_date": "2019-04-03T10:13:40.296Z", + "update_date": "2019-04-03T10:15:51.136Z" + } + }, + "image_file_26.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", + "submission_date": "2019-04-03T10:13:40.306Z", + "update_date": "2019-04-03T10:15:51.052Z" + } + }, + "image_file_27.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3fd2781b-6855-4eaa-b2fb-81db386adb18", + "submission_date": "2019-04-03T10:13:40.315Z", + "update_date": "2019-04-03T10:15:51.027Z" + } + }, + "image_file_28.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "40474d53-44a4-4ab2-9f20-61b71291f8aa", + "submission_date": "2019-04-03T10:13:40.325Z", + "update_date": "2019-04-03T10:15:47.810Z" + } + }, + "image_file_29.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "aaa97d47-7124-4763-a3fc-f6d66eb6d990", + "submission_date": "2019-04-03T10:13:40.334Z", + "update_date": "2019-04-03T10:15:50.958Z" + } + }, + "image_file_30.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "4adbed13-1cb6-4405-b892-fe8165050691", + "submission_date": "2019-04-03T10:13:40.344Z", + "update_date": "2019-04-03T10:15:51.040Z" + } + }, + "image_file_31.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", + "submission_date": "2019-04-03T10:13:40.354Z", + "update_date": "2019-04-03T10:15:51.020Z" + } + }, + "image_file_32.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z0-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "5402916f-6de1-4842-8585-fc25c153992b", + "submission_date": "2019-04-03T10:13:40.364Z", + "update_date": "2019-04-03T10:15:51.039Z" + } + }, + "image_file_33.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", + "submission_date": "2019-04-03T10:13:40.375Z", + "update_date": "2019-04-03T10:16:00.740Z" + } + }, + "image_file_34.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", + "submission_date": "2019-04-03T10:13:40.386Z", + "update_date": "2019-04-03T10:16:00.295Z" + } + }, + "image_file_35.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cb92dd92-570c-4075-8893-eb19dbd837b8", + "submission_date": "2019-04-03T10:13:40.396Z", + "update_date": "2019-04-03T10:16:00.289Z" + } + }, + "image_file_36.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b36948c4-0646-42be-9db2-16626a757343", + "submission_date": "2019-04-03T10:13:40.405Z", + "update_date": "2019-04-03T10:15:57.643Z" + } + }, + "image_file_37.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c974f4eb-27b8-4ec3-913e-a6eb19572a51", + "submission_date": "2019-04-03T10:13:40.414Z", + "update_date": "2019-04-03T10:15:57.265Z" + } + }, + "image_file_38.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "febb760d-1e9e-4432-9b88-ce2869a43c44", + "submission_date": "2019-04-03T10:13:40.423Z", + "update_date": "2019-04-03T10:16:03.118Z" + } + }, + "image_file_39.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "054f40a4-68d0-41db-81e9-00239042d9fa", + "submission_date": "2019-04-03T10:13:40.432Z", + "update_date": "2019-04-03T10:15:54.056Z" + } + }, + "image_file_40.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", + "submission_date": "2019-04-03T10:13:40.441Z", + "update_date": "2019-04-03T10:15:57.262Z" + } + }, + "image_file_41.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "819e3227-cc54-4919-95af-c1f8194bf729", + "submission_date": "2019-04-03T10:13:40.450Z", + "update_date": "2019-04-03T10:16:00.245Z" + } + }, + "image_file_42.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b1e2b9d1-6973-41dc-acdf-95474303561f", + "submission_date": "2019-04-03T10:13:40.458Z", + "update_date": "2019-04-03T10:16:00.392Z" + } + }, + "image_file_43.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "41ffc783-5ad4-4197-8fd1-c029903c43c0", + "submission_date": "2019-04-03T10:13:40.467Z", + "update_date": "2019-04-03T10:16:00.242Z" + } + }, + "image_file_44.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z1-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", + "submission_date": "2019-04-03T10:13:40.475Z", + "update_date": "2019-04-03T10:15:54.163Z" + } + }, + "image_file_45.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9014bbaf-a047-4b69-8e28-8356cc99f84e", + "submission_date": "2019-04-03T10:13:40.484Z", + "update_date": "2019-04-03T10:15:54.097Z" + } + }, + "image_file_46.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f7acf90c-2b32-463b-b832-8daa8529f727", + "submission_date": "2019-04-03T10:13:40.492Z", + "update_date": "2019-04-03T10:15:51.110Z" + } + }, + "image_file_47.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", + "submission_date": "2019-04-03T10:13:40.501Z", + "update_date": "2019-04-03T10:15:54.068Z" + } + }, + "image_file_48.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "db22deab-498a-409c-8386-5bf4e60a080c", + "submission_date": "2019-04-03T10:13:40.509Z", + "update_date": "2019-04-03T10:15:54.171Z" + } + }, + "image_file_49.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "07d600bc-0d55-4a8d-9a48-390fc4169845", + "submission_date": "2019-04-03T10:13:40.518Z", + "update_date": "2019-04-03T10:15:54.155Z" + } + }, + "image_file_50.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "d0a032bb-cd0e-4873-b346-5cb19e45c202", + "submission_date": "2019-04-03T10:13:40.526Z", + "update_date": "2019-04-03T10:15:54.147Z" + } + }, + "image_file_51.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a161f60f-af92-4b09-9df0-dd7ff2bf571a", + "submission_date": "2019-04-03T10:13:40.536Z", + "update_date": "2019-04-03T10:15:54.146Z" + } + }, + "image_file_52.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", + "submission_date": "2019-04-03T10:13:40.545Z", + "update_date": "2019-04-03T10:15:57.073Z" + } + }, + "image_file_53.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f10fd9e2-5747-4d7a-8c0c-beba81749011", + "submission_date": "2019-04-03T10:13:40.553Z", + "update_date": "2019-04-03T10:15:54.011Z" + } + }, + "image_file_54.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "553b6aab-4745-45f8-98ab-de6aadbf48e4", + "submission_date": "2019-04-03T10:13:40.562Z", + "update_date": "2019-04-03T10:15:54.255Z" + } + }, + "image_file_55.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3572abe9-6e42-4266-8671-ff24b592065c", + "submission_date": "2019-04-03T10:13:40.571Z", + "update_date": "2019-04-03T10:15:54.233Z" + } + }, + "image_file_56.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z10-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6882abf6-c247-4167-a18d-e3fec24bcba2", + "submission_date": "2019-04-03T10:13:40.579Z", + "update_date": "2019-04-03T10:15:54.124Z" + } + }, + "image_file_57.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "15f8b73e-937c-444d-8362-fdf458abb651", + "submission_date": "2019-04-03T10:13:40.588Z", + "update_date": "2019-04-03T10:15:54.117Z" + } + }, + "image_file_58.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "33b4e374-20ad-4fee-b682-aaa4fc12bec2", + "submission_date": "2019-04-03T10:13:40.596Z", + "update_date": "2019-04-03T10:15:54.178Z" + } + }, + "image_file_59.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "0e83c507-2211-4561-b75a-92326fb2d4fd", + "submission_date": "2019-04-03T10:13:40.605Z", + "update_date": "2019-04-03T10:15:54.229Z" + } + }, + "image_file_60.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "912c55cf-0774-4838-8874-352766984715", + "submission_date": "2019-04-03T10:13:40.613Z", + "update_date": "2019-04-03T10:15:54.213Z" + } + }, + "image_file_61.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", + "submission_date": "2019-04-03T10:13:40.622Z", + "update_date": "2019-04-03T10:15:50.981Z" + } + }, + "image_file_62.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "5b8e3d96-e625-46b6-9689-110fa84fd721", + "submission_date": "2019-04-03T10:13:40.630Z", + "update_date": "2019-04-03T10:15:54.097Z" + } + }, + "image_file_63.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", + "submission_date": "2019-04-03T10:13:40.639Z", + "update_date": "2019-04-03T10:15:57.225Z" + } + }, + "image_file_64.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6f3272d7-4a62-4a3c-8c44-11dda8756956", + "submission_date": "2019-04-03T10:13:40.647Z", + "update_date": "2019-04-03T10:15:53.957Z" + } + }, + "image_file_65.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "168422c5-e89d-466c-9085-f29c02160143", + "submission_date": "2019-04-03T10:13:40.656Z", + "update_date": "2019-04-03T10:15:54.119Z" + } + }, + "image_file_66.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7331367a-cc43-4af0-8750-a2921d513f97", + "submission_date": "2019-04-03T10:13:40.664Z", + "update_date": "2019-04-03T10:15:57.287Z" + } + }, + "image_file_67.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "edf83a09-2e60-4571-b650-abf4c7ff757b", + "submission_date": "2019-04-03T10:13:40.672Z", + "update_date": "2019-04-03T10:15:54.149Z" + } + }, + "image_file_68.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z11-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", + "submission_date": "2019-04-03T10:13:40.681Z", + "update_date": "2019-04-03T10:15:54.166Z" + } + }, + "image_file_69.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "be9d12b6-f8dd-407c-b1d7-844deb6a5023", + "submission_date": "2019-04-03T10:13:40.689Z", + "update_date": "2019-04-03T10:15:54.168Z" + } + }, + "image_file_70.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e3e59792-61e3-4bf0-a985-2acec75acafd", + "submission_date": "2019-04-03T10:13:40.698Z", + "update_date": "2019-04-03T10:15:57.350Z" + } + }, + "image_file_71.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "095ee09c-1605-4c07-9324-b5382f20b78e", + "submission_date": "2019-04-03T10:13:40.707Z", + "update_date": "2019-04-03T10:15:51.023Z" + } + }, + "image_file_72.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "77b96424-accb-4c6b-884c-756f2bb40929", + "submission_date": "2019-04-03T10:13:40.715Z", + "update_date": "2019-04-03T10:15:54.145Z" + } + }, + "image_file_73.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", + "submission_date": "2019-04-03T10:13:40.724Z", + "update_date": "2019-04-03T10:15:57.414Z" + } + }, + "image_file_74.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "78518dc1-d38e-4230-88b8-887bdd83f965", + "submission_date": "2019-04-03T10:13:40.733Z", + "update_date": "2019-04-03T10:15:54.195Z" + } + }, + "image_file_75.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "652dd3c5-6467-41ee-89b3-e4b3361fb533", + "submission_date": "2019-04-03T10:13:40.741Z", + "update_date": "2019-04-03T10:15:54.138Z" + } + }, + "image_file_76.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cae3d214-d485-4350-8cd2-f4142aca4aef", + "submission_date": "2019-04-03T10:13:40.749Z", + "update_date": "2019-04-03T10:15:54.152Z" + } + }, + "image_file_77.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", + "submission_date": "2019-04-03T10:13:40.758Z", + "update_date": "2019-04-03T10:15:54.144Z" + } + }, + "image_file_78.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "de282263-0944-48d4-9819-6182636c76bd", + "submission_date": "2019-04-03T10:13:40.766Z", + "update_date": "2019-04-03T10:15:50.968Z" + } + }, + "image_file_79.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bfdbe9b5-42ac-419a-b297-843095de2cc2", + "submission_date": "2019-04-03T10:13:40.775Z", + "update_date": "2019-04-03T10:15:57.263Z" + } + }, + "image_file_80.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z12-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", + "submission_date": "2019-04-03T10:13:40.783Z", + "update_date": "2019-04-03T10:15:57.144Z" + } + }, + "image_file_81.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e2763cda-3236-487e-9944-5169c0cb8856", + "submission_date": "2019-04-03T10:13:40.792Z", + "update_date": "2019-04-03T10:15:57.230Z" + } + }, + "image_file_82.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "37018bd8-8537-47c3-a5a9-efb43552f30c", + "submission_date": "2019-04-03T10:13:40.801Z", + "update_date": "2019-04-03T10:15:57.364Z" + } + }, + "image_file_83.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a6c9b1ce-2054-4a48-b262-bb0723b8a567", + "submission_date": "2019-04-03T10:13:40.809Z", + "update_date": "2019-04-03T10:15:57.302Z" + } + }, + "image_file_84.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8319ee38-f199-49d7-989a-25b451656b38", + "submission_date": "2019-04-03T10:13:40.818Z", + "update_date": "2019-04-03T10:15:54.124Z" + } + }, + "image_file_85.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "022841b6-8b7c-4d0c-b65f-06ba14253540", + "submission_date": "2019-04-03T10:13:40.826Z", + "update_date": "2019-04-03T10:15:54.250Z" + } + }, + "image_file_86.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "299dfbe5-05f5-48a7-816b-61036f0e435a", + "submission_date": "2019-04-03T10:13:40.835Z", + "update_date": "2019-04-03T10:15:54.232Z" + } + }, + "image_file_87.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6b8b11aa-3600-4a63-a980-93465e681c9c", + "submission_date": "2019-04-03T10:13:40.844Z", + "update_date": "2019-04-03T10:15:50.951Z" + } + }, + "image_file_88.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "35716168-df43-4273-b52f-72e3d18a47bc", + "submission_date": "2019-04-03T10:13:40.853Z", + "update_date": "2019-04-03T10:15:57.202Z" + } + }, + "image_file_89.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6be783ec-c132-4e09-90e0-0958efaf6619", + "submission_date": "2019-04-03T10:13:40.862Z", + "update_date": "2019-04-03T10:15:57.305Z" + } + }, + "image_file_90.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a11956c9-c24e-4efb-8af8-1167b3081e70", + "submission_date": "2019-04-03T10:13:40.871Z", + "update_date": "2019-04-03T10:15:57.283Z" + } + }, + "image_file_91.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", + "submission_date": "2019-04-03T10:13:40.880Z", + "update_date": "2019-04-03T10:15:51.102Z" + } + }, + "image_file_92.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z13-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "753c2a57-b5f1-4984-b874-b2b10d582847", + "submission_date": "2019-04-03T10:13:40.889Z", + "update_date": "2019-04-03T10:16:00.454Z" + } + }, + "image_file_93.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e0b93b3d-075b-482b-838a-e36d8849607b", + "submission_date": "2019-04-03T10:13:40.899Z", + "update_date": "2019-04-03T10:15:57.655Z" + } + }, + "image_file_94.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", + "submission_date": "2019-04-03T10:13:40.908Z", + "update_date": "2019-04-03T10:15:57.378Z" + } + }, + "image_file_95.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c647964a-7796-4dd2-9fa8-b23f012ac14e", + "submission_date": "2019-04-03T10:13:40.917Z", + "update_date": "2019-04-03T10:15:54.078Z" + } + }, + "image_file_96.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "87a63649-9834-49b8-89a0-310211c1b5b3", + "submission_date": "2019-04-03T10:13:40.926Z", + "update_date": "2019-04-03T10:15:57.378Z" + } + }, + "image_file_97.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b2eb5b20-fd1a-403c-8b55-9eec5972d482", + "submission_date": "2019-04-03T10:13:40.936Z", + "update_date": "2019-04-03T10:15:54.167Z" + } + }, + "image_file_98.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "4b3b36cb-cd90-4526-978d-2e7e8f7add39", + "submission_date": "2019-04-03T10:13:40.953Z", + "update_date": "2019-04-03T10:15:57.225Z" + } + }, + "image_file_99.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cdc774f8-3310-4f1f-8c67-03579c253640", + "submission_date": "2019-04-03T10:13:40.968Z", + "update_date": "2019-04-03T10:15:57.258Z" + } + }, + "image_file_100.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "607370e0-7e7e-4d25-ba5c-957c00a73ac1", + "submission_date": "2019-04-03T10:13:40.979Z", + "update_date": "2019-04-03T10:16:00.280Z" + } + }, + "image_file_101.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3240d7ab-568b-4be5-adba-3178b3e8f85e", + "submission_date": "2019-04-03T10:13:40.990Z", + "update_date": "2019-04-03T10:16:00.280Z" + } + }, + "image_file_102.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c0b6ee98-677a-41d9-9d80-9ac63d251b08", + "submission_date": "2019-04-03T10:13:41.002Z", + "update_date": "2019-04-03T10:15:57.303Z" + } + }, + "image_file_103.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f34c01ec-06df-49e6-bc2f-c50c7f398851", + "submission_date": "2019-04-03T10:13:41.020Z", + "update_date": "2019-04-03T10:16:00.436Z" + } + }, + "image_file_104.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z14-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2047311b-f3ee-4137-8338-a45166e01d53", + "submission_date": "2019-04-03T10:13:41.032Z", + "update_date": "2019-04-03T10:15:50.968Z" + } + }, + "image_file_105.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "44ea335a-1991-4504-be12-04f1a332ddfb", + "submission_date": "2019-04-03T10:13:41.044Z", + "update_date": "2019-04-03T10:16:00.403Z" + } + }, + "image_file_106.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", + "submission_date": "2019-04-03T10:13:41.054Z", + "update_date": "2019-04-03T10:15:54.147Z" + } + }, + "image_file_107.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", + "submission_date": "2019-04-03T10:13:41.065Z", + "update_date": "2019-04-03T10:16:00.681Z" + } + }, + "image_file_108.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6af3cb41-9e64-4b11-b272-be87adf0fa94", + "submission_date": "2019-04-03T10:13:41.076Z", + "update_date": "2019-04-03T10:15:57.097Z" + } + }, + "image_file_109.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7541d176-dfba-4e05-ba45-0c6964271dff", + "submission_date": "2019-04-03T10:13:41.087Z", + "update_date": "2019-04-03T10:15:57.397Z" + } + }, + "image_file_110.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8ee1e829-a507-40a5-87ac-7fd8379b87ce", + "submission_date": "2019-04-03T10:13:41.097Z", + "update_date": "2019-04-03T10:15:57.618Z" + } + }, + "image_file_111.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8e57554a-abb2-4664-87b6-a397f4da6555", + "submission_date": "2019-04-03T10:13:41.107Z", + "update_date": "2019-04-03T10:16:00.218Z" + } + }, + "image_file_112.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", + "submission_date": "2019-04-03T10:13:41.117Z", + "update_date": "2019-04-03T10:15:57.372Z" + } + }, + "image_file_113.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", + "submission_date": "2019-04-03T10:13:41.127Z", + "update_date": "2019-04-03T10:15:57.219Z" + } + }, + "image_file_114.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", + "submission_date": "2019-04-03T10:13:41.136Z", + "update_date": "2019-04-03T10:16:00.319Z" + } + }, + "image_file_115.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", + "submission_date": "2019-04-03T10:13:41.146Z", + "update_date": "2019-04-03T10:16:00.829Z" + } + }, + "image_file_116.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z15-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f0cb4244-e19a-46a0-89f1-04143548872d", + "submission_date": "2019-04-03T10:13:41.156Z", + "update_date": "2019-04-03T10:16:00.414Z" + } + }, + "image_file_117.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "73074f55-d009-41a2-929e-6fd9949bb1dd", + "submission_date": "2019-04-03T10:13:41.166Z", + "update_date": "2019-04-03T10:15:57.285Z" + } + }, + "image_file_118.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", + "submission_date": "2019-04-03T10:13:41.176Z", + "update_date": "2019-04-03T10:16:03.247Z" + } + }, + "image_file_119.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", + "submission_date": "2019-04-03T10:13:41.185Z", + "update_date": "2019-04-03T10:15:51.101Z" + } + }, + "image_file_120.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "146231bb-1b13-4db5-8157-9d9962cc3a3a", + "submission_date": "2019-04-03T10:13:41.195Z", + "update_date": "2019-04-03T10:16:00.042Z" + } + }, + "image_file_121.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", + "submission_date": "2019-04-03T10:13:41.205Z", + "update_date": "2019-04-03T10:15:57.650Z" + } + }, + "image_file_122.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7fe17380-3090-4fc3-9504-02b3f8ed95b6", + "submission_date": "2019-04-03T10:13:41.215Z", + "update_date": "2019-04-03T10:16:00.270Z" + } + }, + "image_file_123.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "fc405b01-60ca-436f-a06c-2f38f7156a87", + "submission_date": "2019-04-03T10:13:41.225Z", + "update_date": "2019-04-03T10:16:00.160Z" + } + }, + "image_file_124.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bae92b53-c6c7-4712-865e-6cff3cba506e", + "submission_date": "2019-04-03T10:13:41.235Z", + "update_date": "2019-04-03T10:16:00.763Z" + } + }, + "image_file_125.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "83662ec5-a202-42ab-9a47-a701d4f19de3", + "submission_date": "2019-04-03T10:13:41.246Z", + "update_date": "2019-04-03T10:16:00.067Z" + } + }, + "image_file_126.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "a04957c6-8ce8-4fa6-950d-71812ff3d698", + "submission_date": "2019-04-03T10:13:41.256Z", + "update_date": "2019-04-03T10:15:57.271Z" + } + }, + "image_file_127.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9284d3a4-73bd-4aa0-847c-ab273d14185a", + "submission_date": "2019-04-03T10:13:41.266Z", + "update_date": "2019-04-03T10:16:00.765Z" + } + }, + "image_file_128.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z16-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "4d664562-c333-4aaf-bb8b-641e0568733e", + "submission_date": "2019-04-03T10:13:41.276Z", + "update_date": "2019-04-03T10:16:00.166Z" + } + }, + "image_file_129.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b533685d-3c60-4483-841b-a054f0a69fec", + "submission_date": "2019-04-03T10:13:41.286Z", + "update_date": "2019-04-03T10:15:54.188Z" + } + }, + "image_file_130.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", + "submission_date": "2019-04-03T10:13:41.296Z", + "update_date": "2019-04-03T10:15:57.291Z" + } + }, + "image_file_131.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", + "submission_date": "2019-04-03T10:13:41.305Z", + "update_date": "2019-04-03T10:16:00.394Z" + } + }, + "image_file_132.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3e8510c9-7e31-49bd-bb90-cb55577c2f25", + "submission_date": "2019-04-03T10:13:41.315Z", + "update_date": "2019-04-03T10:16:00.298Z" + } + }, + "image_file_133.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "463aff9a-ec7e-40d0-be42-c6686af9130d", + "submission_date": "2019-04-03T10:13:41.325Z", + "update_date": "2019-04-03T10:16:00.374Z" + } + }, + "image_file_134.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", + "submission_date": "2019-04-03T10:13:41.334Z", + "update_date": "2019-04-03T10:16:00.331Z" + } + }, + "image_file_135.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "868efb99-df36-462b-91a2-bb6ca27e842a", + "submission_date": "2019-04-03T10:13:41.344Z", + "update_date": "2019-04-03T10:15:57.472Z" + } + }, + "image_file_136.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", + "submission_date": "2019-04-03T10:13:41.354Z", + "update_date": "2019-04-03T10:15:57.134Z" + } + }, + "image_file_137.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "36ded48a-869f-4fa8-971f-56bc28298276", + "submission_date": "2019-04-03T10:13:41.363Z", + "update_date": "2019-04-03T10:16:00.039Z" + } + }, + "image_file_138.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", + "submission_date": "2019-04-03T10:13:41.373Z", + "update_date": "2019-04-03T10:15:57.347Z" + } + }, + "image_file_139.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e72742a4-23ba-4e5d-a29b-ad449abe8101", + "submission_date": "2019-04-03T10:13:41.382Z", + "update_date": "2019-04-03T10:15:57.374Z" + } + }, + "image_file_140.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z2-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cd6e1096-f8c3-4eda-957d-b09741d60901", + "submission_date": "2019-04-03T10:13:41.392Z", + "update_date": "2019-04-03T10:16:00.117Z" + } + }, + "image_file_141.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "903ea376-5153-4fb8-8ffa-e2948951409c", + "submission_date": "2019-04-03T10:13:41.401Z", + "update_date": "2019-04-03T10:15:57.150Z" + } + }, + "image_file_142.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", + "submission_date": "2019-04-03T10:13:41.411Z", + "update_date": "2019-04-03T10:16:00.258Z" + } + }, + "image_file_143.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8381d167-c4dd-49a2-b5df-1ae815bbe42e", + "submission_date": "2019-04-03T10:13:41.421Z", + "update_date": "2019-04-03T10:15:57.334Z" + } + }, + "image_file_144.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", + "submission_date": "2019-04-03T10:13:41.430Z", + "update_date": "2019-04-03T10:15:57.150Z" + } + }, + "image_file_145.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cf305c60-bb2c-41af-82bf-0631c2a7b0be", + "submission_date": "2019-04-03T10:13:41.440Z", + "update_date": "2019-04-03T10:15:57.290Z" + } + }, + "image_file_146.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "074290a9-35e1-422f-a3af-e5ed58781b4d", + "submission_date": "2019-04-03T10:13:41.450Z", + "update_date": "2019-04-03T10:15:57.347Z" + } + }, + "image_file_147.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", + "submission_date": "2019-04-03T10:13:41.460Z", + "update_date": "2019-04-03T10:16:00.451Z" + } + }, + "image_file_148.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", + "submission_date": "2019-04-03T10:13:41.470Z", + "update_date": "2019-04-03T10:16:03.144Z" + } + }, + "image_file_149.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "5165cc56-ff89-42bf-b000-fec4bd57176e", + "submission_date": "2019-04-03T10:13:41.479Z", + "update_date": "2019-04-03T10:16:00.708Z" + } + }, + "image_file_150.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "545be634-5893-45e0-93b2-dd4ea93e00db", + "submission_date": "2019-04-03T10:13:41.489Z", + "update_date": "2019-04-03T10:16:00.405Z" + } + }, + "image_file_151.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2d2e58c6-7c24-4089-bbe9-d47b7482be46", + "submission_date": "2019-04-03T10:13:41.499Z", + "update_date": "2019-04-03T10:16:00.253Z" + } + }, + "image_file_152.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z3-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", + "submission_date": "2019-04-03T10:13:41.509Z", + "update_date": "2019-04-03T10:15:57.292Z" + } + }, + "image_file_153.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "81214e49-318f-4221-bf2c-4ef00cfa916b", + "submission_date": "2019-04-03T10:13:41.519Z", + "update_date": "2019-04-03T10:16:00.761Z" + } + }, + "image_file_154.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7fc97754-1121-468b-b1e4-839bde86b6c8", + "submission_date": "2019-04-03T10:13:41.529Z", + "update_date": "2019-04-03T10:15:57.316Z" + } + }, + "image_file_155.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7d70d44c-b5d7-47be-9687-e9a775e86251", + "submission_date": "2019-04-03T10:13:41.539Z", + "update_date": "2019-04-03T10:16:00.785Z" + } + }, + "image_file_156.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", + "submission_date": "2019-04-03T10:13:41.552Z", + "update_date": "2019-04-03T10:15:57.619Z" + } + }, + "image_file_157.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b7607809-e975-4c32-bff7-375cb2d8276f", + "submission_date": "2019-04-03T10:13:41.564Z", + "update_date": "2019-04-03T10:15:57.213Z" + } + }, + "image_file_158.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b8a6c863-626d-4fbf-863b-610cffaac37d", + "submission_date": "2019-04-03T10:13:41.579Z", + "update_date": "2019-04-03T10:16:00.707Z" + } + }, + "image_file_159.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "45077a5c-ee96-47c0-a84f-9d46cf799338", + "submission_date": "2019-04-03T10:13:41.590Z", + "update_date": "2019-04-03T10:15:57.619Z" + } + }, + "image_file_160.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "49d82b74-6f1a-415c-93ab-958c60f083b6", + "submission_date": "2019-04-03T10:13:41.601Z", + "update_date": "2019-04-03T10:15:57.323Z" + } + }, + "image_file_161.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "753b51b7-a909-44e7-bb21-cf2cd18328f8", + "submission_date": "2019-04-03T10:13:41.612Z", + "update_date": "2019-04-03T10:16:00.722Z" + } + }, + "image_file_162.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c7ab6349-b2bb-4ba3-9c9b-27d270550052", + "submission_date": "2019-04-03T10:13:41.624Z", + "update_date": "2019-04-03T10:16:00.390Z" + } + }, + "image_file_163.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7be770fc-4a56-4f82-a4cf-3cf908d54dca", + "submission_date": "2019-04-03T10:13:41.635Z", + "update_date": "2019-04-03T10:16:00.789Z" + } + }, + "image_file_164.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z4-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3f5f8537-c1af-4d2e-a732-53b6d4275588", + "submission_date": "2019-04-03T10:13:41.646Z", + "update_date": "2019-04-03T10:16:00.749Z" + } + }, + "image_file_165.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", + "submission_date": "2019-04-03T10:13:41.657Z", + "update_date": "2019-04-03T10:15:57.145Z" + } + }, + "image_file_166.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f986c2c2-2823-45a0-80cf-5e6f67958afb", + "submission_date": "2019-04-03T10:13:41.668Z", + "update_date": "2019-04-03T10:16:00.833Z" + } + }, + "image_file_167.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7d17d6d6-d038-40c6-b965-6de41ce9c931", + "submission_date": "2019-04-03T10:13:41.680Z", + "update_date": "2019-04-03T10:15:57.652Z" + } + }, + "image_file_168.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3d208b38-62c8-492d-9434-21bb66ead16e", + "submission_date": "2019-04-03T10:13:41.692Z", + "update_date": "2019-04-03T10:16:03.214Z" + } + }, + "image_file_169.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9a982898-77c6-4a56-8e54-9cb83ff0b235", + "submission_date": "2019-04-03T10:13:41.704Z", + "update_date": "2019-04-03T10:16:03.249Z" + } + }, + "image_file_170.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", + "submission_date": "2019-04-03T10:13:41.715Z", + "update_date": "2019-04-03T10:16:00.293Z" + } + }, + "image_file_171.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "24b6366f-03ce-4e4d-b50f-90687f3e2b94", + "submission_date": "2019-04-03T10:13:41.726Z", + "update_date": "2019-04-03T10:16:00.295Z" + } + }, + "image_file_172.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ec1d0987-fb49-48b8-aaeb-321c659fb67f", + "submission_date": "2019-04-03T10:13:41.736Z", + "update_date": "2019-04-03T10:16:03.247Z" + } + }, + "image_file_173.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", + "submission_date": "2019-04-03T10:13:41.746Z", + "update_date": "2019-04-03T10:16:03.243Z" + } + }, + "image_file_174.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6fbcb1c7-ce98-46db-8054-b451b6bca205", + "submission_date": "2019-04-03T10:13:41.756Z", + "update_date": "2019-04-03T10:16:03.126Z" + } + }, + "image_file_175.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", + "submission_date": "2019-04-03T10:13:41.766Z", + "update_date": "2019-04-03T10:16:00.740Z" + } + }, + "image_file_176.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z5-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "aa6fca0d-6a70-4016-a0e4-307878e9ff45", + "submission_date": "2019-04-03T10:13:41.776Z", + "update_date": "2019-04-03T10:16:00.704Z" + } + }, + "image_file_177.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ee62cd8d-fb93-4082-980b-213c7a8a0c47", + "submission_date": "2019-04-03T10:13:41.785Z", + "update_date": "2019-04-03T10:16:03.200Z" + } + }, + "image_file_178.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bbd60a79-3572-42c0-8e53-b0c566a72f06", + "submission_date": "2019-04-03T10:13:41.795Z", + "update_date": "2019-04-03T10:16:00.196Z" + } + }, + "image_file_179.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", + "submission_date": "2019-04-03T10:13:41.805Z", + "update_date": "2019-04-03T10:16:03.144Z" + } + }, + "image_file_180.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", + "submission_date": "2019-04-03T10:13:41.816Z", + "update_date": "2019-04-03T10:16:00.186Z" + } + }, + "image_file_181.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "240a67cc-e827-41bf-8ac8-a66bc2797f13", + "submission_date": "2019-04-03T10:13:41.827Z", + "update_date": "2019-04-03T10:16:00.772Z" + } + }, + "image_file_182.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7a9b6534-fa1d-4282-a064-11e60e57a322", + "submission_date": "2019-04-03T10:13:41.838Z", + "update_date": "2019-04-03T10:15:57.638Z" + } + }, + "image_file_183.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "b0af6371-4379-45f0-8c09-f6610833fc46", + "submission_date": "2019-04-03T10:13:41.848Z", + "update_date": "2019-04-03T10:15:57.644Z" + } + }, + "image_file_184.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f5ce7a96-cfc0-42c4-852b-386f9a27111d", + "submission_date": "2019-04-03T10:13:41.859Z", + "update_date": "2019-04-03T10:16:00.829Z" + } + }, + "image_file_185.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", + "submission_date": "2019-04-03T10:13:41.869Z", + "update_date": "2019-04-03T10:16:00.329Z" + } + }, + "image_file_186.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3dff4add-7d6f-418c-afba-e46864af51d2", + "submission_date": "2019-04-03T10:13:41.880Z", + "update_date": "2019-04-03T10:16:00.156Z" + } + }, + "image_file_187.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ab2b7c67-8f13-4388-acd7-e2abb0091f30", + "submission_date": "2019-04-03T10:13:41.895Z", + "update_date": "2019-04-03T10:16:00.743Z" + } + }, + "image_file_188.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z6-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "d9912d93-3d92-48d2-9f75-826fbba3d94e", + "submission_date": "2019-04-03T10:13:41.907Z", + "update_date": "2019-04-03T10:16:03.046Z" + } + }, + "image_file_189.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "8b37aba2-be5e-4963-8e6f-51a2df8e143e", + "submission_date": "2019-04-03T10:13:41.917Z", + "update_date": "2019-04-03T10:16:00.282Z" + } + }, + "image_file_190.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", + "submission_date": "2019-04-03T10:13:41.927Z", + "update_date": "2019-04-03T10:16:00.805Z" + } + }, + "image_file_191.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "2d7e88dd-bddd-4289-9556-27d301be0b83", + "submission_date": "2019-04-03T10:13:41.937Z", + "update_date": "2019-04-03T10:16:03.188Z" + } + }, + "image_file_192.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", + "submission_date": "2019-04-03T10:13:41.947Z", + "update_date": "2019-04-03T10:16:03.221Z" + } + }, + "image_file_193.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", + "submission_date": "2019-04-03T10:13:41.958Z", + "update_date": "2019-04-03T10:16:00.822Z" + } + }, + "image_file_194.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", + "submission_date": "2019-04-03T10:13:41.969Z", + "update_date": "2019-04-03T10:16:03.130Z" + } + }, + "image_file_195.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e834d3df-8432-40ba-b67d-c7cd0bd7328d", + "submission_date": "2019-04-03T10:13:41.979Z", + "update_date": "2019-04-03T10:16:03.234Z" + } + }, + "image_file_196.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "d8908d6d-5daa-454d-9082-726054cfddc1", + "submission_date": "2019-04-03T10:13:41.990Z", + "update_date": "2019-04-03T10:16:03.189Z" + } + }, + "image_file_197.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c5a7142e-4702-4e84-b7aa-239df2a71ba8", + "submission_date": "2019-04-03T10:13:42.000Z", + "update_date": "2019-04-03T10:16:00.189Z" + } + }, + "image_file_198.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "f69e44ef-cf23-4571-8dad-e44222697974", + "submission_date": "2019-04-03T10:13:42.011Z", + "update_date": "2019-04-03T10:16:03.186Z" + } + }, + "image_file_199.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "ea72f81c-2c58-43e2-acca-294254f470f7", + "submission_date": "2019-04-03T10:13:42.021Z", + "update_date": "2019-04-03T10:16:03.138Z" + } + }, + "image_file_200.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z7-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", + "submission_date": "2019-04-03T10:13:42.031Z", + "update_date": "2019-04-03T10:16:03.194Z" + } + }, + "image_file_201.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6928ac1b-fd1d-436c-bfc6-4087c65809d7", + "submission_date": "2019-04-03T10:13:42.042Z", + "update_date": "2019-04-03T10:16:03.234Z" + } + }, + "image_file_202.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "07a7b938-435b-4804-b140-c255957b6532", + "submission_date": "2019-04-03T10:13:42.052Z", + "update_date": "2019-04-03T10:16:03.185Z" + } + }, + "image_file_203.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3d532a7b-55e7-4461-afbc-65ef76403384", + "submission_date": "2019-04-03T10:13:42.062Z", + "update_date": "2019-04-03T10:16:00.225Z" + } + }, + "image_file_204.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bab40245-28bd-49a2-8be0-ba109fe41c91", + "submission_date": "2019-04-03T10:13:42.072Z", + "update_date": "2019-04-03T10:16:03.171Z" + } + }, + "image_file_205.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9d577bd4-3a27-48be-ad7c-8c44cf803cda", + "submission_date": "2019-04-03T10:13:42.082Z", + "update_date": "2019-04-03T10:16:03.221Z" + } + }, + "image_file_206.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", + "submission_date": "2019-04-03T10:13:42.093Z", + "update_date": "2019-04-03T10:16:03.221Z" + } + }, + "image_file_207.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "21a043b6-6dde-41b9-b20e-74b961da8b88", + "submission_date": "2019-04-03T10:13:42.104Z", + "update_date": "2019-04-03T10:16:03.210Z" + } + }, + "image_file_208.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "11280200-1803-4110-aa84-2808776c2d50", + "submission_date": "2019-04-03T10:13:42.114Z", + "update_date": "2019-04-03T10:16:03.231Z" + } + }, + "image_file_209.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "86df5269-576b-4d18-a0ce-6e2b2a36d51b", + "submission_date": "2019-04-03T10:13:42.124Z", + "update_date": "2019-04-03T10:16:03.201Z" + } + }, + "image_file_210.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e524ff4e-95fa-4561-bfd3-276cba79e664", + "submission_date": "2019-04-03T10:13:42.134Z", + "update_date": "2019-04-03T10:16:03.251Z" + } + }, + "image_file_211.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "3d5737da-b1ab-48cb-a26f-d420e53edccd", + "submission_date": "2019-04-03T10:13:42.144Z", + "update_date": "2019-04-03T10:16:03.057Z" + } + }, + "image_file_212.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z8-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "44cf15ec-3d4e-4698-bb14-107c34891191", + "submission_date": "2019-04-03T10:13:42.154Z", + "update_date": "2019-04-03T10:16:03.206Z" + } + }, + "image_file_213.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H0-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "6242cdf3-fd6d-4479-a08a-1747818fd978", + "submission_date": "2019-04-03T10:13:42.164Z", + "update_date": "2019-04-03T10:16:03.054Z" + } + }, + "image_file_214.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H0-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "bc60bbd4-8b09-425c-b507-9da24a84f412", + "submission_date": "2019-04-03T10:13:42.174Z", + "update_date": "2019-04-03T10:16:00.270Z" + } + }, + "image_file_215.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H0-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", + "submission_date": "2019-04-03T10:13:42.184Z", + "update_date": "2019-04-03T10:16:03.187Z" + } + }, + "image_file_216.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H0-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", + "submission_date": "2019-04-03T10:13:42.195Z", + "update_date": "2019-04-03T10:16:03.267Z" + } + }, + "image_file_217.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H1-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "5f67c32c-a154-4620-8603-0b64979b04a4", + "submission_date": "2019-04-03T10:13:42.207Z", + "update_date": "2019-04-03T10:16:03.116Z" + } + }, + "image_file_218.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H1-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", + "submission_date": "2019-04-03T10:13:42.219Z", + "update_date": "2019-04-03T10:16:00.148Z" + } + }, + "image_file_219.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H1-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "dcee6df0-9e87-4935-8873-f8d30d449d76", + "submission_date": "2019-04-03T10:13:42.230Z", + "update_date": "2019-04-03T10:16:03.250Z" + } + }, + "image_file_220.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H1-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", + "submission_date": "2019-04-03T10:13:42.242Z", + "update_date": "2019-04-03T10:16:03.126Z" + } + }, + "image_file_221.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H2-C0.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e6d00b0c-3641-4ec4-a553-8fd742193dba", + "submission_date": "2019-04-03T10:13:42.254Z", + "update_date": "2019-04-03T10:16:03.321Z" + } + }, + "image_file_222.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H2-C1.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "e5034863-0528-4f55-be95-c8501c29f9fe", + "submission_date": "2019-04-03T10:13:42.272Z", + "update_date": "2019-04-03T10:16:03.187Z" + } + }, + "image_file_223.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H2-C2.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", + "submission_date": "2019-04-03T10:13:42.284Z", + "update_date": "2019-04-03T10:16:03.190Z" + } + }, + "image_file_224.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000-Z9-H2-C3.tiff", + "file_format": "tiff" + }, + "provenance": { + "document_id": "33d332c9-aefe-4db5-8830-b8daddaed0d2", + "submission_date": "2019-04-03T10:13:42.295Z", + "update_date": "2019-04-03T10:16:03.189Z" + } + }, + "image_file_225.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image-fov_000.json", + "file_format": "json" + }, + "provenance": { + "document_id": "bb3b6fc7-0902-432d-bad1-6b3f61951314", + "submission_date": "2019-04-03T10:13:42.306Z", + "update_date": "2019-04-03T10:15:51.086Z" + } + }, + "image_file_226.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", + "schema_type": "file", + "file_core": { + "file_name": "primary_image.json", + "file_format": "json" + }, + "provenance": { + "document_id": "2b734e88-3a33-4c73-92bb-82e0b8f8c13b", + "submission_date": "2019-04-03T10:13:42.318Z", + "update_date": "2019-04-03T10:16:00.280Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/project/11.0.1/project", + "schema_type": "project", + "project_core": { + "project_short_name": "barista_seq", + "project_title": "1 FOV BaristaSeq mouse SpaceTx dataset", + "project_description": "1 FOV BaristaSeq mouse SpaceTx dataset" + }, + "supplementary_links": [ + "https://github.com/spacetx" + ], + "funders": [ + { + "grant_title": "grant", + "grant_id": "1", + "organization": "funder" + } + ], + "provenance": { + "document_id": "ae5237b4-633f-403a-afc6-cb87e6f90db1", + "submission_date": "2019-04-03T10:13:39.976Z", + "update_date": "2019-04-03T10:13:45.439Z" + } + }, + "imaging_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/imaging/11.0.12/imaging_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "zador_singlerolseq_1" + }, + "microscope_setup_description": "PerkinElmer Ultraview Vox Spinning disk (Nikon Ti-E, Yokogawa CSU-X1, Hamamatsu orca-R2, ASI MS-2000 xyz stage, Nikon Plan Apo 10x 0.45 and Nikon Plan Apo 20x 0.75)", + "microscopy_technique": { + "text": "spinning disk confocal" + }, + "magnification": "20x", + "numerical_aperture": 0.75, + "immersion_medium_type": "air", + "immersion_medium_refractive_index": 1.0, + "pixel_size": 322.5, + "number_of_tiles": 25, + "tile_size_y": 433.0, + "tile_size_x": 330.0, + "z_stack_step_size": 3000.0, + "number_of_z_steps": 17, + "overlapping_tiles": "yes", + "target": [ + { + "molecule_name": "Ank1", + "molecule_id": "NM_001277289", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggcccacactcattccagagaaggatcaccaccatccaaggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ank1", + "molecule_id": "NM_001277289", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggactgggataaacagggttccacagcggtacacccgcaagaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ank1", + "molecule_id": "NM_001277289", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agcagcgagttcacgcccgaatcacagactcaccctcagtgag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnmb2", + "molecule_id": "NM_028231", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gtgggagacaaagctggtgagatcactcccagtaaactgactgg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnmb2", + "molecule_id": "NM_028231", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cctgaccaaactctacagctccaatgtgctgttccattctctct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnmb2", + "molecule_id": "NM_028231", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttcagctgtgggcccgactgttggaagctctctcagtacccttg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ankrd55", + "molecule_id": "NM_001168404", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agggcccgtccattatcaactacgacgacgagagtgggaaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ankrd55", + "molecule_id": "NM_001168404", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgcagagcctgatgtgaggctcctcatagtcctgctgcagca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ankrd55", + "molecule_id": "NM_001168404", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgtgtgagtctgctcagaaacggtgccaagcacaacatcccag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc32a1", + "molecule_id": "NM_009508", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tcttcacgctgctcatggccatctacgtgccacacttcgcgct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc32a1", + "molecule_id": "NM_009508", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tatccgttgcccttcttcgcggccgtcgaagtgctggagaagt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc32a1", + "molecule_id": "NM_009508", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tcaacatcctggtcatcgcttactgtctctctcgcgcgcgtgatt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Btbd11", + "molecule_id": "NM_001017525", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgagatcatggagcttctgtctgctgctaaatttttccagctggag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Btbd11", + "molecule_id": "NM_001017525", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cgtgaagtatcccatcttccagctcgtcatgcagtatctctactac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Btbd11", + "molecule_id": "NM_001017525", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcttgttcacagcctctcccaggttcaaggccctcctctcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arx", + "molecule_id": "NM_001305940", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agcattttggcgctctatgttgatttaagcgcggcccggctaaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arx", + "molecule_id": "NM_001305940", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caaggcagttcttggcgctaaaggatgtggcacctcctccact", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arx", + "molecule_id": "NM_001305940", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atggaaacagaggaccagctcactcccaagaaggcacagacag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx1", + "molecule_id": "NM_010053", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgtaaacatgttgcacaagcttagcctctttccgttctgttgtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx1", + "molecule_id": "NM_010053", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "taagacacaagcagcggctcgaccacagaacacaagtcatcaccct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx1", + "molecule_id": "NM_010053", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcacagtaacttttgtacttggctgaaatgcagaaagggaaaac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad2", + "molecule_id": "NM_008078", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaaggtggcgccagtgattaaagccagaatgatggagtatggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad2", + "molecule_id": "NM_008078", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agtgttcagctctcctggttagagaggagggactgatgcagagct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad2", + "molecule_id": "NM_008078", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tactgatgtcccggaaacacaagtggaagctgagtggagtagaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pvalb", + "molecule_id": "NM_013645", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgcttggtactgagtgctcatgtgggccacctcgttcaatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pvalb", + "molecule_id": "NM_013645", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggagaaacaataaaggctgtaccaatcggacaccacctgtaggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pvalb", + "molecule_id": "NM_013645", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcctcagatgccagagacttgtctgctaaagaaacaaagacgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pdgfra", + "molecule_id": "NM_001083316", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgggcaagaggaacagacacagctcacagacttcggaagagag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pdgfra", + "molecule_id": "NM_001083316", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaaaagattcacctggacttcctaaagagtgaccatccggccgt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pdgfra", + "molecule_id": "NM_001083316", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agtgagcccgagaagagaccctccttctaccacctcagcgagata", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph4", + "molecule_id": "NM_183297", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aattgccacgtggaatatgagaagacaaaccgcgctcgcaag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph4", + "molecule_id": "NM_183297", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cacaattcgtccagcctgggtaacctaagcgtcagtatcgtgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph4", + "molecule_id": "NM_183297", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgtgcataccctcaagttctcgctgttggtgaccggcaagatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car3", + "molecule_id": "NM_007606", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cattgtgtggctgctgctcaaagagcccatgactgtgagctc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car3", + "molecule_id": "NM_007606", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "catcatgcctgttccctgcttgccgggactattggacctatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car3", + "molecule_id": "NM_007606", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gggagaaaggcgagttccagattcttcttgatgccctggacaaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a8", + "molecule_id": "NM_001310710", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaactcaaccacgagactttcgtaagtcccagaaagaagatgtct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a8", + "molecule_id": "NM_001310710", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggctttgctatttcaggcttcaatgtcaaccacctggacattgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a8", + "molecule_id": "NM_001310710", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgctcctggtggttggattttcccataccaaaggagtggctatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Syt6", + "molecule_id": "NM_001276679", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cgagacgctgattgtgcgcatcctgaaggcctttgacctccct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Syt6", + "molecule_id": "NM_001276679", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agatgcatgtctccagcgtggactatggcaatgagctgccgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Syt6", + "molecule_id": "NM_001276679", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acaaagctgcagcgacagaccacagagccagcatcctccacca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rspo1", + "molecule_id": "NM_138683", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagaagaggaagctgtgcggtttccggaagggatcggaagag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rspo1", + "molecule_id": "NM_138683", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gtgtcaggagggcttgtacttacacaagggccgctgctatcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rspo1", + "molecule_id": "NM_138683", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cccaagctcttcattctgctggagaggaacgacatccgccaggt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fam84b", + "molecule_id": "NM_001162926", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcctggaggacttgatcatggagaagcggcgcaacgaccagat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fam84b", + "molecule_id": "NM_001162926", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aacgatctgtatcgctacaagccactgagccctagcgctgtagt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fam84b", + "molecule_id": "NM_001162926", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aacaagtgcagtccgggtgacctggtggagtttgtatcgcaggc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Deptor", + "molecule_id": "NM_001037937", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcaggagacgcatgacagtcccttctgtctgaggaagcagag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Deptor", + "molecule_id": "NM_001037937", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcaacctcctctaccagttcagaatgaacttccgtcggaggcgga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Deptor", + "molecule_id": "NM_001037937", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagaggcagagcagctttgccaccggcttatggaccatgggatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ndnf", + "molecule_id": "NM_172399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caccagaaagaaatcagagaaggtcctttgcaaatacttccacag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ndnf", + "molecule_id": "NM_172399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agcttttgacaagctacgtacctgctcttcagttacggtggcat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ndnf", + "molecule_id": "NM_172399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aggcaacaggaaaggagcatcaaagctgaaaatactggcgacca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chrna2", + "molecule_id": "NM_144803", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagcactagaaggtgtacactacattgctgaccacctgaggtct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chrna2", + "molecule_id": "NM_144803", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tcattggctggagaccaacatggatgctgaagaaagggaggag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chrna2", + "molecule_id": "NM_144803", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgtcttcctgctgctcatcacagaaattatcccatccacctcac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Calb1", + "molecule_id": "NM_009788", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cacccaaagcacctctgtgctgcttctatctggcggaagggat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Calb1", + "molecule_id": "NM_009788", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cgaacagaccttgctcttattctttctgctggagacaactagagtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Calb1", + "molecule_id": "NM_009788", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgcgaggaattcatgaagacttggagaaagtatgatactgaccac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sncg", + "molecule_id": "NM_011430", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gttgcccaagttctctgtccctagcccagtgccacaagtcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sncg", + "molecule_id": "NM_011430", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gagaatgaagaggccaagagtggagaagactagaaggctgccag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sncg", + "molecule_id": "NM_011430", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tggtcagcagcgtcaacacagtggccaacaagaccgtggagga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Th", + "molecule_id": "NM_009377", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gacaagctcaggaactatgcctctcgtatccagcgcccattctc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Th", + "molecule_id": "NM_009377", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgggacacgtacccatgttggctgaccgcacatttgcccagtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Th", + "molecule_id": "NM_009377", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gtttcagtgcacacagtacatccgtcatgcctcctcacctatgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad1", + "molecule_id": "NM_001312900", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgatcgctccaccaaggttctggatttccaccacccacacca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad1", + "molecule_id": "NM_001312900", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tccaagaacctgctttcctgtgaaaacagtgaccagggtgccc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gad1", + "molecule_id": "NM_001312900", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tctgtggcttcttacaaaggaccaatagcctggaagagaagagtcg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a7", + "molecule_id": "NM_182993", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atcgctgactttttgcgcagtcgtcacataatgtccactaccaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a7", + "molecule_id": "NM_182993", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caccctggaggcgcttctttacgtccatgcccgtctatgccat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc17a7", + "molecule_id": "NM_182993", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tatggcagcttcgggatcttttggtacctgttctggttgcttgtct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod1", + "molecule_id": "NM_010894", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gatcctgcgctcaggcaaaagccctgatctggtctccttcgta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod1", + "molecule_id": "NM_010894", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cttgctactccaagacccagaaactgtctaaaatagagacactgcg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod1", + "molecule_id": "NM_010894", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcgcgcctagaacgttttaaattaaggcgcatgaaggccaacg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rorb", + "molecule_id": "NM_146095", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctttgcgaagaatctgtgttccttgcagctgactgaggaagagat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rorb", + "molecule_id": "NM_146095", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccacacctacgaggaaatcaaggcgtatcaaagcaagtccaggga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rorb", + "molecule_id": "NM_146095", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgcacagaacatcattaagtcccatttggagacatgtcagtacac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fezf2", + "molecule_id": "NM_080433", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gctttcaccaaaaagggaactacaagaatcacaagctcacccaca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fezf2", + "molecule_id": "NM_080433", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttcaatcgcagctccacgctcaacacgcacatccgcatccac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fezf2", + "molecule_id": "NM_080433", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agctagaccgtttgtgtgcaaagtctgtggcaaaggcttccg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adarb2", + "molecule_id": "NM_001289530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ataccgacaaaacaggcctctccttagtggcgtgagtcacgca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adarb2", + "molecule_id": "NM_001289530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atcgagcctgtgtacctccacagcatcattgtgggcagcctgca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adarb2", + "molecule_id": "NM_001289530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cagacttgaacagcagcaaacacatcgtcaggaagttccgaggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lamp5", + "molecule_id": "NM_029530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgactttgtcttcagtgaagaacataaatgtccagtggatgagc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lamp5", + "molecule_id": "NM_029530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tttctctggcctccagtgaccctcagaagactgtcaccatgatcct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lamp5", + "molecule_id": "NM_029530", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcagaatgctctttgtaaaggaaagtcacaacacttccaaagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vip", + "molecule_id": "NM_001313969", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gggtcagatttctgccaaaaaataccttgagtcactcattggcaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vip", + "molecule_id": "NM_001313969", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcagaaaatggcacaccctattatgatgtgtcaagaaatgccaggc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vip", + "molecule_id": "NM_001313969", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccttctgtagtgagtaggctggatgacaggatgccgtttgaagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lhx6", + "molecule_id": "NM_001083127", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cgcatccattacgacaccatgatcgagaacctcaagagggcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lhx6", + "molecule_id": "NM_001083127", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctggcatgtttcgcctgcttttcctgcaagcgccagctatcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Lhx6", + "molecule_id": "NM_001083127", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atttggaaccaagtgcgcccggtgcggcagacaaatctatgcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chodl", + "molecule_id": "NM_139134", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggtgcaacatgaagcacaattacatctgcaagtatgaaccagaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chodl", + "molecule_id": "NM_139134", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aatgtgtagtcatgtaccaccaaccaactgccaatcctggccta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Chodl", + "molecule_id": "NM_139134", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaacatcgggtgcctgcccagatctctaccagtggtctgatggaag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fa2h", + "molecule_id": "NM_178086", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tacctgcacttcggctctccacacaagggctcctacctgtacaac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fa2h", + "molecule_id": "NM_178086", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gattgccttcttctatgtgttcctgcggctcattctgcctgaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fa2h", + "molecule_id": "NM_178086", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gccattacctcatcatgttgcattttgtcatgcacggccagcac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly86", + "molecule_id": "NM_010745", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggcttggaagtagtctaccagagctgtgatcccttacaggattttg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly86", + "molecule_id": "NM_010745", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "attctgacttctccgagcagcagtgaccatggcagcgaaaatg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly86", + "molecule_id": "NM_010745", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atggcaaaaggctcttctattctgaactactcctatcccctttg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dcn", + "molecule_id": "NM_007833", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caggtcgtctaccttcacaacaacaacatctccgcagttgggcaaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dcn", + "molecule_id": "NM_007833", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tctcactgaagtgcatctagatggcaacaagatcaccaaggttgat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dcn", + "molecule_id": "NM_007833", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agggactgaagagtctctcatacattcgcatctcagacaccaacat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fgfr3", + "molecule_id": "NM_001163216", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cctcactgtgacatcaaccgacgagtacttggacctctccgt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fgfr3", + "molecule_id": "NM_001163216", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgtacatgatcatgcgggaatgttggcatgcggtgccttcacag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Fgfr3", + "molecule_id": "NM_001163216", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgctggtggagtacgcagccaagggcaatctccgggagttcctt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Map3k7cl", + "molecule_id": "NM_144854", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagctacctatcgttcagacacaccgttgagtgaatgcagaattag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Map3k7cl", + "molecule_id": "NM_144854", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cctttgtgttagcacacagtggtcacatttgccttggccgtgtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Map3k7cl", + "molecule_id": "NM_144854", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gagcctaaatgctttcttgtgaaaatatcagcaggcgtgtgtcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph1", + "molecule_id": "NM_008751", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gattccaagtccttcaactgtcgcattgagtatgagaaggttgac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph1", + "molecule_id": "NM_008751", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tctgggactggctgaggaactccacagatcttcaggagcctcg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nxph1", + "molecule_id": "NM_008751", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gtcggctcctctcacagactttccgtggtaaagaaaatgacac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pcp4", + "molecule_id": "NM_008791", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agaagaaaaaggcaggatcacagtcctagtggtgaagctgcttc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pcp4", + "molecule_id": "NM_008791", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggcagaagaaagtccaagaagaatttgatatcgacatggatgcacc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Pcp4", + "molecule_id": "NM_008791", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tagctgcggagtcaggccaacatgagtgagagacaaagtgccgg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod6", + "molecule_id": "NM_009717", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccaactacaaacttggtggcaggctgcttacagctcaacgcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod6", + "molecule_id": "NM_009717", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttacatctgggcactttctgaaattctgaggattggcaagagacc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Neurod6", + "molecule_id": "NM_009717", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggtcaagttcaggagacaggaagctaatgcgcgcgagaggaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrn1", + "molecule_id": "NM_153529", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "actcacccacactcacaccatgctcccggaaatcgagaggaata", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrn1", + "molecule_id": "NM_153529", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "accgtgtgcacatactgggaggatttccacagctgcacggtc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrn1", + "molecule_id": "NM_153529", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cttttcagactgtttgctcaagctgggcgacagcatggccaacta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrgn", + "molecule_id": "NM_022029", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttctttgtttatgcaaaagcctcctgagcgcctggaggctcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrgn", + "molecule_id": "NM_022029", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcccgctcttctttgtttatgcaaaagcctcctgagcgcctgga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nrgn", + "molecule_id": "NM_022029", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccaagccagacgacgatattcttgacatcccgctggatgatcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptn", + "molecule_id": "NM_008973", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caatgctgactgtcagaaaactgtcaccatctccaagccctgtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptn", + "molecule_id": "NM_008973", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccttcctggcattgattttcatcttggcagctgtggacactgct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptn", + "molecule_id": "NM_008973", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaaggcagccagctagtcagcgaggacctctgcaagccaaaaaatg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cck", + "molecule_id": "NM_031161", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgccgaggactacgaatacccatcgtagtgggccagcgtctt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cck", + "molecule_id": "NM_031161", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tacatccagcaggtccgcaaagctccttctggccgcatgtccgtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cck", + "molecule_id": "NM_031161", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagagcggcgtatgtctgtgcgtggtgatggcagtcctagctgct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Synpr", + "molecule_id": "NM_001163032", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgatgtcagcttgcaagcagccttccaacaagtgcatggctg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Synpr", + "molecule_id": "NM_001163032", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gactttatcgtcactgtagtcttttcattcttgtggctggtgg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Synpr", + "molecule_id": "NM_001163032", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tttctctactccctggctgccacggtcgtgtacattttcttccag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc6a1", + "molecule_id": "NM_178703", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "catcattgtggcgggcgtgtttctcttcagtgctgtgcagatg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc6a1", + "molecule_id": "NM_178703", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgtcaaccggttctatgacaacatccaggagatggttggctcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Slc6a1", + "molecule_id": "NM_178703", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctcttcattgctgccgtgtgcatcgtgtcctacctgattggc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx6", + "molecule_id": "NM_010057", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cacaccaggacaccatgcagagaccacagatgatgtgacttctc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx6", + "molecule_id": "NM_010057", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgtcaccacgatcaccagccctgcctccagtgtgggacgtttct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Dlx6", + "molecule_id": "NM_010057", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccatcgctttcagcagactcaatacctggcccttcccgagaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Atp1a3", + "molecule_id": "NM_001290469", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "actgggatgatcgcactgtcaatgacctagaagacagttatggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Atp1a3", + "molecule_id": "NM_001290469", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cccacgcacagacaaactggtcaacgaaaggctcatcagcatg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Atp1a3", + "molecule_id": "NM_001290469", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cctgagatcacacccttcctgctcttcatcatggctaacatccc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arpp19", + "molecule_id": "NM_021548", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caatgcatctccaccatttgatatgcaataggacactgcctgt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arpp19", + "molecule_id": "NM_021548", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcccactgtaagcacttcacttacattttctaaagcaccgtcttg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Arpp19", + "molecule_id": "NM_021548", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagcaggtagcctctgggaagagctattctgatggttaccaagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cxcl14", + "molecule_id": "NM_019568", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acagcactgttctctgagttaggatgttaggacgatcctgcgcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cxcl14", + "molecule_id": "NM_019568", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aagggaagatgcaggattagatgcaggacacacagccagagcta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cxcl14", + "molecule_id": "NM_019568", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tactgctccgctccaggcttacaaagcttccgctcagagagcct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rab3b", + "molecule_id": "NM_023537", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cttttccaataagtgtgatcccgtcgcttggaatcctgcccaag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rab3b", + "molecule_id": "NM_023537", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gctggtatcaggcccagtgatcaaatgaaagggccaaatagag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rab3b", + "molecule_id": "NM_023537", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aggtaaagggagctctatagggaagcaggctcaggctgtagtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cryab", + "molecule_id": "NM_001289785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaacaggtgtctggccctgagcgcaccattcccatcacccgtgaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cryab", + "molecule_id": "NM_001289785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggcttcatctccagggagttccacaggaagtaccggatccca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cryab", + "molecule_id": "NM_001289785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gatgcgtttggagaaggacagattctctgtgaatctggacgtgaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Penk", + "molecule_id": "NM_001002927", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gctgaaagagctactgggaacgggagacaaccgtgcgaaagac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Penk", + "molecule_id": "NM_001002927", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggtacggaggcttcatgaagaagatggacgagctatatcccatg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Penk", + "molecule_id": "NM_001002927", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acatcgacatgtacaaagacagcagcaaacaggatgagagccac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Crh", + "molecule_id": "NM_205769", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcaagctcacagcaacaggaaactgatggagattatcgggaaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Crh", + "molecule_id": "NM_205769", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cgcccatctctctggatctcaccttccaccttctgcgggaagt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Crh", + "molecule_id": "NM_205769", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaacctgcaggaggcatcctgagagaagtccctctgcagaggca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Caln1", + "molecule_id": "NM_021371", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tccatcccgcaccagcatcttggaatctgcagagagcctggct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Caln1", + "molecule_id": "NM_021371", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gccacctctatccatgacccaattctttcaacccagggaccc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Caln1", + "molecule_id": "NM_021371", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgctttcttttcgtcttggaattccagtagccatccagatagca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip1", + "molecule_id": "NM_027398", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gatcatgtgcaaatggtacttccagacagcacctcttttctaat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip1", + "molecule_id": "NM_027398", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctctatggctcaggagaggcaagttgtgacaaagggtggttagt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip1", + "molecule_id": "NM_027398", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccaaatgtgcaccatcctccgatggcctcccaagccaatgtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gm11549", + "molecule_id": "NR_040411", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aactcagacatccgcctgcctctgcctcctgagtgctgggatta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gm11549", + "molecule_id": "NR_040411", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggctattgtatgtacagttcacaccattctcgtgtgtgtgtgt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Gm11549", + "molecule_id": "NR_040411", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acagcctacgtactggccaagccgagggagaagaaacacttcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ctxn1", + "molecule_id": "NM_183315", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gactcacattggacgctgcctacctataatgcacggtacagtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ctxn1", + "molecule_id": "NM_183315", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agggcgttcggagaagtccagtccttacctaccttagctacccat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ctxn1", + "molecule_id": "NM_183315", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgttcgccttcgtgctctgcctgctcgtggtgttggttctgtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car4", + "molecule_id": "NM_007607", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aacttcctccagtaatggcccacttctggatatctgacctctga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car4", + "molecule_id": "NM_007607", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaaggacaagtttgcagtgctggcatttatgattgaggtaggag", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Car4", + "molecule_id": "NM_007607", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaatgacaacggttcagagcacagtattgatgggagacactttgc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nfib", + "molecule_id": "NM_008687", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atgacatgaactctggtgtgaacctgcagaggtcgctgtcttct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nfib", + "molecule_id": "NM_008687", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gagtatccagaacacccataacccagggaactggagtcaacttcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Nfib", + "molecule_id": "NM_008687", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acaatcaggaagtccaagccacagtgatcctgccaagaatcctc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Id2", + "molecule_id": "NM_010496", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aaggaattgcccaatgtaagcagactttgccttttcacaaaggtgg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Id2", + "molecule_id": "NM_010496", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcggaaggaaaactaaggatgatcgtcttgcccaggtgtcgttct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Id2", + "molecule_id": "NM_010496", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acccgatgagtctgctctacaacatgaacgactgctactccaagc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Igfbp6", + "molecule_id": "NM_008344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcctttgccagtgtctccagatggtcaaggaagcactcagtg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Igfbp6", + "molecule_id": "NM_008344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgggctctatgtgccaaactgtgacctcagaggcttctaccg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Igfbp6", + "molecule_id": "NM_008344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aggagtgtacagggcaaaaactctgaccatgacctgggatgggct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Itpka", + "molecule_id": "NM_146125", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cttcgtgcatgaccattgccatcgtgctggtgtgtggctcatc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Itpka", + "molecule_id": "NM_146125", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gcctacagcagatccgggataccctggagatctctgatttcttt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Itpka", + "molecule_id": "NM_146125", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acgaagccgagagcaagtgacccgtgtctttgaggagttcatgca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptprd", + "molecule_id": "NM_001352630", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccgccttgttaatattatgccatatgaatccacaagggtgtgcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptprd", + "molecule_id": "NM_001352630", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atccatgatgcactgttagaagcagtgacatgtggaaataccgaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ptprd", + "molecule_id": "NM_001352630", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aatcctccagatgcagggccaatggtggtacactgcagtgctggt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sv2b", + "molecule_id": "NM_001109753", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tttggcaacagcgagtctgcgatgatcggctggcaatgcctgtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sv2b", + "molecule_id": "NM_001109753", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gctcatggacagaattggaagactcaagatgattggcggctccat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sv2b", + "molecule_id": "NM_001109753", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ggactttgaagaggacaatgattttctgatttacctcgtcagct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vxn", + "molecule_id": "NM_178399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ctgagcatctgaccctcatgtccaaacatagtctggacacttgg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vxn", + "molecule_id": "NM_178399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acatggcggtaagtcaaacccagacttccaggctcttgcctt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Vxn", + "molecule_id": "NM_178399", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgaactgtttgggtatcaggcttgcttctgctgttctgtggattct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Reln", + "molecule_id": "NM_001310464", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aggagttctactgcgctggtggcagccacgccacaatggaaca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Reln", + "molecule_id": "NM_001310464", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atcacctggcacgtcatcgctcagcaccagccgaaggacttcaca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Reln", + "molecule_id": "NM_001310464", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cactcgagcaagcaaaattatgtttgtcttgcaaattgggagcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rprml", + "molecule_id": "NM_001033212", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aacgaagtacctcgcaccacccgggtctggacaccataggact", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rprml", + "molecule_id": "NM_001033212", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cttgccagagttgaagcaccgcgaggaagagactacggagcct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Rprml", + "molecule_id": "NM_001033212", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tcaagtccgagagcatgatcaactttctgatgcaggagcgcagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cnr1", + "molecule_id": "NM_007726", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gagacatgctttccgcagcatgttcccttcatgtgaaggcact", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cnr1", + "molecule_id": "NM_007726", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgaacaagcttatcaagacggtgtttgccttctgtagtatgctct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cnr1", + "molecule_id": "NM_007726", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atccagcgtggaacccagaaaagcatcatcattcacacctcaga", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cacna2d3", + "molecule_id": "NM_009785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaatcccttaagtgtgaacggttaaaggctcagaagatcagacgac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cacna2d3", + "molecule_id": "NM_009785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tggtggtggacagtagctgtctctgtgagtccgtggctcctata", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Cacna2d3", + "molecule_id": "NM_009785", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agaccacagggaacattgcttgcgaagactgctccaagtcct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Plpp4", + "molecule_id": "NM_001080963", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaggagtgattggcctcatttttgcctatatttgctacagacaac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Plpp4", + "molecule_id": "NM_001080963", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgctgccatcttgcccttgtactgtgccatgatgatcgccct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Plpp4", + "molecule_id": "NM_001080963", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttctcgggcctcggtttcacaacattctacctggctggcaagc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adcy2", + "molecule_id": "NM_153534", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caataagcactccttcaacgacttcaaacttcgagtgggtatcaac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adcy2", + "molecule_id": "NM_153534", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "atacatggcagccacgggtctgagtgctgtacccagtcaggagca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Adcy2", + "molecule_id": "NM_153534", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aggagttgtaccaccagtcctacgattgtgtctgtgtcatgtt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip4", + "molecule_id": "NM_030265", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgcctagtgacgcttattaacaagtaaccctaacagcagtaaagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip4", + "molecule_id": "NM_030265", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ccatgcagctctttgaaaatgtgatctagaatgtcagcacctcctc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Kcnip4", + "molecule_id": "NM_030265", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gaagatgagctggagatggctactgtcaggcatcggcctgaa", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sparcl1", + "molecule_id": "NM_010097", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caggatcttgacacactctgaacttgctcctctgcgagcttccct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sparcl1", + "molecule_id": "NM_010097", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cggatgagagactggctcaaaaacatcctcatgcagctttatgaac", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sparcl1", + "molecule_id": "NM_010097", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "acaccaactgcagctggattacttcggagcttgcaaatctattc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Brinp3", + "molecule_id": "NM_001145807", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tatgcctgtgagtgagagcagctttccagactgggagcggacta", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Brinp3", + "molecule_id": "NM_001145807", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "actctgcaagcctgaagtcgctgagtcaaccgatcactacattg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Brinp3", + "molecule_id": "NM_001145807", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gctctttagccttagcaaacggtgccacaagcagcctctcatca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Snrpn", + "molecule_id": "NM_013670", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caagccaaagaatgcaaaacagccagaacgtgaagaaaaacggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Snrpn", + "molecule_id": "NM_013670", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "agaggtggttaaagcagtattgcaacttcaaggtggtggaattca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Snrpn", + "molecule_id": "NM_013670", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caagagtgtcacttgtacccacgacgttctcagcaacagcaagt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly6c2", + "molecule_id": "NM_001099217", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gccatttagttgtggatctctattcttggccctggaggcatgt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly6c2", + "molecule_id": "NM_001099217", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tcctgttgcagcgaagacctctgcaatgcagcagttcccact", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Ly6c2", + "molecule_id": "NM_001099217", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caaagaaggaaactaaagacccgtcagtgcctttctttctgcc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Npy", + "molecule_id": "NM_023456", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gtctgcctgtcccaccaatgcatgccaccactaggctggact", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Npy", + "molecule_id": "NM_023456", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cattctggctgaggggtacccctccaagccggacaatccg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Npy", + "molecule_id": "NM_023456", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "cactacatcaatctcatcaccagacagagatatggcaagagatcca", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Tesc", + "molecule_id": "NM_021344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "caagatgcacattcgtttcctcaacatggagaccatcgccctct", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Tesc", + "molecule_id": "NM_021344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "aatgtggtggaggagctgctctcgggaaaccctcacattgaaaagg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Tesc", + "molecule_id": "NM_021344", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "tgactatcatgtcctacttccggcccatcgacaccaccctggg", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sst", + "molecule_id": "NM_009215", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gggaaacaggaactggccaagtacttcttggcagagctgctgtc", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sst", + "molecule_id": "NM_009215", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "gagcccaaccagacagagaatgatgccctggagcccgaggattt", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + }, + { + "molecule_name": "Sst", + "molecule_id": "NM_009215", + "subcellular_structure": { + "text": "cytoplasmic" + }, + "probe_sequence": "ttcttggcagagctgctgtccgagcccaaccagacagagaat", + "assay_type": { + "text": "in situ sequencing" + }, + "multiplexed": "yes" + } + ], + "channel": [ + { + "channel_id": "nissl", + "excitation_wavelength": 440.0, + "filter_range": "455-515", + "multiplexed": "no", + "target_fluorophore": "Neurotrace 435/455", + "exposure_time": 400.0 + }, + { + "channel_id": "G", + "excitation_wavelength": 514.0, + "filter_range": "525-575", + "multiplexed": "yes", + "target_fluorophore": "Illumina G", + "exposure_time": 1000.0 + }, + { + "channel_id": "T", + "excitation_wavelength": 561.0, + "filter_range": "580-650", + "multiplexed": "yes", + "target_fluorophore": "Illumina Y", + "exposure_time": 240.0 + }, + { + "channel_id": "A", + "excitation_wavelength": 640.0, + "filter_range": "661-691", + "multiplexed": "yes", + "target_fluorophore": "Illumina A", + "exposure_time": 500.0 + }, + { + "channel_id": "C", + "excitation_wavelength": 640.0, + "filter_range": "705-845", + "multiplexed": "yes", + "target_fluorophore": "Illumina C", + "exposure_time": 1000.0 + } + ], + "provenance": { + "document_id": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8", + "submission_date": "2019-04-03T10:13:40.043Z", + "update_date": "2019-04-03T10:13:45.902Z" + } + }, + "imaging_preparation_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/imaging/2.0.3/imaging_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "zador_baristaseq_1", + "protocol_name": "BaristaSeq for genes", + "protocol_description": "BaristaSeq for targeted endogenous mRNA sequencing without gapfilling" + }, + "imaged_slice_thickness": 20.0, + "final_slicing_method": "cryosectioning", + "fiducial_marker": "rolonies", + "expansion_factor": 1.0, + "provenance": { + "document_id": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38", + "submission_date": "2019-04-03T10:13:40.034Z", + "update_date": "2019-04-03T10:13:45.426Z" + } + }, + "collection_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/9.0.0/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "col_protocol_1", + "protocol_name": "Fresh frozen mouse brain embedded in OCT", + "protocol_description": "Fresh mouse brain was dissected and embedded in OCT, frozen, and stored at -80C." + }, + "method": { + "text": "organ extraction", + "ontology": "EFO:0009124", + "ontology_label": "organ extraction" + }, + "provenance": { + "document_id": "caf94c25-8327-4379-b88e-2a6642cd7513", + "submission_date": "2019-04-03T10:13:40.027Z", + "update_date": "2019-04-03T10:13:45.505Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "zador_baristaseq_1" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "da265acd-5601-49c5-855e-d792d51b4042", + "submission_date": "2019-04-03T10:13:42.362Z", + "update_date": "2019-04-03T10:14:03.513Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_2" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", + "submission_date": "2019-04-03T10:13:42.335Z", + "update_date": "2019-04-03T10:13:53.863Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", + "provenance": { + "document_id": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", + "submission_date": "2019-04-03T10:13:42.326Z", + "update_date": "2019-04-03T10:13:53.834Z" + } + }, + "links.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/system/1.1.5/links", + "schema_type": "link_bundle", + "schema_version": "1.1.5", + "links": [ + { + "process": "da265acd-5601-49c5-855e-d792d51b4042", + "inputs": [ + "87f58f88-ef8b-4323-bd19-cde1a2497b59" + ], + "input_type": "biomaterial", + "outputs": [ + "6baa3aff-b2a5-4e49-82f7-25c108a6107a", + "06dcfc33-21da-485f-8e50-49d294713a9e", + "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", + "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", + "76e52f76-ede7-4088-b7f6-d6e5f6152292", + "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", + "be66141d-84a3-457d-a8d2-2f0da8c91dff", + "680cf532-ef0c-4155-b44d-a6ec3920743a", + "08609f14-cf43-4188-b743-4a0b55b17347", + "d10827a1-38f7-457d-9c9f-695f2fc7689c", + "6f8eb2e5-7a0c-4c98-8da0-276457357071", + "ca480df3-71bb-4634-8f71-b6a75aeb9f05", + "03ae5f5e-65ac-4491-b0ce-eefc940e0224", + "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", + "887f3d73-94d2-44ac-9047-67aca5225882", + "896dfacd-206b-4e4f-a846-ba5b070060d9", + "23303c88-01b1-47d0-b770-dca6802caa13", + "3c1a388d-0577-4417-9cd2-ff33bfed9140", + "67e71b34-7157-4a37-b495-0d740772b480", + "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", + "5fbcb75e-3ee3-4429-8ede-b243afa0789f", + "09226b24-6b11-4e4f-8052-2b544be461aa", + "f67473fd-fbf8-4d69-9db1-556938ab5b87", + "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", + "017a2c88-4f6e-418e-bb96-f42f3a220f87", + "30305240-004d-4632-84d4-37d7e7378782", + "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", + "3fd2781b-6855-4eaa-b2fb-81db386adb18", + "40474d53-44a4-4ab2-9f20-61b71291f8aa", + "aaa97d47-7124-4763-a3fc-f6d66eb6d990", + "4adbed13-1cb6-4405-b892-fe8165050691", + "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", + "5402916f-6de1-4842-8585-fc25c153992b", + "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", + "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", + "cb92dd92-570c-4075-8893-eb19dbd837b8", + "b36948c4-0646-42be-9db2-16626a757343", + "c974f4eb-27b8-4ec3-913e-a6eb19572a51", + "febb760d-1e9e-4432-9b88-ce2869a43c44", + "054f40a4-68d0-41db-81e9-00239042d9fa", + "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", + "819e3227-cc54-4919-95af-c1f8194bf729", + "b1e2b9d1-6973-41dc-acdf-95474303561f", + "41ffc783-5ad4-4197-8fd1-c029903c43c0", + "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", + "9014bbaf-a047-4b69-8e28-8356cc99f84e", + "f7acf90c-2b32-463b-b832-8daa8529f727", + "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", + "db22deab-498a-409c-8386-5bf4e60a080c", + "07d600bc-0d55-4a8d-9a48-390fc4169845", + "d0a032bb-cd0e-4873-b346-5cb19e45c202", + "a161f60f-af92-4b09-9df0-dd7ff2bf571a", + "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", + "f10fd9e2-5747-4d7a-8c0c-beba81749011", + "553b6aab-4745-45f8-98ab-de6aadbf48e4", + "3572abe9-6e42-4266-8671-ff24b592065c", + "6882abf6-c247-4167-a18d-e3fec24bcba2", + "15f8b73e-937c-444d-8362-fdf458abb651", + "33b4e374-20ad-4fee-b682-aaa4fc12bec2", + "0e83c507-2211-4561-b75a-92326fb2d4fd", + "912c55cf-0774-4838-8874-352766984715", + "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", + "5b8e3d96-e625-46b6-9689-110fa84fd721", + "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", + "6f3272d7-4a62-4a3c-8c44-11dda8756956", + "168422c5-e89d-466c-9085-f29c02160143", + "7331367a-cc43-4af0-8750-a2921d513f97", + "edf83a09-2e60-4571-b650-abf4c7ff757b", + "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", + "be9d12b6-f8dd-407c-b1d7-844deb6a5023", + "e3e59792-61e3-4bf0-a985-2acec75acafd", + "095ee09c-1605-4c07-9324-b5382f20b78e", + "77b96424-accb-4c6b-884c-756f2bb40929", + "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", + "78518dc1-d38e-4230-88b8-887bdd83f965", + "652dd3c5-6467-41ee-89b3-e4b3361fb533", + "cae3d214-d485-4350-8cd2-f4142aca4aef", + "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", + "de282263-0944-48d4-9819-6182636c76bd", + "bfdbe9b5-42ac-419a-b297-843095de2cc2", + "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", + "e2763cda-3236-487e-9944-5169c0cb8856", + "37018bd8-8537-47c3-a5a9-efb43552f30c", + "a6c9b1ce-2054-4a48-b262-bb0723b8a567", + "8319ee38-f199-49d7-989a-25b451656b38", + "022841b6-8b7c-4d0c-b65f-06ba14253540", + "299dfbe5-05f5-48a7-816b-61036f0e435a", + "6b8b11aa-3600-4a63-a980-93465e681c9c", + "35716168-df43-4273-b52f-72e3d18a47bc", + "6be783ec-c132-4e09-90e0-0958efaf6619", + "a11956c9-c24e-4efb-8af8-1167b3081e70", + "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", + "753c2a57-b5f1-4984-b874-b2b10d582847", + "e0b93b3d-075b-482b-838a-e36d8849607b", + "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", + "c647964a-7796-4dd2-9fa8-b23f012ac14e", + "87a63649-9834-49b8-89a0-310211c1b5b3", + "b2eb5b20-fd1a-403c-8b55-9eec5972d482", + "4b3b36cb-cd90-4526-978d-2e7e8f7add39", + "cdc774f8-3310-4f1f-8c67-03579c253640", + "607370e0-7e7e-4d25-ba5c-957c00a73ac1", + "3240d7ab-568b-4be5-adba-3178b3e8f85e", + "c0b6ee98-677a-41d9-9d80-9ac63d251b08", + "f34c01ec-06df-49e6-bc2f-c50c7f398851", + "2047311b-f3ee-4137-8338-a45166e01d53", + "44ea335a-1991-4504-be12-04f1a332ddfb", + "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", + "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", + "6af3cb41-9e64-4b11-b272-be87adf0fa94", + "7541d176-dfba-4e05-ba45-0c6964271dff", + "8ee1e829-a507-40a5-87ac-7fd8379b87ce", + "8e57554a-abb2-4664-87b6-a397f4da6555", + "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", + "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", + "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", + "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", + "f0cb4244-e19a-46a0-89f1-04143548872d", + "73074f55-d009-41a2-929e-6fd9949bb1dd", + "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", + "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", + "146231bb-1b13-4db5-8157-9d9962cc3a3a", + "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", + "7fe17380-3090-4fc3-9504-02b3f8ed95b6", + "fc405b01-60ca-436f-a06c-2f38f7156a87", + "bae92b53-c6c7-4712-865e-6cff3cba506e", + "83662ec5-a202-42ab-9a47-a701d4f19de3", + "a04957c6-8ce8-4fa6-950d-71812ff3d698", + "9284d3a4-73bd-4aa0-847c-ab273d14185a", + "4d664562-c333-4aaf-bb8b-641e0568733e", + "b533685d-3c60-4483-841b-a054f0a69fec", + "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", + "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", + "3e8510c9-7e31-49bd-bb90-cb55577c2f25", + "463aff9a-ec7e-40d0-be42-c6686af9130d", + "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", + "868efb99-df36-462b-91a2-bb6ca27e842a", + "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", + "36ded48a-869f-4fa8-971f-56bc28298276", + "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", + "e72742a4-23ba-4e5d-a29b-ad449abe8101", + "cd6e1096-f8c3-4eda-957d-b09741d60901", + "903ea376-5153-4fb8-8ffa-e2948951409c", + "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", + "8381d167-c4dd-49a2-b5df-1ae815bbe42e", + "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", + "cf305c60-bb2c-41af-82bf-0631c2a7b0be", + "074290a9-35e1-422f-a3af-e5ed58781b4d", + "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", + "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", + "5165cc56-ff89-42bf-b000-fec4bd57176e", + "545be634-5893-45e0-93b2-dd4ea93e00db", + "2d2e58c6-7c24-4089-bbe9-d47b7482be46", + "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", + "81214e49-318f-4221-bf2c-4ef00cfa916b", + "7fc97754-1121-468b-b1e4-839bde86b6c8", + "7d70d44c-b5d7-47be-9687-e9a775e86251", + "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", + "b7607809-e975-4c32-bff7-375cb2d8276f", + "b8a6c863-626d-4fbf-863b-610cffaac37d", + "45077a5c-ee96-47c0-a84f-9d46cf799338", + "49d82b74-6f1a-415c-93ab-958c60f083b6", + "753b51b7-a909-44e7-bb21-cf2cd18328f8", + "c7ab6349-b2bb-4ba3-9c9b-27d270550052", + "7be770fc-4a56-4f82-a4cf-3cf908d54dca", + "3f5f8537-c1af-4d2e-a732-53b6d4275588", + "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", + "f986c2c2-2823-45a0-80cf-5e6f67958afb", + "7d17d6d6-d038-40c6-b965-6de41ce9c931", + "3d208b38-62c8-492d-9434-21bb66ead16e", + "9a982898-77c6-4a56-8e54-9cb83ff0b235", + "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", + "24b6366f-03ce-4e4d-b50f-90687f3e2b94", + "ec1d0987-fb49-48b8-aaeb-321c659fb67f", + "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", + "6fbcb1c7-ce98-46db-8054-b451b6bca205", + "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", + "aa6fca0d-6a70-4016-a0e4-307878e9ff45", + "ee62cd8d-fb93-4082-980b-213c7a8a0c47", + "bbd60a79-3572-42c0-8e53-b0c566a72f06", + "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", + "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", + "240a67cc-e827-41bf-8ac8-a66bc2797f13", + "7a9b6534-fa1d-4282-a064-11e60e57a322", + "b0af6371-4379-45f0-8c09-f6610833fc46", + "f5ce7a96-cfc0-42c4-852b-386f9a27111d", + "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", + "3dff4add-7d6f-418c-afba-e46864af51d2", + "ab2b7c67-8f13-4388-acd7-e2abb0091f30", + "d9912d93-3d92-48d2-9f75-826fbba3d94e", + "8b37aba2-be5e-4963-8e6f-51a2df8e143e", + "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", + "2d7e88dd-bddd-4289-9556-27d301be0b83", + "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", + "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", + "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", + "e834d3df-8432-40ba-b67d-c7cd0bd7328d", + "d8908d6d-5daa-454d-9082-726054cfddc1", + "c5a7142e-4702-4e84-b7aa-239df2a71ba8", + "f69e44ef-cf23-4571-8dad-e44222697974", + "ea72f81c-2c58-43e2-acca-294254f470f7", + "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", + "6928ac1b-fd1d-436c-bfc6-4087c65809d7", + "07a7b938-435b-4804-b140-c255957b6532", + "3d532a7b-55e7-4461-afbc-65ef76403384", + "bab40245-28bd-49a2-8be0-ba109fe41c91", + "9d577bd4-3a27-48be-ad7c-8c44cf803cda", + "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", + "21a043b6-6dde-41b9-b20e-74b961da8b88", + "11280200-1803-4110-aa84-2808776c2d50", + "86df5269-576b-4d18-a0ce-6e2b2a36d51b", + "e524ff4e-95fa-4561-bfd3-276cba79e664", + "3d5737da-b1ab-48cb-a26f-d420e53edccd", + "44cf15ec-3d4e-4698-bb14-107c34891191", + "6242cdf3-fd6d-4479-a08a-1747818fd978", + "bc60bbd4-8b09-425c-b507-9da24a84f412", + "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", + "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", + "5f67c32c-a154-4620-8603-0b64979b04a4", + "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", + "dcee6df0-9e87-4935-8873-f8d30d449d76", + "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", + "e6d00b0c-3641-4ec4-a553-8fd742193dba", + "e5034863-0528-4f55-be95-c8501c29f9fe", + "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", + "33d332c9-aefe-4db5-8830-b8daddaed0d2", + "bb3b6fc7-0902-432d-bad1-6b3f61951314", + "2b734e88-3a33-4c73-92bb-82e0b8f8c13b" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "imaging_protocol", + "protocol_id": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8" + } + ] + }, + { + "process": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", + "inputs": [ + "edd1d525-a6ae-4658-a6bf-6c31d7ab6948" + ], + "input_type": "biomaterial", + "outputs": [ + "87f58f88-ef8b-4323-bd19-cde1a2497b59" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "imaging_preparation_protocol", + "protocol_id": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38" + } + ] + }, + { + "process": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", + "inputs": [ + "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4" + ], + "input_type": "biomaterial", + "outputs": [ + "edd1d525-a6ae-4658-a6bf-6c31d7ab6948" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "caf94c25-8327-4379-b88e-2a6642cd7513" + } + ] + } + ] + } + } +} \ No newline at end of file diff --git a/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/manifest.json b/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/manifest.json deleted file mode 100644 index 65a9ac759..000000000 --- a/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/manifest.json +++ /dev/null @@ -1,5582 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "8079eb90", - "indexed": true, - "name": "imaged_specimen_0.json", - "s3_etag": "038fab03a6a415e07fa01214f058cb01", - "sha1": "a5d1b0e5457d029d0fe0f2c19c0c2b2f45c67083", - "sha256": "dcabfb5b083bb3ec5ef482c6266aa46617da50712520f911542d7428228e315d", - "size": 896, - "uuid": "87f58f88-ef8b-4323-bd19-cde1a2497b59", - "version": "2019-04-03T101350.866000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "d46a73e9", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "889570fe22be551b40a308389b62aef7", - "sha1": "f2b51ec11480e4b8613d1adef1beb5850847f57c", - "sha256": "86b0f47a079ed4226c6297c02196c0d9ac3b75666790a0bfa2aed117c158883c", - "size": 1006, - "uuid": "edd1d525-a6ae-4658-a6bf-6c31d7ab6948", - "version": "2019-04-03T101345.512000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "387a6170", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "3ed8a682ec9b84753e948b05aa7b50d3", - "sha1": "c054bb3fdbe4a5c87b2cbbf8af58c9e32445b9af", - "sha256": "3bcd6249e1982a1400a67330c8eb6c72c1c2a6bb94e3f27df9abbd75a2cd4fca", - "size": 1461, - "uuid": "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4", - "version": "2019-04-03T101345.427000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "15c0476b", - "indexed": true, - "name": "image_file_0.json", - "s3_etag": "78969f572594bd6ec8db29581fc3fc49", - "sha1": "821bcb53fadcf5a54df2b80912509394bcf85251", - "sha256": "39477700ca5e11cf9d50e14e734e8b84b9767260f293bfce799fc24cae174953", - "size": 414, - "uuid": "6baa3aff-b2a5-4e49-82f7-25c108a6107a", - "version": "2019-04-03T101544.995000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b2bc1297", - "indexed": true, - "name": "image_file_1.json", - "s3_etag": "352bd9b676d359440b0ab6610d82f880", - "sha1": "92ace2e3683c59df707f6c2cea97a245211b29e4", - "sha256": "fd9e953ea6a0e58915541e4831e77908b2bbb7fe75f8f434bac1f0cc888f71a4", - "size": 416, - "uuid": "06dcfc33-21da-485f-8e50-49d294713a9e", - "version": "2019-04-03T101544.993000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e80dc77a", - "indexed": true, - "name": "image_file_2.json", - "s3_etag": "effc7cc9060288b3fcf6a5a396b8610c", - "sha1": "a55cceb5feb41a61b3e862bab40ab2e07faf527c", - "sha256": "8668a42e2f5e3b222e5c4b9dacf966d4c3a8f9dccd78cb9ca9e6f5ec6204be4e", - "size": 429, - "uuid": "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", - "version": "2019-04-03T101551.032000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b57b1b8b", - "indexed": true, - "name": "image_file_3.json", - "s3_etag": "83e170b0259053817181e116c761c10d", - "sha1": "891e174eaa01454d5c1bd1c2535ec38e2df4a529", - "sha256": "cd07df0ccb235bed07bc0e721465c24ccf4c06d71c5757c63a385be396b4c513", - "size": 429, - "uuid": "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", - "version": "2019-04-03T101547.812000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f6331c39", - "indexed": true, - "name": "image_file_4.json", - "s3_etag": "9faadbc50ac5600af400235f8619f2db", - "sha1": "1f3eb773f5765e4f05fda64697b4ed01eb6ca829", - "sha256": "634269e93a580aa1c58159983acff3cff9d8b0324260ca91932bf600c1441916", - "size": 430, - "uuid": "76e52f76-ede7-4088-b7f6-d6e5f6152292", - "version": "2019-04-03T101551.115000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8920d5a7", - "indexed": true, - "name": "image_file_5.json", - "s3_etag": "1e2fa48d2a074dce3710d3f77fda11f0", - "sha1": "c4f24b94ad65c3ee335e51282e0e406c520b45e2", - "sha256": "6aebe94fb11a4fa44e63d0ee0018938e2051608093e22674a66fe6d9fa35d704", - "size": 430, - "uuid": "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", - "version": "2019-04-03T101554.073000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "56db8826", - "indexed": true, - "name": "image_file_6.json", - "s3_etag": "7b928c34176f343317e854080601345c", - "sha1": "20b719ad5ecaa8028efc6a67d7e192447958db7f", - "sha256": "4f4a790c166529d6fc9621fcbe38e81258e81626dcc46cc9e22f79a0008cbdc4", - "size": 430, - "uuid": "be66141d-84a3-457d-a8d2-2f0da8c91dff", - "version": "2019-04-03T101551.125000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7e67e8ea", - "indexed": true, - "name": "image_file_7.json", - "s3_etag": "eb52641a787d20c9cd079997a79a5260", - "sha1": "f9fb054da4ad78ca1f26c196c4f9494a6fb9bb30", - "sha256": "5e519556738cf22b5e064429fd20f14218cddd0bc07fabcd249373ced79ba62d", - "size": 430, - "uuid": "680cf532-ef0c-4155-b44d-a6ec3920743a", - "version": "2019-04-03T101550.982000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a09c647e", - "indexed": true, - "name": "image_file_8.json", - "s3_etag": "23317a256997a1f7185b08afb0d5d425", - "sha1": "0219f2b9aa844e770b1f58b55aab4ecabaeeca7d", - "sha256": "f18c6fab1c9b5e27c8e5e653e7299cb59801e8d5fd8220d9c9d0afc86d7d7ff1", - "size": 430, - "uuid": "08609f14-cf43-4188-b743-4a0b55b17347", - "version": "2019-04-03T101547.817000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0d5e37c4", - "indexed": true, - "name": "image_file_9.json", - "s3_etag": "abf43be05ab7f890a121d6039aee5750", - "sha1": "dd1a6c404b22f8bf09ef2d880b26a24ff2a66604", - "sha256": "afaf14187b58ad4f3e74329550b4b4163f85a5a9e7cdf36c82735094502c8291", - "size": 430, - "uuid": "d10827a1-38f7-457d-9c9f-695f2fc7689c", - "version": "2019-04-03T101544.996000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8b291c4a", - "indexed": true, - "name": "image_file_10.json", - "s3_etag": "ed31588f7ca14e039f8136f7dc30372b", - "sha1": "792f631014297c0d69add49b8db0ac24f5f664ee", - "sha256": "0a30e13100abf47ee849ee3f62c11dc9409f90cd631f3f584d46d8623bcd6d71", - "size": 430, - "uuid": "6f8eb2e5-7a0c-4c98-8da0-276457357071", - "version": "2019-04-03T101547.821000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a3fcc566", - "indexed": true, - "name": "image_file_11.json", - "s3_etag": "7fdffc464baaa3a9657051b6c05bffd8", - "sha1": "8122461a763c16ce6503f55d7efbefdad4d70887", - "sha256": "9ca32bea5e4ca1fa061592be5f4d390aed852c383253f6c019db8b58dc5ec85e", - "size": 429, - "uuid": "ca480df3-71bb-4634-8f71-b6a75aeb9f05", - "version": "2019-04-03T101547.796000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3f77b944", - "indexed": true, - "name": "image_file_12.json", - "s3_etag": "f2a4015ce36f854b62f5769a5f20bb1c", - "sha1": "8dab42ab4a2c2dc411bfa10a1186ed7c4e2ed420", - "sha256": "a14886279ea8319351bc1da333bf3c087eebbf10b170d9ff9f557293b845b5cb", - "size": 429, - "uuid": "03ae5f5e-65ac-4491-b0ce-eefc940e0224", - "version": "2019-04-03T101548.018000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "290467c1", - "indexed": true, - "name": "image_file_13.json", - "s3_etag": "1103eacb609b98885f4c7a771690d527", - "sha1": "53bdebd939a1c4521dd4a5430b61f71a187b02b1", - "sha256": "9e14b02fb42e2e6d7b4b408274b8262ac8438065e3a368ad483e8ae731907705", - "size": 429, - "uuid": "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", - "version": "2019-04-03T101551.040000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "fc68d967", - "indexed": true, - "name": "image_file_14.json", - "s3_etag": "0e8c05a96c95c62a756e2be8eda7d864", - "sha1": "18b2898720e44376e96d08e289d8788a6dda009c", - "sha256": "29963b642a9e628b630d9591a078c138ff62ed23ecb1d0f0601be29f9c4d6b24", - "size": 429, - "uuid": "887f3d73-94d2-44ac-9047-67aca5225882", - "version": "2019-04-03T101551.029000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1b9ad91f", - "indexed": true, - "name": "image_file_15.json", - "s3_etag": "18b349c44199e87aed42a8e54bd7419d", - "sha1": "4a93629d4d59d8676bdf567b020bbe201e430e88", - "sha256": "0b9a89e36e3690da9259e43290fe70b60603009d00fe39452ba0bbf4dfbb9418", - "size": 429, - "uuid": "896dfacd-206b-4e4f-a846-ba5b070060d9", - "version": "2019-04-03T101547.819000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "27cf3a08", - "indexed": true, - "name": "image_file_16.json", - "s3_etag": "2883ccabfd63c0110b8ca0139ff62493", - "sha1": "51f02c93335d069692528ff7b4b4272b3ad4f76f", - "sha256": "24073054e30b0de495c92dcc02391d8b8c8b1422a655c8bb5f132941c3233319", - "size": 429, - "uuid": "23303c88-01b1-47d0-b770-dca6802caa13", - "version": "2019-04-03T101547.812000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "de878d17", - "indexed": true, - "name": "image_file_17.json", - "s3_etag": "6df775c743947206fc5b6d054135a761", - "sha1": "b53d6fc48f41eb5d4014dbc0468a1c60aec29b83", - "sha256": "5318ef81c7636ad059452277bbaa1b15b120d489a355d221ee58216818405641", - "size": 429, - "uuid": "3c1a388d-0577-4417-9cd2-ff33bfed9140", - "version": "2019-04-03T101547.821000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "76b4e019", - "indexed": true, - "name": "image_file_18.json", - "s3_etag": "02ff24b7bbf5995acb045ac05fb17065", - "sha1": "82886a97a3933d232acb4da65c78fd157d0aa26f", - "sha256": "f0cd2b5a3ff27f319d78edcb6ae8649768810273a759af44ef249f04d2b4df13", - "size": 429, - "uuid": "67e71b34-7157-4a37-b495-0d740772b480", - "version": "2019-04-03T101551.111000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a2a8f359", - "indexed": true, - "name": "image_file_19.json", - "s3_etag": "ce0597ac8c4d8814a2e603eec2965ea9", - "sha1": "8965dfd33a90ff2a03b15bfcba57893e456042ba", - "sha256": "610fa9de68fc0c392e981e7ed61bcab9c656aae9debf6067cc6a5eca7a31150c", - "size": 420, - "uuid": "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", - "version": "2019-04-03T101551.054000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6f83b0eb", - "indexed": true, - "name": "image_file_20.json", - "s3_etag": "48292580773c094adec3a832e7968944", - "sha1": "d7935356c353ad1b8aa0b0665bd541be3718ef24", - "sha256": "5415fddfae88e6ad9a1248b52f041c541a91568bdd528a729cf296a66e07990f", - "size": 412, - "uuid": "5fbcb75e-3ee3-4429-8ede-b243afa0789f", - "version": "2019-04-03T101551.028000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7a5f8396", - "indexed": true, - "name": "image_file_21.json", - "s3_etag": "4a0074b189ce3989a5315274668f47f7", - "sha1": "65ba0cc95f878158865ea52129e4368c7a4b7117", - "sha256": "517eef28842bbdedb80bafbd691dbbc9218a14a197ba1d094b293cd1f3aa5d6b", - "size": 436, - "uuid": "09226b24-6b11-4e4f-8052-2b544be461aa", - "version": "2019-04-03T101551.126000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f9d5a275", - "indexed": true, - "name": "image_file_22.json", - "s3_etag": "40bc3e0ea2d8f5c200e188e62105f352", - "sha1": "b6d3ab14c34c3c9926fec8b9ddbcad9af3495b6b", - "sha256": "0bb8b449b7c18075f3f157facd415fef08888124bbdac344873a8887d66a2a50", - "size": 436, - "uuid": "f67473fd-fbf8-4d69-9db1-556938ab5b87", - "version": "2019-04-03T101554.317000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "438b1035", - "indexed": true, - "name": "image_file_23.json", - "s3_etag": "34fed4de23ea62eee190201f0ca332b2", - "sha1": "31ec656cde738741d43f7bff141132e7639c15a3", - "sha256": "fb46973e9398e82e5e842bab20db97b5e7464a14c8ef8e0bca8ac8b90b1d1215", - "size": 436, - "uuid": "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", - "version": "2019-04-03T101550.940000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "69359cac", - "indexed": true, - "name": "image_file_24.json", - "s3_etag": "fb0fb60fcb0f76f67edc4a61ecea4b39", - "sha1": "684a152a02274a7dca17d263d3ea313b49a0eb71", - "sha256": "1d2b9a93a4188ddec501b996fde7ec2fc38f060ed0c2cb82b30e1584353bb44a", - "size": 436, - "uuid": "017a2c88-4f6e-418e-bb96-f42f3a220f87", - "version": "2019-04-03T101550.977000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4811eaf7", - "indexed": true, - "name": "image_file_25.json", - "s3_etag": "ad0643bdfa0eb18c8d67f9efa7bd602c", - "sha1": "f68e533ecb1f121f52631c6010619eb47c3968fa", - "sha256": "6989e2d3d621b3f9fcb307bd7905c745cf36fba395e6a061e3681e7fe31097f1", - "size": 436, - "uuid": "30305240-004d-4632-84d4-37d7e7378782", - "version": "2019-04-03T101551.136000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d89e7350", - "indexed": true, - "name": "image_file_26.json", - "s3_etag": "45bbd1cd2580a55e3eeaa20e73e8acad", - "sha1": "98dae7c81669f3b0dbf2ddef9c78db8d13311411", - "sha256": "28393237e14ce9891dbc646df4a7c562333f925cdc3189184893b630b7678048", - "size": 436, - "uuid": "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", - "version": "2019-04-03T101551.052000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "442d4d84", - "indexed": true, - "name": "image_file_27.json", - "s3_etag": "8f90d9f8fb508084508fc300ef4bb4d0", - "sha1": "5092ba88250f093030a7ab84774df73210cdc08b", - "sha256": "afd4ea38d62c45ff93a5abfe15d892a54c5fe188347e1c5bf7595c2d4a814748", - "size": 436, - "uuid": "3fd2781b-6855-4eaa-b2fb-81db386adb18", - "version": "2019-04-03T101551.027000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0c4146ab", - "indexed": true, - "name": "image_file_28.json", - "s3_etag": "80856577d5972945a7afe21ae2c3835f", - "sha1": "c20bcbca57adf6ef800ed44fd8201cf626a750e1", - "sha256": "f00fb2b5d6da250b1d50d35f447d0cbd4ed99b3d2e3acccd9b4a0ae22e8bc56f", - "size": 436, - "uuid": "40474d53-44a4-4ab2-9f20-61b71291f8aa", - "version": "2019-04-03T101547.810000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ce7e2b8b", - "indexed": true, - "name": "image_file_29.json", - "s3_etag": "e00f6a988100b240e32a67e570b7ba38", - "sha1": "2410904c1785fb9bf0daa3171474a0fecd979ae3", - "sha256": "ccd379770ac524045e495ea08411378a90e6c2970dd329c391da22bb842cb681", - "size": 436, - "uuid": "aaa97d47-7124-4763-a3fc-f6d66eb6d990", - "version": "2019-04-03T101550.958000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b9183afa", - "indexed": true, - "name": "image_file_30.json", - "s3_etag": "28e9cd98bdef0d045db1ddcb23abe0f3", - "sha1": "428ef83c0b71284a0edb85b976579d381127ffb7", - "sha256": "472be58ecb075755d87eb778b337c7697d8885ea6d97c7f48b3b1266c14d60a0", - "size": 436, - "uuid": "4adbed13-1cb6-4405-b892-fe8165050691", - "version": "2019-04-03T101551.040000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "571ac117", - "indexed": true, - "name": "image_file_31.json", - "s3_etag": "fdf353efd62c1d32f79002132495b9ec", - "sha1": "a06c917ba4016a7de26bf2f91931d55e085ad078", - "sha256": "b12f58e60c5d2e30be93e6fa39ae8f8b73781f07722b24158a36dc19893bb1f2", - "size": 436, - "uuid": "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", - "version": "2019-04-03T101551.020000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8db2e4c7", - "indexed": true, - "name": "image_file_32.json", - "s3_etag": "d67dc364c58e8bd22753e80490aba312", - "sha1": "c7426a20f166f6657c7cf1ea60fa33d74e09cf5f", - "sha256": "cea402f913566a622705f61d4b339bbf4ca6b9b0a0ba60122c742dfc41f8bb6f", - "size": 436, - "uuid": "5402916f-6de1-4842-8585-fc25c153992b", - "version": "2019-04-03T101551.039000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "291b9622", - "indexed": true, - "name": "image_file_33.json", - "s3_etag": "c610bd7d6df298676d3ab9e03974c6d4", - "sha1": "fc80e91c6acb500470e0c78be820c0d09364e09d", - "sha256": "e28f94fdbab9f4cc65e509289c0ed8175c2fe6a74e4180c7f22759619e206abd", - "size": 436, - "uuid": "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", - "version": "2019-04-03T101600.740000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c5d54b4d", - "indexed": true, - "name": "image_file_34.json", - "s3_etag": "71a459e0e4ebe380e4f5ad699dfe39e5", - "sha1": "a870a769c567e00fd726b069f591e0509a705dbc", - "sha256": "1834e21010a32a18fbaa3b0414efb7c6ae7e159d3333df54bb678f24881aff95", - "size": 436, - "uuid": "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", - "version": "2019-04-03T101600.295000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "81bfdbb5", - "indexed": true, - "name": "image_file_35.json", - "s3_etag": "5a9051abd6e6ed9cee00abd59c9862f1", - "sha1": "fc71295b18c68520da079e4560583f89ffa459a6", - "sha256": "205f951bbc20d1c1ca49520908cf7d655478db083dd96d62f176979454893392", - "size": 436, - "uuid": "cb92dd92-570c-4075-8893-eb19dbd837b8", - "version": "2019-04-03T101600.289000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9b22db0b", - "indexed": true, - "name": "image_file_36.json", - "s3_etag": "c55531713486c10a999da38866629fff", - "sha1": "8b80501e4488e6a73b6164926aa9e938571fef64", - "sha256": "552fe82b645d82a4ab8dec0f3e975b585a471b6ec71dad714d19d37a619295f8", - "size": 436, - "uuid": "b36948c4-0646-42be-9db2-16626a757343", - "version": "2019-04-03T101557.643000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "147e5d0a", - "indexed": true, - "name": "image_file_37.json", - "s3_etag": "17a6a4d22efbf306b66d00457f0609f1", - "sha1": "17abc1637628aaa85c60cc5d2e3d8e14e01018ee", - "sha256": "d4296b9d358855fe9af556d6aee1d8ccd13901e4276c3b8e174ba9db65df7a73", - "size": 436, - "uuid": "c974f4eb-27b8-4ec3-913e-a6eb19572a51", - "version": "2019-04-03T101557.265000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f72b1879", - "indexed": true, - "name": "image_file_38.json", - "s3_etag": "dcdb7889b5563daff4401efdf07424f4", - "sha1": "cd81502dc2051090a806608de2284e18856b76b4", - "sha256": "8e16a4bfe71a99a57492f2de4d6a462713d5c5a90bd8ec67008a5bc69f18e31a", - "size": 436, - "uuid": "febb760d-1e9e-4432-9b88-ce2869a43c44", - "version": "2019-04-03T101603.118000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7ba1aac8", - "indexed": true, - "name": "image_file_39.json", - "s3_etag": "fed9a54f347c79af8759da6c18fd8797", - "sha1": "52782e2d062d6491bb4dc0096de07396a3053599", - "sha256": "c333fe3b4e6856c7e0f45e61b44dc2aad0a819d3a446e2f1ebde6451c4673418", - "size": 436, - "uuid": "054f40a4-68d0-41db-81e9-00239042d9fa", - "version": "2019-04-03T101554.056000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "26797393", - "indexed": true, - "name": "image_file_40.json", - "s3_etag": "fb9706107509f936c61eb3ed7473c37f", - "sha1": "92a5c2a82ae00336de23e896d1775ac1079032a4", - "sha256": "f57b95d9d82aa33c9b1ff61c4b4c8471e243b1e190dee06fdc46bc82a9840ddc", - "size": 436, - "uuid": "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", - "version": "2019-04-03T101557.262000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a21721ad", - "indexed": true, - "name": "image_file_41.json", - "s3_etag": "e93177fa673e8f89c9efcc51e5b56d69", - "sha1": "9492388cc20efe206f452e3be6615be353f3f6ec", - "sha256": "1b65fa5a886865bc8323393642034c144e9af72f295f44a5bf0d00b1a1fe0fed", - "size": 436, - "uuid": "819e3227-cc54-4919-95af-c1f8194bf729", - "version": "2019-04-03T101600.245000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8e944c70", - "indexed": true, - "name": "image_file_42.json", - "s3_etag": "b489a896e0b737d725f3f8578d534384", - "sha1": "6bfe2e4ba1e0c332b44e09bb9e196a4960b787ba", - "sha256": "2403b7b6306342055a0da03f1598da76a6602912a7db0ed480a9ec8ba058edf6", - "size": 436, - "uuid": "b1e2b9d1-6973-41dc-acdf-95474303561f", - "version": "2019-04-03T101600.392000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "18f0255d", - "indexed": true, - "name": "image_file_43.json", - "s3_etag": "fc8e33e1a5986dcce6dcd8d35047db9d", - "sha1": "e07b9a462b46380bc61904da44e719a7efe0df60", - "sha256": "6400cd38b14ef3a2ed4259d63836e6a5ccb62c4b65a7a8568dbc5201024f0219", - "size": 436, - "uuid": "41ffc783-5ad4-4197-8fd1-c029903c43c0", - "version": "2019-04-03T101600.242000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "bc005686", - "indexed": true, - "name": "image_file_44.json", - "s3_etag": "530ae4741bece22de276dd91e3ffa50f", - "sha1": "7e06635cca390c555051dbe62a6b7cd36e7b56a7", - "sha256": "69541c6253b9cb9fd37845812eacf0d6ca58ebf0294837f2c02e30fb0c03157b", - "size": 436, - "uuid": "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", - "version": "2019-04-03T101554.163000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7d5688f2", - "indexed": true, - "name": "image_file_45.json", - "s3_etag": "a9351b5ba3a3022072636c6f6fcdb51c", - "sha1": "0adf628f224663418d182c681549f3f405f1be9c", - "sha256": "770b880f656b6aa00efdf008791444c126efe1fd297efca8c5a7c7097ea900dd", - "size": 437, - "uuid": "9014bbaf-a047-4b69-8e28-8356cc99f84e", - "version": "2019-04-03T101554.097000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "49d735f5", - "indexed": true, - "name": "image_file_46.json", - "s3_etag": "316b6a48cb999f8a91aebf262eebdb85", - "sha1": "a011d8c48da4c80098bf0147a5abf5949259c5d5", - "sha256": "2bd3f30fd85544254ba37fe941a8328ab3fae7e66fe53f69c48f2b6d9e262421", - "size": 437, - "uuid": "f7acf90c-2b32-463b-b832-8daa8529f727", - "version": "2019-04-03T101551.110000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a7afb522", - "indexed": true, - "name": "image_file_47.json", - "s3_etag": "48de5c790860cfa4b31dbda89fb14848", - "sha1": "3d5adb3c12680dd6b482b82536f4cd487136d0d3", - "sha256": "5bc6eb1cb42a02ced63e8a010cde537c78b3ff34c68ec1d178fd227248a7cd41", - "size": 437, - "uuid": "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", - "version": "2019-04-03T101554.068000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "477f3b73", - "indexed": true, - "name": "image_file_48.json", - "s3_etag": "9ee3a28b10bc548bf3e3e6b255d51b4a", - "sha1": "dada78babeba45bfb4b77ac7ae8be3c3d4481221", - "sha256": "e4c440e517c39a6c3f0ad820f97fda13929d46868355988673c2713eaaa0db5f", - "size": 437, - "uuid": "db22deab-498a-409c-8386-5bf4e60a080c", - "version": "2019-04-03T101554.171000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5a11b2c6", - "indexed": true, - "name": "image_file_49.json", - "s3_etag": "b9920ca8d3aa46ee824b24676d14606c", - "sha1": "78cead43f864e56baf51c1fb43bed2fbe92e044b", - "sha256": "602346da07c3d1d779290fd3fbdcb9046a2929a8bacc384a9b252e70a0a5aacf", - "size": 437, - "uuid": "07d600bc-0d55-4a8d-9a48-390fc4169845", - "version": "2019-04-03T101554.155000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "df5272b6", - "indexed": true, - "name": "image_file_50.json", - "s3_etag": "e394067e17591779b210e0f1aa5217c2", - "sha1": "4a421755b723f08cac72ec4fb7ee96fd551344a4", - "sha256": "cd289cc2db430f92925bc05e40dd5cb1c6ee7c2a3f9c55a3c1f36fbeeb46580a", - "size": 437, - "uuid": "d0a032bb-cd0e-4873-b346-5cb19e45c202", - "version": "2019-04-03T101554.147000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a615de2d", - "indexed": true, - "name": "image_file_51.json", - "s3_etag": "9fd36791a8c43c2303cdb0e17cd33063", - "sha1": "396a37e54eaef8f4fcb4851723b4cb51c80b964e", - "sha256": "4870a840ce29281fa93e8e6a7c8bbde6f78e9c0832e6067432333c00b7e75f60", - "size": 437, - "uuid": "a161f60f-af92-4b09-9df0-dd7ff2bf571a", - "version": "2019-04-03T101554.146000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cc86f251", - "indexed": true, - "name": "image_file_52.json", - "s3_etag": "e32d50d29dc7257124e623a845ce5009", - "sha1": "4de19aae0120499c1ada6758a2a7c6846673c8d2", - "sha256": "bd3c7aea6543616f7861d9ab086c8147df04f39d64b824a4a2696922faac606d", - "size": 437, - "uuid": "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", - "version": "2019-04-03T101557.073000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "331abd76", - "indexed": true, - "name": "image_file_53.json", - "s3_etag": "6431956d2e565c3b1ae3f2846d2e83c9", - "sha1": "b8e4f97a697ce1f604e5b1da059553157ee14c85", - "sha256": "b64c80ab42af729c766d7057252b4792d81976491eaeef548f5d2e5e22f1592a", - "size": 437, - "uuid": "f10fd9e2-5747-4d7a-8c0c-beba81749011", - "version": "2019-04-03T101554.011000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d443e379", - "indexed": true, - "name": "image_file_54.json", - "s3_etag": "28cee81f519bc1d49494e1e3d19537d8", - "sha1": "1430224d8d07c762faf15bf9d85f6a69cf22978a", - "sha256": "f530d71a7102885e24310411cff4052f2ed8c26377f49debd65443c824b0d9b2", - "size": 437, - "uuid": "553b6aab-4745-45f8-98ab-de6aadbf48e4", - "version": "2019-04-03T101554.255000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "17c75bdf", - "indexed": true, - "name": "image_file_55.json", - "s3_etag": "94ecbf24a51f24dcdc2f9a7c215841f5", - "sha1": "0ac5b3148ab528d1f59c0e66600ae99a369b9e28", - "sha256": "77bfaab517f05ded0d779f672033b4fe36a53d8a34d67431b227632c520a58ad", - "size": 437, - "uuid": "3572abe9-6e42-4266-8671-ff24b592065c", - "version": "2019-04-03T101554.233000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5c8d1fd8", - "indexed": true, - "name": "image_file_56.json", - "s3_etag": "a2aff7c7341b8e31e3788539d3723155", - "sha1": "c426fdd2f0fd279ef55023ead517e3ba79d5f936", - "sha256": "244c172dc730e03c4775435ca9d8d6209ae6561d1fa244557e72650d76ec68d4", - "size": 437, - "uuid": "6882abf6-c247-4167-a18d-e3fec24bcba2", - "version": "2019-04-03T101554.124000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b5a3d1f0", - "indexed": true, - "name": "image_file_57.json", - "s3_etag": "55ed2fa1bf8138a0a3c00e0f08cc4bca", - "sha1": "d0756edfcd1ebcd7508bb90a891c3068f6430414", - "sha256": "09ee934bb00c75597a81e8619f1bf36a37d0bfd4a120a4a38b8ccdfe4ee49f62", - "size": 437, - "uuid": "15f8b73e-937c-444d-8362-fdf458abb651", - "version": "2019-04-03T101554.117000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "627f0d21", - "indexed": true, - "name": "image_file_58.json", - "s3_etag": "b02ac497470cbf16eac17fab69f55e69", - "sha1": "783f66868b6e8d15e834bc3fcaff82a4cfc45a1d", - "sha256": "b492fc206e7af25ad25cd703477562e33f6b55a8d729f554762707d47518520f", - "size": 437, - "uuid": "33b4e374-20ad-4fee-b682-aaa4fc12bec2", - "version": "2019-04-03T101554.178000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0b92cd9f", - "indexed": true, - "name": "image_file_59.json", - "s3_etag": "1b95b4be0212ee7f892a2ce76f7c3c01", - "sha1": "5281e448041b0486840c5192760c57d756a1417a", - "sha256": "9c59cb6b48fe2f9c2e2dc1af39c963fa08d04d62db044e25343c91002c18dd74", - "size": 437, - "uuid": "0e83c507-2211-4561-b75a-92326fb2d4fd", - "version": "2019-04-03T101554.229000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "36893dd3", - "indexed": true, - "name": "image_file_60.json", - "s3_etag": "17f6ebe07687b8b410eed108625fa619", - "sha1": "8401c957587084fcda65d0c437f4c231b8b27e43", - "sha256": "264ba999cd45d6439826e2627a2b09c39e6b15e68efc3891f2daff7185b4ce16", - "size": 437, - "uuid": "912c55cf-0774-4838-8874-352766984715", - "version": "2019-04-03T101554.213000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7078c29e", - "indexed": true, - "name": "image_file_61.json", - "s3_etag": "d93bf47f7a357c6a83e44f3679a8b285", - "sha1": "01e6f534e7ce61612dd8ad8cc1aa18f1d659fac8", - "sha256": "07c595226f8dff95523046921d22c770ef035dc177670deaff09efec9b9a5bc2", - "size": 437, - "uuid": "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", - "version": "2019-04-03T101550.981000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3939945a", - "indexed": true, - "name": "image_file_62.json", - "s3_etag": "e2310bdd90fad3e5ff497cb27eae01c8", - "sha1": "f420e9b5654bf60206202a773eb3baacfc612dc5", - "sha256": "c8e688f4d5792c15eff9b60c17e7cb11eb5b9fc22df4b8686da5462ef6c3ebf8", - "size": 437, - "uuid": "5b8e3d96-e625-46b6-9689-110fa84fd721", - "version": "2019-04-03T101554.097000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d1a6ff37", - "indexed": true, - "name": "image_file_63.json", - "s3_etag": "6dbbbe2b32ce74d079b2bef920f1b746", - "sha1": "eedf5323a2543af65d286942be0c6109a301bda9", - "sha256": "1a437156830c17b703cf0ab7b86263a941cb6163eebc323ce1a0986d9b6ee86d", - "size": 437, - "uuid": "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", - "version": "2019-04-03T101557.225000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "130f873c", - "indexed": true, - "name": "image_file_64.json", - "s3_etag": "5ac0b9eeef7510891bc75fd5edf5a18d", - "sha1": "befe8f910959c5bf73d830eee47c30b5336b8d6e", - "sha256": "f80c0c38eba9dc34691c3eb73b7992d6133164b99b36fa1ada3fedfffc7a3db2", - "size": 437, - "uuid": "6f3272d7-4a62-4a3c-8c44-11dda8756956", - "version": "2019-04-03T101553.957000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5430e9f8", - "indexed": true, - "name": "image_file_65.json", - "s3_etag": "f143f2b13c13e3a0ef33d76a35edffd0", - "sha1": "06a516e9cb7e845e2d25550d4d46952b91afc610", - "sha256": "c68187461c589cf329d0388cec56220dccdbc18f731cae340afe945332e3f390", - "size": 437, - "uuid": "168422c5-e89d-466c-9085-f29c02160143", - "version": "2019-04-03T101554.119000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "68502f42", - "indexed": true, - "name": "image_file_66.json", - "s3_etag": "358bbcce28a2897636b9d2e9299bba07", - "sha1": "fd9c1c53771b3aef5b94439c6342a250edc31c24", - "sha256": "3e78b422abd43d4b98ac9fc7c1e194f0bd3bbba37d0dc85059045d02ee677922", - "size": 437, - "uuid": "7331367a-cc43-4af0-8750-a2921d513f97", - "version": "2019-04-03T101557.287000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6649f82a", - "indexed": true, - "name": "image_file_67.json", - "s3_etag": "62579375c4de1c7a4e989f77f3b3d176", - "sha1": "9a9ea328e726e620b6b62f67537757af3b02d86e", - "sha256": "22d6abeef0ef609847afe1ab25316816f47b37e191303574780496bc6def3513", - "size": 437, - "uuid": "edf83a09-2e60-4571-b650-abf4c7ff757b", - "version": "2019-04-03T101554.149000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "53f03eaf", - "indexed": true, - "name": "image_file_68.json", - "s3_etag": "918563dcf5b3881c5e453718f317f045", - "sha1": "34fd4c4a9d3a1c4dc1610643197a9092e9bb0adf", - "sha256": "49fd51fabce4301c831e6ecbf82108fb0e7a8ee70e549b2d87e47ce111690a90", - "size": 437, - "uuid": "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", - "version": "2019-04-03T101554.166000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "01833a50", - "indexed": true, - "name": "image_file_69.json", - "s3_etag": "05d5d3bc163ce94baa3ee79842a90fa4", - "sha1": "18654f02facd85891ff8495e861f61619bfca6a5", - "sha256": "dc427510fa0620ad3eb272fe4e81e0a23e8eef322edf52b38cca3799f6049045", - "size": 437, - "uuid": "be9d12b6-f8dd-407c-b1d7-844deb6a5023", - "version": "2019-04-03T101554.168000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a9d26b59", - "indexed": true, - "name": "image_file_70.json", - "s3_etag": "beae917af371b2fb95b3a2adbdf21e65", - "sha1": "0303ec0d5692e7a62235958df7b712b76a5ff0d8", - "sha256": "3e0af88cb3304fa3f4aa2118d2a94cc8576deb86564146d2022ab0d6453a6173", - "size": 437, - "uuid": "e3e59792-61e3-4bf0-a985-2acec75acafd", - "version": "2019-04-03T101557.350000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9fe6ba4d", - "indexed": true, - "name": "image_file_71.json", - "s3_etag": "387f36478b6eb60e7acf905ebb9a5842", - "sha1": "9c01dc63dff035a391b328738e87ac39b13af959", - "sha256": "e42e317ce059afd91d7365c52ed2baad3120380b354b1cb9d493a9433b7e10a5", - "size": 437, - "uuid": "095ee09c-1605-4c07-9324-b5382f20b78e", - "version": "2019-04-03T101551.023000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7ad3743d", - "indexed": true, - "name": "image_file_72.json", - "s3_etag": "a4342cc672a96585326afda3a205261c", - "sha1": "04c729435898e80e38de10184f44b6602bc218a7", - "sha256": "dade5e214dbc78247a89a7d6ef9d1008fb951858e4267208a2d598c94b295fd1", - "size": 437, - "uuid": "77b96424-accb-4c6b-884c-756f2bb40929", - "version": "2019-04-03T101554.145000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ba0941b9", - "indexed": true, - "name": "image_file_73.json", - "s3_etag": "12c381a6f2c6832468c66997392d83c3", - "sha1": "599497576384f0e1c98a389d6025215af6744c5c", - "sha256": "df4d56cef909e3c2ce9d4c336fd753c47a1731fbf1c2058b0c8aa4f79c6890a1", - "size": 437, - "uuid": "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", - "version": "2019-04-03T101557.414000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a141033a", - "indexed": true, - "name": "image_file_74.json", - "s3_etag": "df8f791ca45a522323e01418f86c25a5", - "sha1": "fb018f093d4434d8dc47966e22ce23633fdae934", - "sha256": "8d6cda07d844c1d5c022954b2431a60b2fcba5d7233da6adfc211117c5e5badd", - "size": 437, - "uuid": "78518dc1-d38e-4230-88b8-887bdd83f965", - "version": "2019-04-03T101554.195000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cc1184ee", - "indexed": true, - "name": "image_file_75.json", - "s3_etag": "6518fb057b8c7f2a56caa360b1519757", - "sha1": "f519a4da84b758b6d776920863efbbd1ba640759", - "sha256": "793bc7b3b9e4a543a458c3f68bb5827beddd934c102e87be93945190950e3453", - "size": 437, - "uuid": "652dd3c5-6467-41ee-89b3-e4b3361fb533", - "version": "2019-04-03T101554.138000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1a59e2d8", - "indexed": true, - "name": "image_file_76.json", - "s3_etag": "48aa40e3a77ca54322dc0f64da753fbd", - "sha1": "38dc7bca72733b1a44b431e8181d5c976e40c7d8", - "sha256": "df2b61efc26152c558cb2943696d322091109587591c61b7408890f35a2fd646", - "size": 437, - "uuid": "cae3d214-d485-4350-8cd2-f4142aca4aef", - "version": "2019-04-03T101554.152000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a1ddc855", - "indexed": true, - "name": "image_file_77.json", - "s3_etag": "ededc6656768c58f119d4980f70254f4", - "sha1": "5c630b8a409f7f835cac142d118696fdbbb00d64", - "sha256": "eb94a6d41ccab3e1c1f7dbecdd96ce2c82cd1fd789359f8e05645f4b66e6fec0", - "size": 437, - "uuid": "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", - "version": "2019-04-03T101554.144000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c53f9c1e", - "indexed": true, - "name": "image_file_78.json", - "s3_etag": "109b91349e3cbb3e381e1901d6fe3489", - "sha1": "03754fc3c3da983b559aeb9a60173362190cfa2a", - "sha256": "67fb4687262d1951b1b876e13877bac009c1306f3d6a993a3a74afe873faf5be", - "size": 437, - "uuid": "de282263-0944-48d4-9819-6182636c76bd", - "version": "2019-04-03T101550.968000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8d566bb1", - "indexed": true, - "name": "image_file_79.json", - "s3_etag": "597d15f02500d28ff234417f602d1d40", - "sha1": "eb4208dfe7401b4ce7fd64f8fa8914475c4728a9", - "sha256": "60578d0981d6c0a835df6e917ff9d0d297c62a6e97e36666bbf2640f6b82d123", - "size": 437, - "uuid": "bfdbe9b5-42ac-419a-b297-843095de2cc2", - "version": "2019-04-03T101557.263000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "60902f7b", - "indexed": true, - "name": "image_file_80.json", - "s3_etag": "39f399a9d08ef483207e36e918fcb092", - "sha1": "4fb249c2a84d19c71aa8f5838174012bc110edc8", - "sha256": "30b856dbc8c2a79fef91e6e8e124674843238a2aa7c078fbd8c779881b7c1e7f", - "size": 437, - "uuid": "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", - "version": "2019-04-03T101557.144000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "33ec1464", - "indexed": true, - "name": "image_file_81.json", - "s3_etag": "2d0c895d47fb3e0e63fc2e5db4ae297e", - "sha1": "42ad5f23c979338cb6d9c4502d5e59b7f2ded445", - "sha256": "6c43740b4d9754cab558430310c8cb4ac1c32a59802eb4fc8198e238fdada39c", - "size": 437, - "uuid": "e2763cda-3236-487e-9944-5169c0cb8856", - "version": "2019-04-03T101557.230000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "55c07209", - "indexed": true, - "name": "image_file_82.json", - "s3_etag": "9a473e1c3162cd9eeca4260125d7bfa4", - "sha1": "f392161ccc348296e32e3559732aff34679af0f0", - "sha256": "34f70ea5ffd42361331bd21ad3e39868bca7162f0d32f83c7d11753b3a20caa2", - "size": 437, - "uuid": "37018bd8-8537-47c3-a5a9-efb43552f30c", - "version": "2019-04-03T101557.364000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "621e5f97", - "indexed": true, - "name": "image_file_83.json", - "s3_etag": "298619f74be831631fd104c5b5cad470", - "sha1": "7dcc56f153ff341fe60e7f49d0eb3bb225b728a1", - "sha256": "1929e1c99a24ccf2931c086fd3d8746449a7e2eb18805090d3fb06efd94631f2", - "size": 437, - "uuid": "a6c9b1ce-2054-4a48-b262-bb0723b8a567", - "version": "2019-04-03T101557.302000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "70ced63d", - "indexed": true, - "name": "image_file_84.json", - "s3_etag": "7d69de69006a80659a97cdf67c08d7b5", - "sha1": "f1dff5908f09eec4cec54dde9e1602afa18183c3", - "sha256": "2c31cc1a1ebed37153f365b27d4deb9abc4119c3e283348c8873d96b12e5a921", - "size": 437, - "uuid": "8319ee38-f199-49d7-989a-25b451656b38", - "version": "2019-04-03T101554.124000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "38e38e3d", - "indexed": true, - "name": "image_file_85.json", - "s3_etag": "56aed7326c3f1bfa0c6b9d7dacf20e32", - "sha1": "a8fecab539fd4ff259ab5dd5fdd1e19bf939b3ac", - "sha256": "7e31d64e42873ab36812aa6ce79dae2b44b0e2312174c5f951893b23d40584c1", - "size": 437, - "uuid": "022841b6-8b7c-4d0c-b65f-06ba14253540", - "version": "2019-04-03T101554.250000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0bca100e", - "indexed": true, - "name": "image_file_86.json", - "s3_etag": "fa63ae3fe746e56b47c9d62577989f9b", - "sha1": "cbc472805f45908fd63e674861c44c1ac57e8982", - "sha256": "709a2c0bb5fd2c33aeb0a48a93b24b7947a89989db89c8bd26cc5a0a7f410cd9", - "size": 437, - "uuid": "299dfbe5-05f5-48a7-816b-61036f0e435a", - "version": "2019-04-03T101554.232000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "16162a4f", - "indexed": true, - "name": "image_file_87.json", - "s3_etag": "58f2f4b9a105d3b89cceb1e748816c25", - "sha1": "eb7dc8ed82ffe878749bc7841d7cde8acb8aa14d", - "sha256": "8c07684be9327c97b8f4260d5b8653a25b0961f75f639a2dd400bc29b931d5f3", - "size": 437, - "uuid": "6b8b11aa-3600-4a63-a980-93465e681c9c", - "version": "2019-04-03T101550.951000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c58cf92e", - "indexed": true, - "name": "image_file_88.json", - "s3_etag": "eba9085a7e39d9fff4e5da8d451f61ed", - "sha1": "d4236e73125c388d1a4d16903b5c843af4f3129f", - "sha256": "c6dc86adf9e12786e038487f201109cc48bd03828ef5bf1ba603db9657ac4359", - "size": 437, - "uuid": "35716168-df43-4273-b52f-72e3d18a47bc", - "version": "2019-04-03T101557.202000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9a0da2c4", - "indexed": true, - "name": "image_file_89.json", - "s3_etag": "bec756d6be365766fdfad45b53f38880", - "sha1": "749b564f0385e28d865ad240b96e909fb47ab44c", - "sha256": "b3a6e0d610ad5c171130df88cc1df675ec51ffec48781ef25f00e3bb96a9015f", - "size": 437, - "uuid": "6be783ec-c132-4e09-90e0-0958efaf6619", - "version": "2019-04-03T101557.305000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "665d3f1d", - "indexed": true, - "name": "image_file_90.json", - "s3_etag": "abca2e6e1ed70947444c7fd878aa2d5b", - "sha1": "f064f41ece19e3865c8cab294bc0b9fb5f04388c", - "sha256": "8bb1b6b4470029750f1387f4c9e66a939ed3f6c4ecbadebb40601d354ce34e00", - "size": 437, - "uuid": "a11956c9-c24e-4efb-8af8-1167b3081e70", - "version": "2019-04-03T101557.283000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c70854d7", - "indexed": true, - "name": "image_file_91.json", - "s3_etag": "89feebd68aa27a9cd0884f7c1ed32ea9", - "sha1": "af50b2be1793c1290dd5488ed7d7b38b9acdb5d6", - "sha256": "492b495aa8b0722ab69598f15f24324e7627415a77fe26ec382cba71a7fe75cf", - "size": 437, - "uuid": "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", - "version": "2019-04-03T101551.102000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "73ce1e4b", - "indexed": true, - "name": "image_file_92.json", - "s3_etag": "0faba09d5b0be8d8c42db50dcfe32ef4", - "sha1": "ae62cf99381dd28323a02f941a7fc3873d922e9a", - "sha256": "52b880a8c81b99983c728c7c2c0866ba96e8148402ffbc13b694f867ba27a7e6", - "size": 437, - "uuid": "753c2a57-b5f1-4984-b874-b2b10d582847", - "version": "2019-04-03T101600.454000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ea20fe74", - "indexed": true, - "name": "image_file_93.json", - "s3_etag": "f8c0ec3314cc411ab605da45ee1ae1c4", - "sha1": "3932905d596d5d826d76ad750f9ee5aa83300a5d", - "sha256": "8a7603ecc0ff0b6b717477aa5d5afbd3df097137983e8e1f5adaba919a560842", - "size": 437, - "uuid": "e0b93b3d-075b-482b-838a-e36d8849607b", - "version": "2019-04-03T101557.655000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "622c51fc", - "indexed": true, - "name": "image_file_94.json", - "s3_etag": "8c64a2315a751302959367ff6db0f258", - "sha1": "cf13fc28ccfcbbe1757f2e36ac5e680af272fbcc", - "sha256": "3399cd5ce881ad41a2c66de6a2eb9beec34607c9a23e055aa033a7cc2f812c55", - "size": 437, - "uuid": "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", - "version": "2019-04-03T101557.378000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f742a098", - "indexed": true, - "name": "image_file_95.json", - "s3_etag": "b82ff13446f48b797b25ee7a247523b1", - "sha1": "9ce3bd2c23c3f3f318436171829e848879752b0d", - "sha256": "cf8e194170ee6776493818ba0565a0801d2b857072aa7f03764309ab3db3a116", - "size": 437, - "uuid": "c647964a-7796-4dd2-9fa8-b23f012ac14e", - "version": "2019-04-03T101554.078000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "33f738ad", - "indexed": true, - "name": "image_file_96.json", - "s3_etag": "7e3ff05da1641afd7f8e448506ab7bbe", - "sha1": "7e0c25e40da0f9cc8130390540fe5850bef5adc5", - "sha256": "8a74efabad603cbe62ae6711c2777020934ff877be26bd854748aa9b4d6d2857", - "size": 437, - "uuid": "87a63649-9834-49b8-89a0-310211c1b5b3", - "version": "2019-04-03T101557.378000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "372f7803", - "indexed": true, - "name": "image_file_97.json", - "s3_etag": "86eee4d968daf81c07b15df9578c3a79", - "sha1": "5c052256e33b424fecd5cd48d15340358dd1966a", - "sha256": "f9d96e64d719a40319b77c2f25b2b0d57729005c589da7caedb8750f063333f0", - "size": 437, - "uuid": "b2eb5b20-fd1a-403c-8b55-9eec5972d482", - "version": "2019-04-03T101554.167000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7920ddea", - "indexed": true, - "name": "image_file_98.json", - "s3_etag": "3f7514879a314611145fada6d6ef1a1c", - "sha1": "680d17694216d6446b2a97a811f5e938acabb819", - "sha256": "86f486d31d468286eea367872038a8f9a6cd7cb92120a2e84e0afda813f3dcee", - "size": 437, - "uuid": "4b3b36cb-cd90-4526-978d-2e7e8f7add39", - "version": "2019-04-03T101557.225000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4bb30263", - "indexed": true, - "name": "image_file_99.json", - "s3_etag": "299c9a59919fc74679773ad2137e5beb", - "sha1": "7c06964d005e1006afa38a10bd2bec82845f293f", - "sha256": "181f6ed90801bdd3f19172909a54eec5964520a6f1883f80b0407bb674c76662", - "size": 437, - "uuid": "cdc774f8-3310-4f1f-8c67-03579c253640", - "version": "2019-04-03T101557.258000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c7f66f6a", - "indexed": true, - "name": "image_file_100.json", - "s3_etag": "84d7f8e31b4e82269118ec57bfbe9de0", - "sha1": "9a3279a8e854b7198890d3cc90a82b3e98e3effc", - "sha256": "ac1e8d1a0b4b81f2f04392c43c65f80b658830eed5f9a82be8c37966e211f352", - "size": 437, - "uuid": "607370e0-7e7e-4d25-ba5c-957c00a73ac1", - "version": "2019-04-03T101600.280000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "624ffe6d", - "indexed": true, - "name": "image_file_101.json", - "s3_etag": "9612eff1a5c6807b112ca4f617c1a0cf", - "sha1": "43b0e9771bce23227ed553fc915bd7977fad7e9c", - "sha256": "a75773e2cb876338fa609bedd525a3bd19a8ba2f130326e9ed1a4f10af45b39a", - "size": 437, - "uuid": "3240d7ab-568b-4be5-adba-3178b3e8f85e", - "version": "2019-04-03T101600.280000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "61105f50", - "indexed": true, - "name": "image_file_102.json", - "s3_etag": "d6c60238a7e239f1b2c2d14ffdbfaff7", - "sha1": "4dc9d964fc5e3f096ff97e655379e44f51ae6283", - "sha256": "6cb57b49802a50e4dddeb57588ea5186e0377e89f623a77c65fbf1fe27571ae6", - "size": 437, - "uuid": "c0b6ee98-677a-41d9-9d80-9ac63d251b08", - "version": "2019-04-03T101557.303000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e2a40e24", - "indexed": true, - "name": "image_file_103.json", - "s3_etag": "ef8478fb1671bbc1d61e611d71df6209", - "sha1": "66a40c2e81ba53a78ead911040a04e4164060ae5", - "sha256": "a5c98779f87e59fa7376751b9ce911a4a2b478d0da157ff9d1471b3e97222d1c", - "size": 437, - "uuid": "f34c01ec-06df-49e6-bc2f-c50c7f398851", - "version": "2019-04-03T101600.436000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ed53b87c", - "indexed": true, - "name": "image_file_104.json", - "s3_etag": "cd43d127238ae68d6c2327f31449708e", - "sha1": "db64df46a9f42e44207740bd97841361c60e052c", - "sha256": "f6c5e6e0dbd6fef34c139a9435403c39f7de7c0fababdc5f4d8bbb4f9b8b66ed", - "size": 437, - "uuid": "2047311b-f3ee-4137-8338-a45166e01d53", - "version": "2019-04-03T101550.968000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "59fccb86", - "indexed": true, - "name": "image_file_105.json", - "s3_etag": "d92291c2deeb51a389c5211a387cbdd7", - "sha1": "3a23e34dd658ca95b49f583b6874ff845db80159", - "sha256": "15e24fe5fc4b6cf2ca9ed30d1268221ae111280b6ccff9683d16d196d36a4d3d", - "size": 437, - "uuid": "44ea335a-1991-4504-be12-04f1a332ddfb", - "version": "2019-04-03T101600.403000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d7098a00", - "indexed": true, - "name": "image_file_106.json", - "s3_etag": "85283fdd005d246b6fb38459d7f2440c", - "sha1": "1c73d5fb44792b50527e840d2e625e9a56ede3f5", - "sha256": "0e02dcf31f407949507893d0a21d3ca9b4b9a179a7acdf9f787ed8fe920a738e", - "size": 437, - "uuid": "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", - "version": "2019-04-03T101554.147000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e63be200", - "indexed": true, - "name": "image_file_107.json", - "s3_etag": "233a420f75217bb794b045ccfbb292c5", - "sha1": "3603e59b9f6c90a093ef7749eb098778cbd638aa", - "sha256": "235200c223615ab1193535c564f774895e405aa2e9546759f2dab55aa5ce2451", - "size": 437, - "uuid": "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", - "version": "2019-04-03T101600.681000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f9a3777d", - "indexed": true, - "name": "image_file_108.json", - "s3_etag": "65d36a223b22814e7a5114378f4febf2", - "sha1": "b1d71006b9a1198c2e506f408872bdd5ac4db009", - "sha256": "8fba1891ad6b9df93f54b549089db335e7e30f54887f530ac21b9277457e9d18", - "size": 437, - "uuid": "6af3cb41-9e64-4b11-b272-be87adf0fa94", - "version": "2019-04-03T101557.097000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "54b9897c", - "indexed": true, - "name": "image_file_109.json", - "s3_etag": "0924942c5529ce97e69d64deeafe4193", - "sha1": "a3b0c53987977b17d90b50cbe75d04e08767e28d", - "sha256": "bf4ccbd57c8ab29598df6db62c0242c59cf9497d68523d7d34cd27dfd4e1534c", - "size": 437, - "uuid": "7541d176-dfba-4e05-ba45-0c6964271dff", - "version": "2019-04-03T101557.397000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "79071d9d", - "indexed": true, - "name": "image_file_110.json", - "s3_etag": "9102a7f7284f714de7dd7716a9e27620", - "sha1": "5e42004ac09f29adb33554087c9de21e557be9d9", - "sha256": "9697819224a07cc6cacd817a072d1ea331692b8c2de7c80d21883d8e2c5502ae", - "size": 437, - "uuid": "8ee1e829-a507-40a5-87ac-7fd8379b87ce", - "version": "2019-04-03T101557.618000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e7e82287", - "indexed": true, - "name": "image_file_111.json", - "s3_etag": "04794f18a9e69798098d87af82b0ac50", - "sha1": "d9f31ee11b671fc7e5c4ea5e9fd656380358a6ed", - "sha256": "17d7e6629a107f8cd2513a9b54ed787786842ed61bff2f0ee99a816572922417", - "size": 437, - "uuid": "8e57554a-abb2-4664-87b6-a397f4da6555", - "version": "2019-04-03T101600.218000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c1769884", - "indexed": true, - "name": "image_file_112.json", - "s3_etag": "2c4ac75a339eccbb64b95a4772ca0286", - "sha1": "3ca9d372b0d6515a12492af3b6e253634d3a2c35", - "sha256": "1f3ea4e1d4dbb998ea75391d51abd0bce2110c13dd8364ba8a37391dc92761a0", - "size": 437, - "uuid": "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", - "version": "2019-04-03T101557.372000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ae603b89", - "indexed": true, - "name": "image_file_113.json", - "s3_etag": "92a50c4f73d046495f9047669dc95400", - "sha1": "645f1bff947772653acd03f6a7a28dd4a1254259", - "sha256": "cc69be74713fbfc1bb0b5a0acad1c8836c9b2147fe007457f90272266f70cf39", - "size": 437, - "uuid": "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", - "version": "2019-04-03T101557.219000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "73d138c9", - "indexed": true, - "name": "image_file_114.json", - "s3_etag": "f5a3493d4933a9d3def5aed6bf4dc974", - "sha1": "4eac231dc59f280fac884896aa72681c22b9a22c", - "sha256": "b32d18b2ef17e125b656df0e09afc7cf6f21ea3009dd79f73f3ab7d291b9a5be", - "size": 437, - "uuid": "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", - "version": "2019-04-03T101600.319000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "2002b87e", - "indexed": true, - "name": "image_file_115.json", - "s3_etag": "49fdb8916437c2d00c9362050564f8db", - "sha1": "fb1dc7c2021f1f92193079a4e19f8979ae078514", - "sha256": "405bc8dee78ba33131c71b2a894d10b7a4a49b5adc97b82b3642e27713592b38", - "size": 437, - "uuid": "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", - "version": "2019-04-03T101600.829000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d2232993", - "indexed": true, - "name": "image_file_116.json", - "s3_etag": "7b03afd50c19ea3220af78da012d474c", - "sha1": "5caabb826abcc6449375527d011f46c382c38e96", - "sha256": "475bff5a0b66a5cd85554951a3da5cf9ae03e1d56df2a4fdd8ddec885ea90c02", - "size": 437, - "uuid": "f0cb4244-e19a-46a0-89f1-04143548872d", - "version": "2019-04-03T101600.414000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b381224e", - "indexed": true, - "name": "image_file_117.json", - "s3_etag": "e2ac25c9e4dd4a54c505f071249aced1", - "sha1": "653b892fd869284e0309ae1e25dcd1cf019187b3", - "sha256": "67d977bcfb8d491d430f00162f53ceba85b02a95b71cc5b2dea4fd1ce8d6d511", - "size": 437, - "uuid": "73074f55-d009-41a2-929e-6fd9949bb1dd", - "version": "2019-04-03T101557.285000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "75bd6a49", - "indexed": true, - "name": "image_file_118.json", - "s3_etag": "2c552e3196418b5a5ec891ba0e26ec86", - "sha1": "3126099c6657a585599ee1f7726cd3228cdb46a2", - "sha256": "209e942d61b826433bb3b4cc931166a73c5901c3746d35d590e554fad83f436c", - "size": 437, - "uuid": "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", - "version": "2019-04-03T101603.247000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5b9a0501", - "indexed": true, - "name": "image_file_119.json", - "s3_etag": "974f31e145f872033ab5bc86e050e39b", - "sha1": "519fe892b3a9fcdbb121bc4fa403e353025a236c", - "sha256": "f440dd4a87df90e9bfcddf95095a240ea0de8a20288355eab70bba407296df4d", - "size": 437, - "uuid": "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", - "version": "2019-04-03T101551.101000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "32464a4e", - "indexed": true, - "name": "image_file_120.json", - "s3_etag": "2fad178d730a3fd02138b288f5b7d152", - "sha1": "cef2feb1cbfb9f700567987e7238d9c90303b537", - "sha256": "0d2fa638787455be594ff8c3eba9a1731854eb5224f3b836619ef99ca11aebf0", - "size": 437, - "uuid": "146231bb-1b13-4db5-8157-9d9962cc3a3a", - "version": "2019-04-03T101600.042000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b347303b", - "indexed": true, - "name": "image_file_121.json", - "s3_etag": "45819280077953a7a4043d006c32e95f", - "sha1": "be3950c90eb520df4c0db5bb78bfcf6cdf364a78", - "sha256": "de0ea21220a12139e499c35acd5b4a5a3000e638835fdc772745d3f54fdc2d9f", - "size": 437, - "uuid": "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", - "version": "2019-04-03T101557.650000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f83dbf7a", - "indexed": true, - "name": "image_file_122.json", - "s3_etag": "25fa029b8cc72c3d263016e44136acb2", - "sha1": "8fc55cdceeaaacb6166525a56e0e9be43f8c5d2a", - "sha256": "0ff933b23d7d629e121ed1cf845eee404eea6d8322d609b5b7d16149eaf17229", - "size": 437, - "uuid": "7fe17380-3090-4fc3-9504-02b3f8ed95b6", - "version": "2019-04-03T101600.270000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "20a30aeb", - "indexed": true, - "name": "image_file_123.json", - "s3_etag": "ff0ff40005e08d2ec615286d214798ee", - "sha1": "00b4280000427d5850b6201e603c711910ff5faf", - "sha256": "6b2ae2280f5ff317272091022d49e24e0f82522f85e99f42bba4d5b250645aa8", - "size": 437, - "uuid": "fc405b01-60ca-436f-a06c-2f38f7156a87", - "version": "2019-04-03T101600.160000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3d500e06", - "indexed": true, - "name": "image_file_124.json", - "s3_etag": "765c12fe8aec0b8b560be0caa7d1a1a2", - "sha1": "364cdc9bd7e1289522d53f378f1d31b44494baf6", - "sha256": "ca52cb02fea907aeaf355786658202edf0d186fb1a2accd5ab7b90db40052469", - "size": 437, - "uuid": "bae92b53-c6c7-4712-865e-6cff3cba506e", - "version": "2019-04-03T101600.763000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0a5825b4", - "indexed": true, - "name": "image_file_125.json", - "s3_etag": "ed8f09ad61dd92fe37c3311c0da8e7d7", - "sha1": "90ea8642a77ff2596131e50687db1f35d51f1b44", - "sha256": "5d17f983241619d437110e0ab3cbd20cd4d0cabe26a27ce7695c88db17f6d239", - "size": 437, - "uuid": "83662ec5-a202-42ab-9a47-a701d4f19de3", - "version": "2019-04-03T101600.067000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d283a3c0", - "indexed": true, - "name": "image_file_126.json", - "s3_etag": "41ab5d98dc01456e033ba21cada13967", - "sha1": "28f2f41885c436c12af1316d6d81ae587d587ecd", - "sha256": "0c2a898e93a79cd6f8f79523dd46fb0a31c01d628f9af9660bf0ef1846db4fba", - "size": 437, - "uuid": "a04957c6-8ce8-4fa6-950d-71812ff3d698", - "version": "2019-04-03T101557.271000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "2930ebf2", - "indexed": true, - "name": "image_file_127.json", - "s3_etag": "ffa9e1437330e4ab38b9e35946e3da76", - "sha1": "29e640bc48643e6930ae4615c3b16fbdd4771bb3", - "sha256": "631ee2371f5ca8d15962b29394e5f532be94ebef0abf3fc0cf91e7408fd9dfb8", - "size": 437, - "uuid": "9284d3a4-73bd-4aa0-847c-ab273d14185a", - "version": "2019-04-03T101600.765000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e6f83572", - "indexed": true, - "name": "image_file_128.json", - "s3_etag": "1fad73cf9527342ba01c029eeddc9c6a", - "sha1": "7916b415e145c01bba59c939a1c8caef58672942", - "sha256": "c0267f598a6a8f796bc19637830c6464bc0f88164482408895d232ebffa74f64", - "size": 437, - "uuid": "4d664562-c333-4aaf-bb8b-641e0568733e", - "version": "2019-04-03T101600.166000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0face8e2", - "indexed": true, - "name": "image_file_129.json", - "s3_etag": "c3946fd4f7038ec19522943290a01823", - "sha1": "dccbc72810c9a914396bece0ac056b992d3319ec", - "sha256": "c97f7b03e607af29022647cb841f3eca29e09b23db9ee1d28bfa6e2e31833231", - "size": 436, - "uuid": "b533685d-3c60-4483-841b-a054f0a69fec", - "version": "2019-04-03T101554.188000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "eeb1cf11", - "indexed": true, - "name": "image_file_130.json", - "s3_etag": "50fcbb4d44a132b0c931ddd3850cdb76", - "sha1": "4b167cc718f2a451411dfe8439b290071075d3df", - "sha256": "9916e0dee25d18f691fb03a0f86d11236a31751f74b7f3c012b8c041ccfe04e8", - "size": 436, - "uuid": "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", - "version": "2019-04-03T101557.291000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7d18a70f", - "indexed": true, - "name": "image_file_131.json", - "s3_etag": "09415327b487d9215fbe3a7cd9971c55", - "sha1": "1987b17490c671ae6b951a56fb8ba4f055af4aa2", - "sha256": "c3cc6d03ace371186e69ea2415ea613995215b8aed9dc922dd95e1a35308efbe", - "size": 436, - "uuid": "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", - "version": "2019-04-03T101600.394000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "79c9d70e", - "indexed": true, - "name": "image_file_132.json", - "s3_etag": "e8ce33c0637ad065f3c7c9a78de30385", - "sha1": "b03fef701c5df99332e3d1517a90631aa031b862", - "sha256": "c7608f0bec65265bb64ca7ee2331f9ff640156687b1f01c027acd02aef2930b8", - "size": 436, - "uuid": "3e8510c9-7e31-49bd-bb90-cb55577c2f25", - "version": "2019-04-03T101600.298000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "27ed9a00", - "indexed": true, - "name": "image_file_133.json", - "s3_etag": "ce451ac5cde6b0c2cb1a3adc91d7164d", - "sha1": "4b0a408cbd8cf2f87690fb73cede23de947ca04b", - "sha256": "bb545cc8d1fe58ba58c817538725802ac30511b624eea797cd7c4a1d3ea1d2a0", - "size": 436, - "uuid": "463aff9a-ec7e-40d0-be42-c6686af9130d", - "version": "2019-04-03T101600.374000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "76e8ee5d", - "indexed": true, - "name": "image_file_134.json", - "s3_etag": "cc459b9d7b79e0fef59d42408c20b41b", - "sha1": "982bb44680503ba65a841496e17bbd05a3489c3f", - "sha256": "03110bae90cfe1ee3c1ae30589bb0596a45c44e7b2dcc785fc8f1c9dd717bfef", - "size": 436, - "uuid": "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", - "version": "2019-04-03T101600.331000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "47f5374c", - "indexed": true, - "name": "image_file_135.json", - "s3_etag": "77583cd44f03dd1186a2898b798bb9ca", - "sha1": "5f58a0d3791185ea4bf1ed4ed353f0bd66ce7c23", - "sha256": "e4d5b9e10d9be4235dde88a29f2c56c7d23bfa0f8a23c7d3cb13467f80c0f723", - "size": 436, - "uuid": "868efb99-df36-462b-91a2-bb6ca27e842a", - "version": "2019-04-03T101557.472000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0de6130e", - "indexed": true, - "name": "image_file_136.json", - "s3_etag": "d90a9f70d65ed59bf7277ed6a7372736", - "sha1": "ec158fad497fe8036c5832cb23afb5cd9056f5c6", - "sha256": "455d6ba0201f4cc52da2c2c4c8e7b77ec1863ee9fdbf83e92fea1eba32de30f3", - "size": 436, - "uuid": "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", - "version": "2019-04-03T101557.134000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "80bffdf2", - "indexed": true, - "name": "image_file_137.json", - "s3_etag": "5676ddf939d13e2efe60b272a64c07b9", - "sha1": "23c94945eeb9f001f6bbf4ade8ba9f8737ec3ac6", - "sha256": "d0e1200160461dae6b9f135d8f3675db46bf9f793eff1a443f1580af484ebfce", - "size": 436, - "uuid": "36ded48a-869f-4fa8-971f-56bc28298276", - "version": "2019-04-03T101600.039000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1ce611f0", - "indexed": true, - "name": "image_file_138.json", - "s3_etag": "b63dfe549fefc2224fcfda0c5b7f36f8", - "sha1": "3d0d7637421bceb4e12c3972816c596a05b5849a", - "sha256": "bdaf3af322d92baff7b48b2857bd0b293932e415b28e7c0cb80b37cda4058b55", - "size": 436, - "uuid": "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", - "version": "2019-04-03T101557.347000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5a22cc4e", - "indexed": true, - "name": "image_file_139.json", - "s3_etag": "406308a789dca9a4f1fb3e42c5d0ce6d", - "sha1": "7a7d2ad5df54c464b239128752c9db0abcad8a4d", - "sha256": "d845d457e3e3d5216e807c174e1b6c828785bee4c5caca5c1111f9a59531d040", - "size": 436, - "uuid": "e72742a4-23ba-4e5d-a29b-ad449abe8101", - "version": "2019-04-03T101557.374000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "321edac3", - "indexed": true, - "name": "image_file_140.json", - "s3_etag": "998b50460976c875a91ba2abcbb145b5", - "sha1": "7e428b8ed4dfe7e32680bf3305c715cb008479f4", - "sha256": "5df5e75dbb87f5f393c1849cf8bec18363833c36f17bd4734f3b528c2558dd5d", - "size": 436, - "uuid": "cd6e1096-f8c3-4eda-957d-b09741d60901", - "version": "2019-04-03T101600.117000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "05c21c7f", - "indexed": true, - "name": "image_file_141.json", - "s3_etag": "f7191d8b82990813acdaeb81a3c48e09", - "sha1": "4a54ae7415987a2289cdcc7ec4f52271d6a31687", - "sha256": "5e571a9b994680f3c22dc7602a6d1963968218df6dfe454d31ae7845f4b22bd5", - "size": 436, - "uuid": "903ea376-5153-4fb8-8ffa-e2948951409c", - "version": "2019-04-03T101557.150000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a391fe15", - "indexed": true, - "name": "image_file_142.json", - "s3_etag": "49fa6f1f0f9045e97c687ca7cee1a427", - "sha1": "b598f243e49b4c0038b35ca80c85fa369512314c", - "sha256": "4bfe719bda36737bcfe027391ee51f71d255899c604fc0c7c564caeaa571b79a", - "size": 436, - "uuid": "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", - "version": "2019-04-03T101600.258000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0f6d4dd3", - "indexed": true, - "name": "image_file_143.json", - "s3_etag": "dedcad4d1d420963dda73eaa13de9ad0", - "sha1": "d6d83a8d1e3d9577445635afc6c50f998aaf540d", - "sha256": "761e759e7a00651aec0fac66bbd59ef0aeb36b2557dd1246eda36f8ed69c6250", - "size": 436, - "uuid": "8381d167-c4dd-49a2-b5df-1ae815bbe42e", - "version": "2019-04-03T101557.334000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f5635da2", - "indexed": true, - "name": "image_file_144.json", - "s3_etag": "79b298d6e9509013fa92a009be3060e1", - "sha1": "d9588ae5a7ec0a693dce7526f10c34584d9465ff", - "sha256": "f5a3b61de263bf318c23ab9f56037feb5789a168b8daf4ad3b1d1ae4ab0394f5", - "size": 436, - "uuid": "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", - "version": "2019-04-03T101557.150000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ae023b15", - "indexed": true, - "name": "image_file_145.json", - "s3_etag": "277a167ac421f95409963957f70ec2a5", - "sha1": "b52c00f0005001479cc124d53dcc1cade66cd123", - "sha256": "830a39493a1edcdb9cdd7c760d17bcf246a6793e131700a5088751b9f83ddd6b", - "size": 436, - "uuid": "cf305c60-bb2c-41af-82bf-0631c2a7b0be", - "version": "2019-04-03T101557.290000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "f217da63", - "indexed": true, - "name": "image_file_146.json", - "s3_etag": "68059331cc8eba21ae8da8eec733a92c", - "sha1": "6ae82b609470e7c25a3a7802f3fef1e18cddd91e", - "sha256": "6a35e93e2b0ba923a92cb3feed491152de214cdb71b89481fa756153ad2e892b", - "size": 436, - "uuid": "074290a9-35e1-422f-a3af-e5ed58781b4d", - "version": "2019-04-03T101557.347000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8ff80ff5", - "indexed": true, - "name": "image_file_147.json", - "s3_etag": "234da0f4d86eb03da380ff350d87b410", - "sha1": "397af1eb0ffd0fe65abc7d7d65f81cba7d7bbfaf", - "sha256": "3245c4b347e2614367a0c0e5be0af80e86d79eb25cbbdf3521528db34220faa7", - "size": 436, - "uuid": "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", - "version": "2019-04-03T101600.451000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "54435b96", - "indexed": true, - "name": "image_file_148.json", - "s3_etag": "829f2304a1d66de60eab78bb8de7ff53", - "sha1": "5eb6f2581432a335c2849d90ff63c15e1903088f", - "sha256": "35f0fe08eabe0511e110f9cde3fe8f56c038f14e3ec5f51b1c842c53b8b1a4c0", - "size": 436, - "uuid": "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", - "version": "2019-04-03T101603.144000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1722edab", - "indexed": true, - "name": "image_file_149.json", - "s3_etag": "a1b65af108379e8caa23b206a548984f", - "sha1": "d00d1811fe7c4dca9e85bb4b6835f0739d213aba", - "sha256": "15d1cbf4249524b751f63dd52d2c110c14634e4fbb88657bfaca27cdc6b97ca2", - "size": 436, - "uuid": "5165cc56-ff89-42bf-b000-fec4bd57176e", - "version": "2019-04-03T101600.708000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "685b0cfa", - "indexed": true, - "name": "image_file_150.json", - "s3_etag": "38c369f513b7c2eed7c745328979b76c", - "sha1": "d57ccb510a194f02b991e64e37e651f40c033194", - "sha256": "c5667a1a102c5a80d8b44ef82213da14d545942e30c735bf7dcfb67932384a3b", - "size": 436, - "uuid": "545be634-5893-45e0-93b2-dd4ea93e00db", - "version": "2019-04-03T101600.405000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "fe1bbb74", - "indexed": true, - "name": "image_file_151.json", - "s3_etag": "6062fbf6271c2148b2fd4737b216db40", - "sha1": "5bb0d785da697b28316390ffde3db2b05c38180f", - "sha256": "8231bb5b5cb4c9817d3be93acda16e781368fc3925de5540b513c586094e4a9c", - "size": 436, - "uuid": "2d2e58c6-7c24-4089-bbe9-d47b7482be46", - "version": "2019-04-03T101600.253000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8c4bb73b", - "indexed": true, - "name": "image_file_152.json", - "s3_etag": "5f722ea4baf112069b8a5bf1b01a13b7", - "sha1": "82aef5f80d2e84b65efde395b8da62499ecd9302", - "sha256": "66b544e1348b06907777033d0c4d07af18e50bcde6420125f265bc6f197cb8ed", - "size": 436, - "uuid": "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", - "version": "2019-04-03T101557.292000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "11249b6b", - "indexed": true, - "name": "image_file_153.json", - "s3_etag": "6ef957eddbad0f492996f3f363e8ae51", - "sha1": "ebef3a01f7e15db24021b9a6d19322d37b733a8b", - "sha256": "38c9cc3471db114dc2be54d129a1190008513a77ca65804352efcfe9201cb08c", - "size": 436, - "uuid": "81214e49-318f-4221-bf2c-4ef00cfa916b", - "version": "2019-04-03T101600.761000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "92b0b29b", - "indexed": true, - "name": "image_file_154.json", - "s3_etag": "c90e974cb1b1892dbeca3185a907b500", - "sha1": "1f407c842e06425614a768f8a10266cb007e1e9f", - "sha256": "a8c965392de54d429232efdfed7d0107d7e7a7c6d0686d74b4cfcc0c6bafd90a", - "size": 436, - "uuid": "7fc97754-1121-468b-b1e4-839bde86b6c8", - "version": "2019-04-03T101557.316000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b1505ecb", - "indexed": true, - "name": "image_file_155.json", - "s3_etag": "6cf24b3927d8e13d844f6819a3840238", - "sha1": "f06abd8bbb30f39f06a245ccbe6439b8c766cb6f", - "sha256": "701ebd34ad74580573d6a298bca4519b8b292996ee5141ad602cf6126602a37e", - "size": 436, - "uuid": "7d70d44c-b5d7-47be-9687-e9a775e86251", - "version": "2019-04-03T101600.785000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "efa31258", - "indexed": true, - "name": "image_file_156.json", - "s3_etag": "cec56efbee285fc19c3ee663dc551084", - "sha1": "cfe179f1ea6d3a17d6335ac2894502994e69261a", - "sha256": "be2350182247dc4e96357958ac29aad38fe7f1f5967e219c9bdf60a87d00d41a", - "size": 436, - "uuid": "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", - "version": "2019-04-03T101557.619000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "58022c3e", - "indexed": true, - "name": "image_file_157.json", - "s3_etag": "320217d67eff2c0999400320c4b4c479", - "sha1": "b84b26090099a14047a4d446d3534d8bd86b8f58", - "sha256": "34e8451f895b057d9eb9d78b052315727d0ca27824ce7b802924c14bb56d92d1", - "size": 436, - "uuid": "b7607809-e975-4c32-bff7-375cb2d8276f", - "version": "2019-04-03T101557.213000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "646ebd9e", - "indexed": true, - "name": "image_file_158.json", - "s3_etag": "b0fcc0e0fa26aadba68868c953e95aa7", - "sha1": "4250fadce024c8e572ccae9196a34c3add170bc0", - "sha256": "61126f5fd54652044be1a6024516195d785bc5682f99619e646e75c8e9b4ca09", - "size": 436, - "uuid": "b8a6c863-626d-4fbf-863b-610cffaac37d", - "version": "2019-04-03T101600.707000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ceeea3d0", - "indexed": true, - "name": "image_file_159.json", - "s3_etag": "9c2b629c3f76d3cba6cb9d2cf36f2969", - "sha1": "df803935dbcbbc632fbef8449c4edd8803558da6", - "sha256": "90c270bfa37cefaa0fcc7f60e4bd9cd96c5a7c7e59533cd5c89437e3d85e5ec0", - "size": 436, - "uuid": "45077a5c-ee96-47c0-a84f-9d46cf799338", - "version": "2019-04-03T101557.619000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "07d7c432", - "indexed": true, - "name": "image_file_160.json", - "s3_etag": "c0e3a6c7a3b417eebe7158d0fb4f44de", - "sha1": "b1e56979e1d8ec8ef40bc9ba5577dbdf0c170a4b", - "sha256": "c1e95db63a247249500612b3ac067bfe3fe990b92913a1ec51b9612dc6e4fec3", - "size": 436, - "uuid": "49d82b74-6f1a-415c-93ab-958c60f083b6", - "version": "2019-04-03T101557.323000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "432002e2", - "indexed": true, - "name": "image_file_161.json", - "s3_etag": "96bfcb095d96f58c1aea8ea4b2322dd4", - "sha1": "d8b85fac27de7dcf1258fc4623d0cb465635a89f", - "sha256": "3366f748eaebf43ba8502f4c744a05fe4410b2b8a42b89484f2bf4e9604cf5c5", - "size": 436, - "uuid": "753b51b7-a909-44e7-bb21-cf2cd18328f8", - "version": "2019-04-03T101600.722000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e5099003", - "indexed": true, - "name": "image_file_162.json", - "s3_etag": "e61fcde1c4228360450a575067c4dc29", - "sha1": "5fb6230b4a18e08a79f45d57fafb11450991a3ed", - "sha256": "369173be00544e7db713040ae411dcffc156ffff71ecce67c23b2d6cd76e4c3e", - "size": 436, - "uuid": "c7ab6349-b2bb-4ba3-9c9b-27d270550052", - "version": "2019-04-03T101600.390000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8ef87540", - "indexed": true, - "name": "image_file_163.json", - "s3_etag": "5de5c4488b699a38d35a6cf1a3729ec2", - "sha1": "8812a835916c73d11fbcdce13ec0fceb46104e08", - "sha256": "f68584cf5841a7423b2f39719f7bb250e509062572c116628a2cd764a2fb06ab", - "size": 436, - "uuid": "7be770fc-4a56-4f82-a4cf-3cf908d54dca", - "version": "2019-04-03T101600.789000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "361437fd", - "indexed": true, - "name": "image_file_164.json", - "s3_etag": "41b89d6da480cd0db891c52c634e8815", - "sha1": "387f16272f6a0da030485421d02c3e7921406ddd", - "sha256": "441ace0d1c8b13015277680fdfd7548dae8fd05393bb06be7627c2c5a29844b9", - "size": 436, - "uuid": "3f5f8537-c1af-4d2e-a732-53b6d4275588", - "version": "2019-04-03T101600.749000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b934da24", - "indexed": true, - "name": "image_file_165.json", - "s3_etag": "584d533d0e7bc1df7f178732438ea21e", - "sha1": "ec7aca11af79a1b696f54f0cb1c70606e3fce94e", - "sha256": "0094cb6ffe96d5ee71480e8ea461c94058f9618c078888ccff23a1122cc61686", - "size": 436, - "uuid": "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", - "version": "2019-04-03T101557.145000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "12539dd0", - "indexed": true, - "name": "image_file_166.json", - "s3_etag": "f26054dea0d3b7e8c776a0a55c295c8b", - "sha1": "a0342333a1abb0ff158ba07c7e78118c4a57b0ff", - "sha256": "24fe0898bd7fc8aaa554d7ba22ac6cafd74ee1bc3f0e1b81a77b46e2f24edf9f", - "size": 436, - "uuid": "f986c2c2-2823-45a0-80cf-5e6f67958afb", - "version": "2019-04-03T101600.833000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "22a53208", - "indexed": true, - "name": "image_file_167.json", - "s3_etag": "d2fe9d320c5908fb6b3d0af4616e2189", - "sha1": "6167d04ed23d98345784b5e6191dbd38618b0cac", - "sha256": "09c0968595187999bba9a8eca60c7853abc81a5a005d85ccfb48ccdf022fe3b6", - "size": 436, - "uuid": "7d17d6d6-d038-40c6-b965-6de41ce9c931", - "version": "2019-04-03T101557.652000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "62177c6b", - "indexed": true, - "name": "image_file_168.json", - "s3_etag": "a7a228cdb27db7e6349c86a4f1618922", - "sha1": "954be66ea44ed4b270ddd8d2c518e71f0c0c489e", - "sha256": "6f1db0bbaa75a5c7f8735d06835024fd9b32db984527f4923253aec9cac0ec32", - "size": 436, - "uuid": "3d208b38-62c8-492d-9434-21bb66ead16e", - "version": "2019-04-03T101603.214000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "de89cf68", - "indexed": true, - "name": "image_file_169.json", - "s3_etag": "fe1b4590d57459ce581a7755b8939e79", - "sha1": "7762a76834aea1aacc5b965d70a649004b8b8c67", - "sha256": "a674fdce30a1aab7bc45095518c3b14942bf60eeb6b7873ab5f2161bc014c21a", - "size": 436, - "uuid": "9a982898-77c6-4a56-8e54-9cb83ff0b235", - "version": "2019-04-03T101603.249000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "553133b0", - "indexed": true, - "name": "image_file_170.json", - "s3_etag": "81bfd03ec69d028d623809786583bb08", - "sha1": "39dafbe9e39d05153bab4af4bc81186b716c8158", - "sha256": "9bbc3bf95a7e3c9e15b3204e247cc577c47c21d1ecffb0683878841b7986bbb3", - "size": 436, - "uuid": "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", - "version": "2019-04-03T101600.293000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "16781583", - "indexed": true, - "name": "image_file_171.json", - "s3_etag": "e3db20f24674487c034a21d232110849", - "sha1": "a6598d4672988c579d26a334e2ee3d962ede20ff", - "sha256": "09c65df04747d7c47f3e2b9d2fdc4ac65cad2d5161628b3b4c778ab737a275ad", - "size": 436, - "uuid": "24b6366f-03ce-4e4d-b50f-90687f3e2b94", - "version": "2019-04-03T101600.295000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1a02cf5a", - "indexed": true, - "name": "image_file_172.json", - "s3_etag": "e519eb15144b716f9043913d598d4f16", - "sha1": "7857304e4d0365ad9798a25dd7ab10b5faf98f6e", - "sha256": "fe756824663266bf7ea44ccbfd6e6fc8453e890c7101fdd8e20dfd6b78c4fcd8", - "size": 436, - "uuid": "ec1d0987-fb49-48b8-aaeb-321c659fb67f", - "version": "2019-04-03T101603.247000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "2017fe6c", - "indexed": true, - "name": "image_file_173.json", - "s3_etag": "33310bd4f765e5d9fdfa84391fe65997", - "sha1": "dd891013bd2b86b798c274ea220c347cbdd9beb8", - "sha256": "be299b783b326df47bad2a3888d2143787b66284e4551a8b4e60868e705e1bb3", - "size": 436, - "uuid": "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", - "version": "2019-04-03T101603.243000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "bc9f22d6", - "indexed": true, - "name": "image_file_174.json", - "s3_etag": "bd6f25c52f98f9d018ce3dcac6d5c9d0", - "sha1": "767a201d9dd1b45cf039fd6274eb64b26d58af21", - "sha256": "03b015063dcde1dacc16ffc3b07897c48b2f59a8d7b0c5f046687bfc27b5e380", - "size": 436, - "uuid": "6fbcb1c7-ce98-46db-8054-b451b6bca205", - "version": "2019-04-03T101603.126000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "51932b0a", - "indexed": true, - "name": "image_file_175.json", - "s3_etag": "8df486d3076b276de29d7c61ef658dd3", - "sha1": "ed8d4e51f6746783b1a47aa9362460f88f560a38", - "sha256": "bbdf743a6e804d27b94cb33e8e6b59d6a3413e67559f643e403d411034da8c00", - "size": 436, - "uuid": "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", - "version": "2019-04-03T101600.740000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "352d8c9e", - "indexed": true, - "name": "image_file_176.json", - "s3_etag": "5ee1244cb84cce357b2872f2981824ed", - "sha1": "419870f478eaa3d85e935b759aafcf650f879111", - "sha256": "4f619d3d55398b5a749affa5ae641328d59d1967944794b985a4657c9b2bf953", - "size": 436, - "uuid": "aa6fca0d-6a70-4016-a0e4-307878e9ff45", - "version": "2019-04-03T101600.704000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "460ce4ac", - "indexed": true, - "name": "image_file_177.json", - "s3_etag": "432d0ce1357747d3243cd50cdd5889ff", - "sha1": "ea8383e16d3eb94f20f7df6bd6cbfbfe65382b7b", - "sha256": "efc92103a7b664b3c6b02a7c17066ea9b18b216382c0822a22397d471886d0d6", - "size": 436, - "uuid": "ee62cd8d-fb93-4082-980b-213c7a8a0c47", - "version": "2019-04-03T101603.200000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "8c61b419", - "indexed": true, - "name": "image_file_178.json", - "s3_etag": "e2cb8e6eb869c7afaec442ae0995344c", - "sha1": "5a7072fc808d4fa06e6d8419ba9134df1d811d17", - "sha256": "0770fda7d1a5547dc66457035da318cc219c375a41f39ca46a96e7be9ff44cea", - "size": 436, - "uuid": "bbd60a79-3572-42c0-8e53-b0c566a72f06", - "version": "2019-04-03T101600.196000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d6abb209", - "indexed": true, - "name": "image_file_179.json", - "s3_etag": "6fe43e50969938136da468e2e8894acd", - "sha1": "928483c2c0bc4d342881b2c25545d01f16c7cb71", - "sha256": "e7747c7be140489f48c578f797c0dabd4d5e9c3910e3bc76a23c1e692689a232", - "size": 436, - "uuid": "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", - "version": "2019-04-03T101603.144000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "b7d162e6", - "indexed": true, - "name": "image_file_180.json", - "s3_etag": "65cb49caef64788194172bf4fd7417ec", - "sha1": "c0872b0193ce9e8fc448fe9e94a6beacba1746e2", - "sha256": "437a5501e4310cf20869d13dfc3a8cfddde42934d1bfa8cc0a4cb444ecf6ccec", - "size": 436, - "uuid": "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", - "version": "2019-04-03T101600.186000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ab6d5527", - "indexed": true, - "name": "image_file_181.json", - "s3_etag": "0d1c86f83d065d1343c9e1d5c8369510", - "sha1": "36dd9aa93668a920858e37c85f8c02e719b0bf8c", - "sha256": "d1d7ee9652037db25e4c2656e9a86ed0a760a847db8bf82ffccd4f2d17f9dbe9", - "size": 436, - "uuid": "240a67cc-e827-41bf-8ac8-a66bc2797f13", - "version": "2019-04-03T101600.772000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e8a5c694", - "indexed": true, - "name": "image_file_182.json", - "s3_etag": "e8041e3fc5a4750d673038c51a56cb2d", - "sha1": "82f3db843dda004956f0601eba039e06c73f80e4", - "sha256": "3b5b2116d087aa66be81e7a4cf01aa166b451059644666a5ee9de2853fd9429e", - "size": 436, - "uuid": "7a9b6534-fa1d-4282-a064-11e60e57a322", - "version": "2019-04-03T101557.638000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ebb4c9bf", - "indexed": true, - "name": "image_file_183.json", - "s3_etag": "e36ac86b45f4c7bc73fc805b0f6fa961", - "sha1": "02fbfef61f6e0348e3c951fbf884fdf424580d59", - "sha256": "14cea205be35245bcff2ef4edc06477006e533f2373efea065b9cdcc31c21429", - "size": 436, - "uuid": "b0af6371-4379-45f0-8c09-f6610833fc46", - "version": "2019-04-03T101557.644000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "d55668a3", - "indexed": true, - "name": "image_file_184.json", - "s3_etag": "eadfb043eb2f4e2b9553455bd0626bbe", - "sha1": "3ef44a8184b22183b8a4ce40c6ecdb5988a4dd3e", - "sha256": "dc39ccec6bd7573b1f78c794feaf9a56a6242c450a2cc98d5e2fdec9fcd0ed1e", - "size": 436, - "uuid": "f5ce7a96-cfc0-42c4-852b-386f9a27111d", - "version": "2019-04-03T101600.829000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "53b106a3", - "indexed": true, - "name": "image_file_185.json", - "s3_etag": "f5b281bace437f0502d62470e501693b", - "sha1": "67e6e702d619d4a3512efa44c0cdeb5c8a3a88a3", - "sha256": "a9d796b59974679d51b813ca6c2e08b5871b264c659fe31234a99905d6f317a9", - "size": 436, - "uuid": "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", - "version": "2019-04-03T101600.329000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6ae63063", - "indexed": true, - "name": "image_file_186.json", - "s3_etag": "307348fe8a62a4ec8a32f02d521a8e6e", - "sha1": "cc02d734a6a3432c53491b260975b8dd4846efd2", - "sha256": "77437331eff788ff99d67b5804f15a4347ec9203e4d6f83dc1ff41b250ad5bfb", - "size": 436, - "uuid": "3dff4add-7d6f-418c-afba-e46864af51d2", - "version": "2019-04-03T101600.156000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5a599407", - "indexed": true, - "name": "image_file_187.json", - "s3_etag": "f1339701f3d7b1a9d98143cfcce2a9d1", - "sha1": "98034f929d70572f5e6ab495e589823d17bd2d9f", - "sha256": "a752ff9735b42b9c6b53933327b5e6bb3ffb5a206eec41359e3fbe673543b0be", - "size": 436, - "uuid": "ab2b7c67-8f13-4388-acd7-e2abb0091f30", - "version": "2019-04-03T101600.743000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "31501c3e", - "indexed": true, - "name": "image_file_188.json", - "s3_etag": "25c95839ffa6224c6fcdc4777e508037", - "sha1": "ea040cf44c3033efe8cec73cfca87e8c280ae54a", - "sha256": "eff85621d5f8a8c61d7ad52200b0fdad1012e96f95cb22f9306774f6f412814e", - "size": 436, - "uuid": "d9912d93-3d92-48d2-9f75-826fbba3d94e", - "version": "2019-04-03T101603.046000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0abe958f", - "indexed": true, - "name": "image_file_189.json", - "s3_etag": "bd3f5852479205f5ec532855bad5bee2", - "sha1": "d4e050415bc653c7d81d94964f5a6fbfa5b2f14b", - "sha256": "4303ecc0597efcc9224f0284b47187457b1d22944dd0b9e017c06dfe7cd58524", - "size": 436, - "uuid": "8b37aba2-be5e-4963-8e6f-51a2df8e143e", - "version": "2019-04-03T101600.282000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "943e901f", - "indexed": true, - "name": "image_file_190.json", - "s3_etag": "dd592f9bd23d5aa50b12b7c5267a8cd0", - "sha1": "b189a418690be8517f963e5e667ad41e590f72ca", - "sha256": "10825c134cab0e3102cade1d845de5fddb61e752251230a8f908bb5aa6e1554e", - "size": 436, - "uuid": "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", - "version": "2019-04-03T101600.805000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9647cd7b", - "indexed": true, - "name": "image_file_191.json", - "s3_etag": "9e416c44355791d612ea6267d888078c", - "sha1": "938ffbf6ca9d303d925c986528dc7a8043dc47e1", - "sha256": "a15f99f58fa393134674a570f7f9456092547ad00b9462e6d3d448e67311fedf", - "size": 436, - "uuid": "2d7e88dd-bddd-4289-9556-27d301be0b83", - "version": "2019-04-03T101603.188000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4da02a27", - "indexed": true, - "name": "image_file_192.json", - "s3_etag": "7092c013124e5859bd69b7fe5b339053", - "sha1": "47472c37e3bc6100417316ab38dbfc111a637200", - "sha256": "43bfae4c58e8fdc505b85af39975ea3f7c907f8c1b3c8f83c9429f6902bf3644", - "size": 436, - "uuid": "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", - "version": "2019-04-03T101603.221000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "3256a7ef", - "indexed": true, - "name": "image_file_193.json", - "s3_etag": "d6117a6abe3d50b2dbe264dbe0c73e56", - "sha1": "6bd41d7486a9e6b5f51352b94cacc6781e6b902b", - "sha256": "c0b6f1bb3710d53f0851e894bc72644f11b0b020038661a10522765f1d7753cc", - "size": 436, - "uuid": "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", - "version": "2019-04-03T101600.822000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "9a11820d", - "indexed": true, - "name": "image_file_194.json", - "s3_etag": "d4c556de6670e046839e7cb11437b5e0", - "sha1": "ade1f482e297204d83b95182f816345122a94bea", - "sha256": "3540055a11816fa6f72725db6f5b57e1030229ef05011c8b612a3adb68122c50", - "size": 436, - "uuid": "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", - "version": "2019-04-03T101603.130000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "7355d406", - "indexed": true, - "name": "image_file_195.json", - "s3_etag": "f05c4c34f04b1438d00d90510e0fda2c", - "sha1": "e1de51e42ce3081bebc99823fd2c190b5b23451d", - "sha256": "2e9f75c40aba60a6adb0997169e35dce1849cb7aaddae973bb65fb873c6cceab", - "size": 436, - "uuid": "e834d3df-8432-40ba-b67d-c7cd0bd7328d", - "version": "2019-04-03T101603.234000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "dc6f1f94", - "indexed": true, - "name": "image_file_196.json", - "s3_etag": "a9940009deeab8048002e783153e2b71", - "sha1": "8a3a6ab8350e07f571d41acda03b4d71fcb572bf", - "sha256": "501e2e1a1370a0098b6d49bd30ea0412e409ee4e9c182f2a4d67bf608ec712a7", - "size": 436, - "uuid": "d8908d6d-5daa-454d-9082-726054cfddc1", - "version": "2019-04-03T101603.189000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4da217df", - "indexed": true, - "name": "image_file_197.json", - "s3_etag": "cfcd1856a0c424b0c950898ab7a6a4c9", - "sha1": "bee3506bcb8bc55b73fc2400f44954786cda09cd", - "sha256": "159f167c8f2cff0867dfdec5309f600367c82068a6d5cde76382570f1a8b64a0", - "size": 436, - "uuid": "c5a7142e-4702-4e84-b7aa-239df2a71ba8", - "version": "2019-04-03T101600.189000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "66d308ad", - "indexed": true, - "name": "image_file_198.json", - "s3_etag": "aa693959fee7931afaa88cd8627f2ad7", - "sha1": "0f1599c32f7c0603efe676f42a40aeabb8b89272", - "sha256": "730abec4612c2615243543b5dd7da6343f525bde84a1ec985578cd4e107dd78d", - "size": 436, - "uuid": "f69e44ef-cf23-4571-8dad-e44222697974", - "version": "2019-04-03T101603.186000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "33c37555", - "indexed": true, - "name": "image_file_199.json", - "s3_etag": "16c583f7c947c9e7e46eac026e60aeff", - "sha1": "a880caa603264e4f1bd78248d090d3d38adaf9e2", - "sha256": "f3627a523c3a78aa3c5f4ffa0ef0a10f30ff579886e86d072aa143cee8efcdcf", - "size": 436, - "uuid": "ea72f81c-2c58-43e2-acca-294254f470f7", - "version": "2019-04-03T101603.138000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4f9d0dc3", - "indexed": true, - "name": "image_file_200.json", - "s3_etag": "ea8d055f71652fb993d0a9ba990fe6f7", - "sha1": "6f2ff0c115545528c7f1725bd75130e3f85c8826", - "sha256": "2c63249c5f51b31921220d211469ef230bf17255f2a7b72393274dfb74310a55", - "size": 436, - "uuid": "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", - "version": "2019-04-03T101603.194000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6545d3ad", - "indexed": true, - "name": "image_file_201.json", - "s3_etag": "e44e2552c5f84e6c3e48c786cdf91eef", - "sha1": "334da492b9decfd6f0b6150de4badef3985cb62d", - "sha256": "8c398968ba0ec196d35e5810d2a3d6917cd3267df54753c32656df264f33e11a", - "size": 436, - "uuid": "6928ac1b-fd1d-436c-bfc6-4087c65809d7", - "version": "2019-04-03T101603.234000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5f297898", - "indexed": true, - "name": "image_file_202.json", - "s3_etag": "3f97fb45b0aa9ad15d4b33d2deb13cfb", - "sha1": "5ebd659f8c945b53dadc5bb8387b844193d1564d", - "sha256": "65bdb91e69ce438a2619d7b9ada56b427ee9af08d11fd88f74f7eb2583211b04", - "size": 436, - "uuid": "07a7b938-435b-4804-b140-c255957b6532", - "version": "2019-04-03T101603.185000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6309ce75", - "indexed": true, - "name": "image_file_203.json", - "s3_etag": "802ddc31415f6844ad5edde301277bab", - "sha1": "46dab9b40a059b07b66c20460d78fb339865cef3", - "sha256": "10e080dccc25d94be0fe7c5965f6e2279f3d60dd418151c16be14893785c4b3c", - "size": 436, - "uuid": "3d532a7b-55e7-4461-afbc-65ef76403384", - "version": "2019-04-03T101600.225000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ecf8ad3f", - "indexed": true, - "name": "image_file_204.json", - "s3_etag": "d1bb8cc02f277b89318e522871cf25b2", - "sha1": "3b5f585065998897b105712dae34566fe88e6ac7", - "sha256": "260fdb27cc3ea57d0bb08c40485463158f3013d01d871089b3c510875a810649", - "size": 436, - "uuid": "bab40245-28bd-49a2-8be0-ba109fe41c91", - "version": "2019-04-03T101603.171000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "09a90cff", - "indexed": true, - "name": "image_file_205.json", - "s3_etag": "14e0ccdb5b77a8414129aa62f61fc78c", - "sha1": "0cb0c0271bd3500212e632500061289b56a3cc9e", - "sha256": "bd4382ac05f05d6808cbb00d20a73511fa28a78236e5a9a6bd1113bda3e128c0", - "size": 436, - "uuid": "9d577bd4-3a27-48be-ad7c-8c44cf803cda", - "version": "2019-04-03T101603.221000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0ab1069a", - "indexed": true, - "name": "image_file_206.json", - "s3_etag": "ebad1a9676f5cd8ddd76b59469365f25", - "sha1": "a02f2712de9609164c787eccccb401a0fc2422b1", - "sha256": "70f034e93920e9e72e3c5160af51973ca06d56313aced23c6d07c9b8af0733b6", - "size": 436, - "uuid": "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", - "version": "2019-04-03T101603.221000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "4f6d7b32", - "indexed": true, - "name": "image_file_207.json", - "s3_etag": "674fa2f644dc280e8874fd77c67b65b0", - "sha1": "6a3ead886a2cecf569e76c38e6e16743a892b430", - "sha256": "6a65d8d223e8f5ddb9b72dbcbb39cdb41f7e334f85c7e80c84166e63265f72a9", - "size": 436, - "uuid": "21a043b6-6dde-41b9-b20e-74b961da8b88", - "version": "2019-04-03T101603.210000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "6fd7c500", - "indexed": true, - "name": "image_file_208.json", - "s3_etag": "fad6c874b12fdf861b2ee1c4bd36bb5a", - "sha1": "972861c7b3c8c6b833ddffc2102c188d0c9e7668", - "sha256": "dfb12987a66cbd856c6122ff9ffabc66b110bd3794447584b2e4e042f0439931", - "size": 436, - "uuid": "11280200-1803-4110-aa84-2808776c2d50", - "version": "2019-04-03T101603.231000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e44d37d5", - "indexed": true, - "name": "image_file_209.json", - "s3_etag": "8b7df9541519a143b24a6efbabe04592", - "sha1": "86e91b50dc2cf55b43fd27c372ddbb5be77f49a2", - "sha256": "143846cd99c35193269dab6470281b9a54f5ba2e40abd20c91f355ccfa1cab0d", - "size": 436, - "uuid": "86df5269-576b-4d18-a0ce-6e2b2a36d51b", - "version": "2019-04-03T101603.201000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "aed7c6c5", - "indexed": true, - "name": "image_file_210.json", - "s3_etag": "1dc957991f3dc47a4292858e839ddc56", - "sha1": "16fa84a5f08af175dd92bb47811a6abd839bfafe", - "sha256": "f27ec531816c73687775c4e23383360b391ebb49ad0c88744bbd223f3b1fd66d", - "size": 436, - "uuid": "e524ff4e-95fa-4561-bfd3-276cba79e664", - "version": "2019-04-03T101603.251000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e11997ed", - "indexed": true, - "name": "image_file_211.json", - "s3_etag": "0b1f1ff61c989b5a5c685d3ccbc60476", - "sha1": "f82c40bd3683f5849104f7f4aae6f72d73661bfd", - "sha256": "7b748dc98d840bfd0a139c9f0de4a1a53f6f692d3f136578d03b78659a4f0320", - "size": 436, - "uuid": "3d5737da-b1ab-48cb-a26f-d420e53edccd", - "version": "2019-04-03T101603.057000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "65ca1c77", - "indexed": true, - "name": "image_file_212.json", - "s3_etag": "99580b225944a0d096deabaf5279c470", - "sha1": "9b33db6b3c9e8fc952933e0b82defa4401c2c71e", - "sha256": "ed1cfc8d52b5c9fa19d2ea0531013c7e9d01f4bf9492687d53925255ea6dada8", - "size": 436, - "uuid": "44cf15ec-3d4e-4698-bb14-107c34891191", - "version": "2019-04-03T101603.206000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5097e346", - "indexed": true, - "name": "image_file_213.json", - "s3_etag": "033e7fb4d352e321525c0514b6532a80", - "sha1": "1976d07dce9994fdb19a7fe110263c2090fdeaa5", - "sha256": "7a684c6ff1f586c22ddcc29274708e8dd39243cef585e7c23b6f3ea3b83e5d36", - "size": 436, - "uuid": "6242cdf3-fd6d-4479-a08a-1747818fd978", - "version": "2019-04-03T101603.054000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "eff8f3f2", - "indexed": true, - "name": "image_file_214.json", - "s3_etag": "8a816b32f72ba899fb407dcac8be12fc", - "sha1": "3dae82c6a46778cc78344fcf46bdc6e00561892a", - "sha256": "ff7884099be508aa2e7dd90e1f1ce1d5067281e4427e3c4a757b71f4f1f75eb2", - "size": 436, - "uuid": "bc60bbd4-8b09-425c-b507-9da24a84f412", - "version": "2019-04-03T101600.270000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a1e3c2c3", - "indexed": true, - "name": "image_file_215.json", - "s3_etag": "f0c377795388b4af6e641f3ba4bd3908", - "sha1": "24403be8640fc36abbc6eed905387655b2b635ec", - "sha256": "2ef2610b443952e5efd36f3d9f3c818fa99d7a3517db805c96328764bd3a42fa", - "size": 436, - "uuid": "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", - "version": "2019-04-03T101603.187000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "0af643cf", - "indexed": true, - "name": "image_file_216.json", - "s3_etag": "8e04eb323bc027d710b7a802932d7f8a", - "sha1": "e26338c1059ec6209839b573757cc5a7b65a265b", - "sha256": "b42e6be60f48d35430fc399eb63b72c42f8f9ab11c079aea8bef9cabb1892167", - "size": 436, - "uuid": "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", - "version": "2019-04-03T101603.267000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "28d5149b", - "indexed": true, - "name": "image_file_217.json", - "s3_etag": "c6c0e3633316132ba255324a87789704", - "sha1": "b4744014f0b1b83ebfd0a755121353902abc7928", - "sha256": "50b685e95463faf94c400143815a574cc4aa9b984488ccd03cee33c755e02cc5", - "size": 436, - "uuid": "5f67c32c-a154-4620-8603-0b64979b04a4", - "version": "2019-04-03T101603.116000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "a6f81947", - "indexed": true, - "name": "image_file_218.json", - "s3_etag": "c492a023e43c8177d018251d68946fba", - "sha1": "0016109014a7e6b8742a0ff4443714f9401d5439", - "sha256": "d6447e02ee2ff36d7d42071b32ee1e814ec64c4335210fe48a1d36e2f29d7eb2", - "size": 436, - "uuid": "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", - "version": "2019-04-03T101600.148000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c1671858", - "indexed": true, - "name": "image_file_219.json", - "s3_etag": "a92c3bb219668bd6fe9ddd387e5fd6a2", - "sha1": "6c57f300b7ad0ac6ccf40cbbd7791bfd25d4a825", - "sha256": "4aa21e087622ab8cbecb91e80202e0fe6eca02bc40114a7229847f6686a366e3", - "size": 436, - "uuid": "dcee6df0-9e87-4935-8873-f8d30d449d76", - "version": "2019-04-03T101603.250000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "142f74af", - "indexed": true, - "name": "image_file_220.json", - "s3_etag": "73f043c5fdf69f67755b00285193fc6a", - "sha1": "51a41a28e7cf05df69ada6c13a55e9ed1880802e", - "sha256": "baa5d34971192d61678bdd15863c1bbcfd3ab80c0b9062b09a9f2308cac4602b", - "size": 436, - "uuid": "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", - "version": "2019-04-03T101603.126000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "1cf00c3f", - "indexed": true, - "name": "image_file_221.json", - "s3_etag": "59b0cbad2c4d14d7f35e0ca97d354e18", - "sha1": "db9399669c6f640f57cd49a33604000cb213fe39", - "sha256": "403dfcc537a0878b1ff87616de9a953e5abd92dff4b01ab36b43f9ce27aa1f85", - "size": 436, - "uuid": "e6d00b0c-3641-4ec4-a553-8fd742193dba", - "version": "2019-04-03T101603.321000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "e549eec8", - "indexed": true, - "name": "image_file_222.json", - "s3_etag": "725ed7a4c652c8ab3ff4fedb778bc727", - "sha1": "69521b67baefb86d6469c97e0310bd964bd776d4", - "sha256": "d60c19c0cff56667cd7db55fd969347184aec7d9e742727e2e1c92d6a8e9af94", - "size": 436, - "uuid": "e5034863-0528-4f55-be95-c8501c29f9fe", - "version": "2019-04-03T101603.187000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "075c3661", - "indexed": true, - "name": "image_file_223.json", - "s3_etag": "425b40a916d858690c908accd215e8da", - "sha1": "9172f676906e65b3bf699df63d8070d1134d7a10", - "sha256": "ef9b0b23c97b0a5845a9d70e823a131e5e13cb2f998ff2443c7b8b7c90eb57c9", - "size": 436, - "uuid": "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", - "version": "2019-04-03T101603.190000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "c44ddd7f", - "indexed": true, - "name": "image_file_224.json", - "s3_etag": "d45b1b18711dd1b99070f27b3af3281b", - "sha1": "459fbb025f924c9ef5e1f422c1ad408ac61624cb", - "sha256": "f31b35f3fd69b056e5a66d50f2e6fbf51ab9be28d420c8bdfe96a7ec013c26ba", - "size": 436, - "uuid": "33d332c9-aefe-4db5-8830-b8daddaed0d2", - "version": "2019-04-03T101603.189000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "ed7d68e3", - "indexed": true, - "name": "image_file_225.json", - "s3_etag": "dbbc913443606f9d8b1c43c590c2d7c3", - "sha1": "af4e4450bc7144799d8f581375e2a3a0dd5761eb", - "sha256": "4feaddde2e62cd14f4a67dec0e6fcba07373c3fa2a3cf3466695d35b1c06b979", - "size": 427, - "uuid": "bb3b6fc7-0902-432d-bad1-6b3f61951314", - "version": "2019-04-03T101551.086000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "58093cc3", - "indexed": true, - "name": "image_file_226.json", - "s3_etag": "c1e51b6c77c9d208626ddf5e7d3951d7", - "sha1": "d30dd623586c97c563fa5f4fd12aa79a706351a4", - "sha256": "31a35a35da5f28cccd7ea6dd5a0e810235bbf3787a80965c7652e591513592ce", - "size": 419, - "uuid": "2b734e88-3a33-4c73-92bb-82e0b8f8c13b", - "version": "2019-04-03T101600.280000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "e6c51cf6", - "indexed": true, - "name": "project_0.json", - "s3_etag": "b6d170f857fa7fd8b13e03079e2f15fb", - "sha1": "ae7695391f2f364c04107af9b529cfbfba92c051", - "sha256": "7ae0b7e40be3a5cbd41ebebce232811ce29360d8407bfad4f9ae553e163a138d", - "size": 756, - "uuid": "ae5237b4-633f-403a-afc6-cb87e6f90db1", - "version": "2019-04-03T101345.439000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "e3ef942b", - "indexed": true, - "name": "imaging_protocol_0.json", - "s3_etag": "3a882352a630779046f9b4bf64e933f0", - "sha1": "db393c6e709a31d7b8192fe94b2024bd4a74711e", - "sha256": "9be854f39a2b314701c87a34d84f0cbf1f43c9af55a6e9eddd7364d7a4ec52e7", - "size": 96127, - "uuid": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8", - "version": "2019-04-03T101345.902000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "1ad2ebc4", - "indexed": true, - "name": "imaging_preparation_protocol_0.json", - "s3_etag": "ea9b7320dbaa133b33485c777be89dc1", - "sha1": "d5f6f071aeaaa7035190ae0a0429c4290d7ce67c", - "sha256": "57c5cb7e10be8475a6ae84669d6779d1943b35e8152a3e39caaeda5f1e412a7d", - "size": 728, - "uuid": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38", - "version": "2019-04-03T101345.426000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "ea6081b8", - "indexed": true, - "name": "collection_protocol_0.json", - "s3_etag": "91d9e560eb9460461b962c9f92770fdd", - "sha1": "be3b0f1d567f4c05c94e729d12393ff809916c67", - "sha256": "e1406be5355ccc4a2b7b083a4b30bd1ab5425e6eec14ebd74d16b336a1effd6b", - "size": 754, - "uuid": "caf94c25-8327-4379-b88e-2a6642cd7513", - "version": "2019-04-03T101345.505000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "571fe4a7", - "indexed": true, - "name": "process_0.json", - "s3_etag": "3145cd2fb4d819d6f269cc3e1c45d828", - "sha1": "64d4fbfb0a9b95a936e56491d2aa10fb3f3848b7", - "sha256": "4ef95348502eb3cc1dac9f871fc6923192e0bf24c794d5ff8173097b60951a4d", - "size": 395, - "uuid": "da265acd-5601-49c5-855e-d792d51b4042", - "version": "2019-04-03T101403.513000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "d871679a", - "indexed": true, - "name": "process_1.json", - "s3_etag": "f19d5dd5447b3c3ae71e7a8c53036810", - "sha1": "2ee999381c4537f4ab99341609278f54274f188f", - "sha256": "980ae82ccc6b879a6730b0196617611bc997446ec6d3153761e4d7a2b814f641", - "size": 389, - "uuid": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", - "version": "2019-04-03T101353.863000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "3f78937c", - "indexed": true, - "name": "process_2.json", - "s3_etag": "6b8172e9d10c70772a48378b6a175440", - "sha1": "c52486236d65aaee58015639115ce13b0a272fca", - "sha256": "c1bc257d37abcb9d1de6cee118cbb211e1dcddeb4c0ce88ef740b425fd873381", - "size": 389, - "uuid": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", - "version": "2019-04-03T101353.834000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "70bbc6b8", - "indexed": true, - "name": "links.json", - "s3_etag": "7385add25e1c482b4d9b4881fb3e196f", - "sha1": "df323c0304644ec6c9cc94694198f568fa43ca86", - "sha256": "3cec4e10f26331a01ccea9741267a9d5a59a00a39b5a67059cd3f18eb3030663", - "size": 14532, - "uuid": "48f0d8a4-fd04-4fee-8301-7441b6efcf48", - "version": "2019-04-03T105534.952135Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "d1fbf93a", - "indexed": false, - "name": "codebook.json", - "s3_etag": "f8b57fb434c840df94b55a56c77450d3", - "sha1": "0af7a2aca946bb2c8680932196ebb9020baa414d", - "sha256": "87ca14c8e7dfe4dcce1ac4d8a14423babdb74763ce13c59a755da3f6719ce8e8", - "size": 832, - "uuid": "34d230e7-dd9f-4a47-8d5b-23043fe43bc0", - "version": "2019-04-03T105535.336469Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "88def662", - "indexed": false, - "name": "experiment.json", - "s3_etag": "f67915ee4d014041844dc020d29e4ddf", - "sha1": "9153498094d2a7c53998168de9211e951bad523a", - "sha256": "82464691f44b4f0cafdcd3e9854a03074432bb36547fcc7184b3810c644d8bcc", - "size": 186, - "uuid": "3db743f3-8235-4553-9a70-37dee987dd64", - "version": "2019-04-03T105535.723353Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ad2281ce", - "indexed": false, - "name": "nuclei-fov_000-Z0-H0-C0.tiff", - "s3_etag": "d2daf199d12d7b04320e4bb052f53986", - "sha1": "82dca7b68d4860c565668be2d6b044476e4095c4", - "sha256": "0589dd5b928af541e1659017e95ba6d9785749a3f4f476d294f0c93df240b121", - "size": 1600269, - "uuid": "13ce8b32-13df-411e-8874-810de85a6d51", - "version": "2019-04-03T105536.220197Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d8b5d806", - "indexed": false, - "name": "nuclei-fov_000-Z1-H0-C0.tiff", - "s3_etag": "67cc6b7a2a8d677c159de350edef6bcc", - "sha1": "ee20d8d4e134e893394a1a03bdc866f397dd6687", - "sha256": "1f5a3012c9ef4a4770308912f8f46607182e3c38a3ab8a3bacb22f292d1694e1", - "size": 1600269, - "uuid": "1eb42fec-c278-43a5-b3a3-b68d998b3a2a", - "version": "2019-04-03T105536.479486Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3b0cdc15", - "indexed": false, - "name": "nuclei-fov_000-Z10-H0-C0.tiff", - "s3_etag": "1753dbb2290e609761ce3f84dd0afc24", - "sha1": "95e12c876c352476ea4edb096ee6dc1796bac431", - "sha256": "23e8f06cae4c966865c79a2191cd5a681ec2ed7b02f20e790b0c229c8d548465", - "size": 1600269, - "uuid": "fe9c7709-3a1c-4548-9578-01e4a63cc9d3", - "version": "2019-04-03T105536.745978Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d1935fb2", - "indexed": false, - "name": "nuclei-fov_000-Z11-H0-C0.tiff", - "s3_etag": "b35770d5b97ec9b27fd308d80061b72e", - "sha1": "7d5e13f9db6b1cce6c416daf66bec1a337d8a4d1", - "sha256": "07977366ff55e8863a6df4924d16d7cf9ae7f94b8cfc638ba004c5817b7ad22b", - "size": 1600269, - "uuid": "508e6ec1-6693-4ffb-aa0c-53940a9b1a30", - "version": "2019-04-03T105537.018211Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "817e676f", - "indexed": false, - "name": "nuclei-fov_000-Z12-H0-C0.tiff", - "s3_etag": "116d31fb34c9fc4690871fabb44148c3", - "sha1": "a49d6792ecb9c0bb71c8529045ea1e3241e08b2b", - "sha256": "d8b766da53f216a594da6ba833c99bd8213bee52058cec0d48647602c97de377", - "size": 1600269, - "uuid": "9d66777d-7af9-4cf2-bcd7-6d4b0cba8fab", - "version": "2019-04-03T105537.249443Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b3be7c25", - "indexed": false, - "name": "nuclei-fov_000-Z13-H0-C0.tiff", - "s3_etag": "6ee57a84a94c6092903e173a2d1a9aca", - "sha1": "fe2a6ea83f6bcc3a1f5da9bcebf375e6f65556ac", - "sha256": "0a4051c4b023501f0c82111379daa4b4763b7428f37ae0e609acfcfdca96dfd1", - "size": 1600269, - "uuid": "50b7b8e6-16fa-4e0c-999a-42cab234b1db", - "version": "2019-04-03T105537.599532Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "acf4da3b", - "indexed": false, - "name": "nuclei-fov_000-Z14-H0-C0.tiff", - "s3_etag": "e4f1a1d854cdc849172788991e2e53af", - "sha1": "f19b5381231a32d27a71777f93042e66cbf7e4ea", - "sha256": "80e1471ea76d4e4ef929130494ca206c1f3e42600936d65cfb4347d5764d1678", - "size": 1600269, - "uuid": "c4be485e-8f30-454c-a641-7d0ff3cafb4a", - "version": "2019-04-03T105537.940591Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "527eec28", - "indexed": false, - "name": "nuclei-fov_000-Z15-H0-C0.tiff", - "s3_etag": "d68135d3e69d3e53f2823c88c443a8cf", - "sha1": "83c3ed3a8fe54080394881357653bd7c0fe179a2", - "sha256": "934dc0c464a532d89bf0d5f29004466a64c648561ffe56945faba7f63bba0679", - "size": 1600269, - "uuid": "23fad5c1-d704-479d-b8cc-a629fee2b340", - "version": "2019-04-03T105538.199379Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "60e20c9b", - "indexed": false, - "name": "nuclei-fov_000-Z16-H0-C0.tiff", - "s3_etag": "7145c8a469f01dcd600febdd94e10591", - "sha1": "27dbacb8100155e78851842f0eee89b5ccd91542", - "sha256": "822a57a48974c1f0fcaf5b0565652876ec1b4265558942222830ab9d246bfe26", - "size": 1600269, - "uuid": "4a9702b6-04e4-409b-a241-42540df7a07f", - "version": "2019-04-03T105538.500545Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c031ab08", - "indexed": false, - "name": "nuclei-fov_000-Z2-H0-C0.tiff", - "s3_etag": "6164a16c6ea593bf5ad7527860c155eb", - "sha1": "c783cb51f109af91225f99ea3114e918f6b0564c", - "sha256": "ab38699d9d1abe447b38225d70490aa0ba7a92cd02bffd4a3a18d8ac1bd13d5f", - "size": 1600269, - "uuid": "bb22c7d2-a22e-4e97-ab75-5bf44d95aa47", - "version": "2019-04-03T105538.750403Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "46b7935c", - "indexed": false, - "name": "nuclei-fov_000-Z3-H0-C0.tiff", - "s3_etag": "8222dac4e29d16a650ad20a1a1a8c5ae", - "sha1": "45b2fbe7405043b09a6e93d3cb2ef7f7c1d8bb6e", - "sha256": "e7ee71cf986302b3466c2c19d0a00403d381ded671bf3a8b631582d35a2177f0", - "size": 1600269, - "uuid": "3047eca0-886e-4989-a220-c35ee497ed62", - "version": "2019-04-03T105538.997194Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6571f990", - "indexed": false, - "name": "nuclei-fov_000-Z4-H0-C0.tiff", - "s3_etag": "4654641a3711f09ab256f7617f558162", - "sha1": "23383caa829a08b3a05cbd76d7a41de87417e0a0", - "sha256": "28a01a55f7889ff47606ac9c785092231908f3418c3821da3be58b03c410d7b3", - "size": 1600269, - "uuid": "86df917c-0969-4e27-8f29-ad2b73837818", - "version": "2019-04-03T105539.261002Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6c5755bd", - "indexed": false, - "name": "nuclei-fov_000-Z5-H0-C0.tiff", - "s3_etag": "4284d4f412a74007207bb3a7592ecec8", - "sha1": "69e9b6ab402527be214cd08732a0d8190948d11b", - "sha256": "d8e7819f4dff7d2ef181c459f3ec538d38fe43a093706772e02c42d2aa28fb0f", - "size": 1600269, - "uuid": "25ce5f57-b9e8-4403-aa8d-6e0d69044683", - "version": "2019-04-03T105539.480189Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2e614198", - "indexed": false, - "name": "nuclei-fov_000-Z6-H0-C0.tiff", - "s3_etag": "0395c6734209a2fb9e4b2b507528555c", - "sha1": "829b3ccaa580580a94675e08c5a42a8f29f8ae25", - "sha256": "240f3bb6f1614280f772073723d721c4e92f379b7e1db3a866884c2ef32d8333", - "size": 1600269, - "uuid": "2f887578-9f16-4dcf-86ad-b8967c32b7a5", - "version": "2019-04-03T105539.720912Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5ce077ba", - "indexed": false, - "name": "nuclei-fov_000-Z7-H0-C0.tiff", - "s3_etag": "8f1f102df1957b494923fc5d170c1d71", - "sha1": "d039df202d60522d38ccdb9a0605472a755e7558", - "sha256": "7632def6e8897eea870cb47f2d1925bbe24ece886696c646dbec63835fe44636", - "size": 1600269, - "uuid": "275513cc-14aa-4ea8-9da8-f47ef8524e37", - "version": "2019-04-03T105539.960131Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "40df3cb1", - "indexed": false, - "name": "nuclei-fov_000-Z8-H0-C0.tiff", - "s3_etag": "bcc7c062ffb6535c2d14b9e25b26786c", - "sha1": "644f28b846c88d16391cbb0cf8ec9ffecc2e5f84", - "sha256": "d1a1c9dfd8422ac2c0dc965ac6ac44ed6c008b4529c4f11c61c54f2245aa1b76", - "size": 1600269, - "uuid": "1f9c2a23-a564-4fd5-9682-7c7d4a68b436", - "version": "2019-04-03T105540.220248Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "95200df1", - "indexed": false, - "name": "nuclei-fov_000-Z9-H0-C0.tiff", - "s3_etag": "d7d0114775507a0500a0f0ba78424d38", - "sha1": "6da2cf3544c519fef20e267b649a5f396eaec045", - "sha256": "43fee434f3dcadd88f911f64b64611f66e56ae4ba428827fded65babfdcf3ebb", - "size": 1600269, - "uuid": "6c37dc76-a843-4009-986e-90f28512e5ef", - "version": "2019-04-03T105540.469870Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "4e149113", - "indexed": false, - "name": "nuclei-fov_000.json", - "s3_etag": "b1c2b59d6f156cd2b0f8d5a660627411", - "sha1": "0256b1daed586807e3aca60f080f68387047ab7f", - "sha256": "648c306a1d4dfb9641f4def7efb3ad3fe299f0c459b83bdd6f88fbc9adc53219", - "size": 4690, - "uuid": "4ed6be97-90ba-4e59-b81f-6432a13ce7da", - "version": "2019-04-03T105540.859515Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "f456645f", - "indexed": false, - "name": "nuclei.json", - "s3_etag": "8c3355f66685fcab73eaf5c7030fa178", - "sha1": "846d7f68755d488e57701c01c1e19ff76398fee2", - "sha256": "fcd7959c7a5df652934f5866aaacb44675bd6bb643d2ce0dbe66139a50048b06", - "size": 112, - "uuid": "d79a3b8e-7031-43a3-9ac3-0f93dbd3228c", - "version": "2019-04-03T105541.199977Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5919ffe8", - "indexed": false, - "name": "primary_image-fov_000-Z0-H0-C0.tiff", - "s3_etag": "a1c6a5e8fa17ebdf33eb0ca5659f1ac2", - "sha1": "1c0256e517b262f98f75ae9473de02275fa88b85", - "sha256": "85c5be8c3b6e4242837162f693f5d1bfce5300a32dc6ff5c30db24f1372e9c25", - "size": 1600269, - "uuid": "4777d5a6-1e0e-4041-8a30-b95a0e98d95c", - "version": "2019-04-03T105541.479157Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "dc899808", - "indexed": false, - "name": "primary_image-fov_000-Z0-H0-C1.tiff", - "s3_etag": "092438df9d1c75434c86b3a44abd3e34", - "sha1": "b815d45333f98a6e415f409f7f1f7646c50d98ae", - "sha256": "48c8b06f40fb077a3afe1089895fbda21ccca2111fe85c39b7b575fd39fa47f2", - "size": 1600269, - "uuid": "6309bae1-2138-4507-8a39-33bb19030090", - "version": "2019-04-03T105541.754003Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ef95e538", - "indexed": false, - "name": "primary_image-fov_000-Z0-H0-C2.tiff", - "s3_etag": "b8d01ac3aeb362bba01f7cebc3970c4e", - "sha1": "599979a65ef48582469bc5d7e16a72645da874d5", - "sha256": "a540dc4a9ccdcfeb2b1ba4061f7735747e776c3b2d1f9bac758d13173a34315f", - "size": 1600269, - "uuid": "30263603-56cd-48da-9694-8b4bacaaf7bc", - "version": "2019-04-03T105542.029318Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "41667304", - "indexed": false, - "name": "primary_image-fov_000-Z0-H0-C3.tiff", - "s3_etag": "ef267373bca39f6c022c1363b4014fa5", - "sha1": "3aa293167e534c86eb86e9603e655e8db1a344fe", - "sha256": "27e04905020b0b33e62f0bee4e1ef338cf24c1114ca58a71af7444d41fe55a9f", - "size": 1600269, - "uuid": "516cc5f6-45ae-4b5a-94ca-bc8a6ece4510", - "version": "2019-04-03T105542.261771Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6de2e7a5", - "indexed": false, - "name": "primary_image-fov_000-Z0-H1-C0.tiff", - "s3_etag": "37e50c5142ba89b0fee52882b441c2a3", - "sha1": "d3e006a7573788c42b24a9d1a7bf58677b1fa3ab", - "sha256": "baad4bcb11c43438f20f8e478666e7ec40ccd74c0b8d37e7119acd7dabb4dab5", - "size": 1600269, - "uuid": "e9a2424f-12b0-4ce8-b61e-29d859a1af3c", - "version": "2019-04-03T105542.605503Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b94c15e4", - "indexed": false, - "name": "primary_image-fov_000-Z0-H1-C1.tiff", - "s3_etag": "a14109d34d7467c1f367c36df26e3488", - "sha1": "d9883b3112b42265aaaf02f00b34de45b010dda5", - "sha256": "13232371857789fbb26be5f783f2df61e65064dad45d495e4c7c5eaf89f4a1ee", - "size": 1600269, - "uuid": "80269cb6-3de5-4818-97b2-fb3748d8facd", - "version": "2019-04-03T105543.080155Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "57641644", - "indexed": false, - "name": "primary_image-fov_000-Z0-H1-C2.tiff", - "s3_etag": "a843d6e5142dabe4d2ee18737fced212", - "sha1": "be5e106fa634516f0987016c58e99c43b5abf74e", - "sha256": "6033c84accb8aeaa13c1d120e18f3250961eefd15501628893fe80eb60861c82", - "size": 1600269, - "uuid": "06862bf0-7add-4177-9d3f-d95aec58c436", - "version": "2019-04-03T105543.440368Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2ef0631d", - "indexed": false, - "name": "primary_image-fov_000-Z0-H1-C3.tiff", - "s3_etag": "8dc65ccb1a30f1196a2619c75c001a6a", - "sha1": "52b27d8337b17bee034add31aa9f320331172719", - "sha256": "c8e712cb8d7c982fc222f4ebcda04a2f75f4dbc9808f77e71ee296ec8b900b47", - "size": 1600269, - "uuid": "9e9be46c-708f-4931-ad11-4fed782e3949", - "version": "2019-04-03T105543.739247Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "e84829d0", - "indexed": false, - "name": "primary_image-fov_000-Z0-H2-C0.tiff", - "s3_etag": "41ed5a93744a943d8fe70f2f3f17b96a", - "sha1": "cab05b18334080557b77701ab0550482feb7c2d1", - "sha256": "5abe3360206c21d661aeeee347e1e9bf3a65218798986c50b52328bd5c218845", - "size": 1600269, - "uuid": "6bfdc846-e6f8-4786-ac75-9fb7ac241778", - "version": "2019-04-03T105544.019854Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "0ad5372d", - "indexed": false, - "name": "primary_image-fov_000-Z0-H2-C1.tiff", - "s3_etag": "9aea02b0c75eb4e67c9f9fc43d5d3491", - "sha1": "272b6b0db0808768ca0719295bfc2fb296acf011", - "sha256": "f1d06980228acb649ce21b0ef38736ec78d04c4cbd07117f7d2c798633271cab", - "size": 1600269, - "uuid": "8d3f44f7-00a0-4fab-adec-401781b783e5", - "version": "2019-04-03T105544.392532Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8f903d20", - "indexed": false, - "name": "primary_image-fov_000-Z0-H2-C2.tiff", - "s3_etag": "6e8f2af5b0a2d3fc5025595ef1b2c2ed", - "sha1": "23489e202e34cabd7d9d61c46cfb451cdbfaaa2b", - "sha256": "a9200607a382651d0a0f8c74fe30b2c470f3004a6e3ccb7aa80394e905a89e17", - "size": 1600269, - "uuid": "b102d32f-1140-4ede-8813-8ed053f350df", - "version": "2019-04-03T105544.670961Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f419bc60", - "indexed": false, - "name": "primary_image-fov_000-Z0-H2-C3.tiff", - "s3_etag": "81d22aa6eada5862f67fc2f6aea4b90a", - "sha1": "fe091ab324b0c644d1c29bde67fd4f7e5cd84132", - "sha256": "c9d2705aa363a24172108e1951134e8272d251ca1e3c82c9aef40e90f059c75e", - "size": 1600269, - "uuid": "e4ba18e1-b072-41cd-a091-32b51b5078f4", - "version": "2019-04-03T105544.961246Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "0686a5ad", - "indexed": false, - "name": "primary_image-fov_000-Z1-H0-C0.tiff", - "s3_etag": "3c2fc50883f92b0b76e252ff12acaa52", - "sha1": "e041d31c5ca58e22c8fc16c2e4b79724517c9374", - "sha256": "c8ebf8c62c728145e8802ba9cf396ae5f5706ca1ca33602d2ea2287ad9df4988", - "size": 1600269, - "uuid": "c296fb80-3fb8-476b-b8ff-eae9e8c75388", - "version": "2019-04-03T105545.187187Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "68f4056c", - "indexed": false, - "name": "primary_image-fov_000-Z1-H0-C1.tiff", - "s3_etag": "aa85587e50c61f3c880f811af83589b3", - "sha1": "be1b220b93033b9f9cfffedb624017b5cfa0ee66", - "sha256": "2eb6cb0132ea1571b590522a167bd60479c7bf52cd671b0763df3178e87853e3", - "size": 1600269, - "uuid": "399445e5-b4f6-4f3e-8b65-bfc76f0e078c", - "version": "2019-04-03T105545.522173Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "533d7018", - "indexed": false, - "name": "primary_image-fov_000-Z1-H0-C2.tiff", - "s3_etag": "fac114b1689dd0fca29af6d3636fbdde", - "sha1": "ba56f9680075f5677ed7294406fe53b5553207f3", - "sha256": "ea883a274715c627c3a2615a1340c22d88f8c5417de3106a9aa666f0c02b851c", - "size": 1600269, - "uuid": "fbefb123-cf54-4eeb-9ec2-d826e44ad953", - "version": "2019-04-03T105545.766611Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c69cd6f6", - "indexed": false, - "name": "primary_image-fov_000-Z1-H0-C3.tiff", - "s3_etag": "816a7f3754cb7c2932ac7e0ccd3b72ba", - "sha1": "81551338a2440f0189af43a590750fdcd999c47f", - "sha256": "7c1d52008fd944b34aa86fd0a5d56a2c0d0360bd6c7939fcc86a5ca28312c024", - "size": 1600269, - "uuid": "8bf3db8e-e9cf-40e8-916b-b1e24449d79d", - "version": "2019-04-03T105546.280407Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4ee7d925", - "indexed": false, - "name": "primary_image-fov_000-Z1-H1-C0.tiff", - "s3_etag": "dea6ad5eef4899e73f04c8f4690d40b6", - "sha1": "5013191d6a7ab184c73a492f80075e994a1a4fd9", - "sha256": "37665c56980c1c395bcf89548565b40d44bd1a6e84bc31ba101d2e83818fe89e", - "size": 1600269, - "uuid": "2207ffb3-4f5a-47ba-99c1-b7d81b56168b", - "version": "2019-04-03T105547.016718Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a8a836cb", - "indexed": false, - "name": "primary_image-fov_000-Z1-H1-C1.tiff", - "s3_etag": "5e0e4bc2b50cc746ff593818d3eec6b4", - "sha1": "555c67dadbbfd481b3137d4a4a5ff6cfde52edf6", - "sha256": "5eebc95b1f0daa116d73359a0c653759910a84e2a086239105fd31cc2c463d6e", - "size": 1600269, - "uuid": "6b04d393-7852-48b4-ae14-8cfa4543c5ca", - "version": "2019-04-03T105547.282294Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1debd71b", - "indexed": false, - "name": "primary_image-fov_000-Z1-H1-C2.tiff", - "s3_etag": "068c894051c2c8b83133fdb7098a10be", - "sha1": "ced49b3e129ebb7516e2719ed98c90b9176065e5", - "sha256": "ab3b43d91b8106b24f550afb6b04e4ff06c29703b8b7c03b62b5ded3e3562bcf", - "size": 1600269, - "uuid": "d2859680-0fe8-400a-be0e-e04a3d832d1f", - "version": "2019-04-03T105547.626243Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "170b0997", - "indexed": false, - "name": "primary_image-fov_000-Z1-H1-C3.tiff", - "s3_etag": "d4bf941909636e00f4e65df0f937c3cb", - "sha1": "f368d9c51c85353f576504ce351dbe5f7c9abc20", - "sha256": "51a22aa82eda457911b822c3a67a6c3d2169c54b7204b66711ff6113d45114e6", - "size": 1600269, - "uuid": "467e4b98-519f-430b-8c59-57270f0e1259", - "version": "2019-04-03T105547.939813Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7fa1a6ac", - "indexed": false, - "name": "primary_image-fov_000-Z1-H2-C0.tiff", - "s3_etag": "fb985f9815313f8178cc81bba8e6899a", - "sha1": "44d97a67583454e7b540bf23634b635ec77273e6", - "sha256": "2783f3179b06e80ae1b5a0f45c40afeae45b8da41930d0c1e3e050d7e9698344", - "size": 1600269, - "uuid": "f7f95a37-370c-459f-bf84-19691fb195a5", - "version": "2019-04-03T105548.236748Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c57cc4b9", - "indexed": false, - "name": "primary_image-fov_000-Z1-H2-C1.tiff", - "s3_etag": "bfb6be8b742f97e57548a08c2f520360", - "sha1": "2de2a3814a9dbc094c76fadcad41a234fc6bc51b", - "sha256": "9055d0b3f83ba41e98c9105cb806e216b0d14a24f50c88489fa06e207f046f3c", - "size": 1600269, - "uuid": "dbf2dbfb-2470-40db-96c8-eab439922ceb", - "version": "2019-04-03T105548.520165Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5b3ff3f3", - "indexed": false, - "name": "primary_image-fov_000-Z1-H2-C2.tiff", - "s3_etag": "51231d0f2eaf546c0530395a18067409", - "sha1": "e111abd73a379d0adb85398ed96e8b21c7e8a023", - "sha256": "5e4028907526a099ee4b685a15a583e000c0164c14ecfcd41118b48cc3c05bc4", - "size": 1600269, - "uuid": "cbb74511-25d3-431a-83e5-96d8746b7b13", - "version": "2019-04-03T105548.859536Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "316b67c4", - "indexed": false, - "name": "primary_image-fov_000-Z1-H2-C3.tiff", - "s3_etag": "d99c136ee57c7e24b55ce51a10a849eb", - "sha1": "ee5b76ef47b16398d5ee3d4e1c3125f32ceabffc", - "sha256": "c72b7a15560b7ab0419e223ad09ded3e3f182263c0c7ae4a6596246e8960b1c0", - "size": 1600269, - "uuid": "8feb1eb5-aae7-49f3-8a50-ca08fc6cd9ae", - "version": "2019-04-03T105549.143186Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8776fda9", - "indexed": false, - "name": "primary_image-fov_000-Z10-H0-C0.tiff", - "s3_etag": "53114fb78c0083e71676e1f5df07c223", - "sha1": "5d9ca067634e35d3c6d2d9c42343551c600757cf", - "sha256": "148e60401f58fffa7ec7e17ef68b45e712114e52d1e33a79b849773f3a5cd5b3", - "size": 1600269, - "uuid": "c24714bc-d736-44b9-80f7-226178093cb0", - "version": "2019-04-03T105549.500027Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a7bafd39", - "indexed": false, - "name": "primary_image-fov_000-Z10-H0-C1.tiff", - "s3_etag": "609844220fd3b593ee0caccac529202c", - "sha1": "9a6a05000bf0851e9469c5a582d04bf716cbe7f1", - "sha256": "1abb6241a8357ff244d86c8352bd1e713ef343fbf15dec7157ac533152d92a0d", - "size": 1600269, - "uuid": "f2f917fb-0729-43a9-8b91-badc7768e23c", - "version": "2019-04-03T105549.865712Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "23d93904", - "indexed": false, - "name": "primary_image-fov_000-Z10-H0-C2.tiff", - "s3_etag": "4dd7610181826f6adf9c563c901e0fca", - "sha1": "dfc98d2e436aef7982fa4241d774aeb6b9aa0ff1", - "sha256": "499483d49cd71506c7095f30a39c64a556ce63902cdbf375b613c495de56e733", - "size": 1600269, - "uuid": "3b548656-b0e1-4fd0-8ed8-0002a5a618ba", - "version": "2019-04-03T105550.106030Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1439edf9", - "indexed": false, - "name": "primary_image-fov_000-Z10-H0-C3.tiff", - "s3_etag": "629e25a7c5a804cda8c849843844076c", - "sha1": "be5ce9eb8bd863dd596a98f4150ab661e01147d4", - "sha256": "d2d0f8b5f1ae031f26adb3a579be5cf845b0c0a0468fe0f0f71ecfb8d3db7e28", - "size": 1600269, - "uuid": "07db36b4-87d4-4fa1-8a85-b85701d5a9f8", - "version": "2019-04-03T105550.478983Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "23dfcc29", - "indexed": false, - "name": "primary_image-fov_000-Z10-H1-C0.tiff", - "s3_etag": "f4a1a90d44cff0e07b1b2d7b9aefcf8c", - "sha1": "2b3ded69a6c35ed47e325fe661482929f4dc4cb4", - "sha256": "4e13cfd76ea5e4b52c9316fbbd563e5bbd9673a708c71bbbfb45b789c6759cd0", - "size": 1600269, - "uuid": "49ada68a-c5b7-4e03-9449-3684e06db4fd", - "version": "2019-04-03T105550.739481Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b8797e65", - "indexed": false, - "name": "primary_image-fov_000-Z10-H1-C1.tiff", - "s3_etag": "98a99be632b58130697636723e4bc732", - "sha1": "638bb19206f156858aebb94110483a0dedcd79ce", - "sha256": "e6bd3d5c56ed7b408a4096a224efd0f09a861674f14991f3c1fcee26aea63d5a", - "size": 1600269, - "uuid": "dc2076bd-19ec-47c7-8ac9-6c6503386cd6", - "version": "2019-04-03T105551.111778Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "387caf6a", - "indexed": false, - "name": "primary_image-fov_000-Z10-H1-C2.tiff", - "s3_etag": "bf79470aa23df7680bc3dab20bc9fdeb", - "sha1": "30b2559ccffd430ab301d0181b7a016fa68a8b39", - "sha256": "28a08c2edb7044af26e5732fe991643c1fb97851d35ad18658b6ff75e9a9e2e7", - "size": 1600269, - "uuid": "2f5d576a-9e48-4f98-b19b-11e0bbd86615", - "version": "2019-04-03T105551.335466Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "94de8736", - "indexed": false, - "name": "primary_image-fov_000-Z10-H1-C3.tiff", - "s3_etag": "c4406f061e2d8b568d72b2d8bba598ee", - "sha1": "cfc78b40a3a786933d7e46b3808cb4fadd1b275b", - "sha256": "621cd72144807a88513d47937d763ac4b665ae144f364f4c69ed0ab6802c9985", - "size": 1600269, - "uuid": "56a4a357-0c62-4058-9362-1ae9b928a38c", - "version": "2019-04-03T105551.680479Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ef84dc08", - "indexed": false, - "name": "primary_image-fov_000-Z10-H2-C0.tiff", - "s3_etag": "4fa41de358086361a329422e9eb9c045", - "sha1": "f50094df26c7aabc9a83d46b85fa59badc5586cb", - "sha256": "e54c2e4b5a5d10ae3be6b91d08415b3fe463c3ccd9f86f7ebf9b2bf9617ffbdc", - "size": 1600269, - "uuid": "ab9c2448-9e9c-4847-ab2a-7e65333c7795", - "version": "2019-04-03T105552.080625Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f901ef1b", - "indexed": false, - "name": "primary_image-fov_000-Z10-H2-C1.tiff", - "s3_etag": "28eb33b0ea77042d1e5467e78ba4a9ee", - "sha1": "162fc33e51482e60820e4c51c5705e10c7cccaa2", - "sha256": "02324cb2dc6975d11959c1694c534654ef48aeae1086128362bd554c92bd4a25", - "size": 1600269, - "uuid": "5b961510-975a-44ee-82c4-47fb7a1ef69f", - "version": "2019-04-03T105552.339328Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a7975ec3", - "indexed": false, - "name": "primary_image-fov_000-Z10-H2-C2.tiff", - "s3_etag": "1f322edc3014aa0637924a3fcf4c7c14", - "sha1": "c7f8bd8e320ae18fc3443dd06e596d2d1468c8c4", - "sha256": "c48167caf74695965ea023cdb713253ea866d0970eb40c0fe23df266c7226917", - "size": 1600269, - "uuid": "db9d6d77-a51f-49ce-946f-21038694b549", - "version": "2019-04-03T105552.640285Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3c89e00e", - "indexed": false, - "name": "primary_image-fov_000-Z10-H2-C3.tiff", - "s3_etag": "16ca9c5b30cf10887d69732d835cef73", - "sha1": "d697fdf4b12a4e4f1f562f90b9347a3a6597d34b", - "sha256": "5a8338ac1fda0c1554f616d4501369f07f7de1d0ea4e3e17ab682e314dfcde98", - "size": 1600269, - "uuid": "5146d165-1eee-48ad-8327-174d1817dfac", - "version": "2019-04-03T105552.942022Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c5ceab43", - "indexed": false, - "name": "primary_image-fov_000-Z11-H0-C0.tiff", - "s3_etag": "6ceae755ed9aeaebb963364ec7a90d1b", - "sha1": "fa929971df1181934df9282fc6f1db41e8f79d88", - "sha256": "6dfdab9d07ef4c282a65d2e6f0f6b0b3f65993ad10100c7c4e92c1f6b5c8bc3f", - "size": 1600269, - "uuid": "78dc3350-0cb6-4731-b0fb-fa0088f7dac7", - "version": "2019-04-03T105553.200291Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2e42a5e7", - "indexed": false, - "name": "primary_image-fov_000-Z11-H0-C1.tiff", - "s3_etag": "06ed8b773024d7146d717791f414ff10", - "sha1": "e5926a496daa980fd009cf259c1d09d60ef88af8", - "sha256": "755a673f5eac78d48792f777ab04e352814e75596625a9331b9e5af7c199d7a3", - "size": 1600269, - "uuid": "213981ed-c5de-40d6-8d09-ef4354fed57a", - "version": "2019-04-03T105553.480733Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4e0d8d92", - "indexed": false, - "name": "primary_image-fov_000-Z11-H0-C2.tiff", - "s3_etag": "11563e56e169852a5c3a993b476de480", - "sha1": "7e4ab718e0abd53edaa1db559eea3a63784e6e8c", - "sha256": "840268313bf93809cf0f6d546a4d24152fe1514a472d4c2715df3904e397f835", - "size": 1600269, - "uuid": "4f19bb8b-95d6-4dfd-8c58-6bf557cf7e8e", - "version": "2019-04-03T105553.790586Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ae3e068c", - "indexed": false, - "name": "primary_image-fov_000-Z11-H0-C3.tiff", - "s3_etag": "a9a16146242832c0defa79e41ae59204", - "sha1": "d6370db80b250ed05858f6eaff1e1b4b95006cca", - "sha256": "b6500f6c5ece4770f0299a3145253b99a012eeba9c451e68e1a887b8f454c2da", - "size": 1600269, - "uuid": "b735a8fe-4d8b-43dc-856b-5376aaf8e7f2", - "version": "2019-04-03T105554.038843Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "27ad1cac", - "indexed": false, - "name": "primary_image-fov_000-Z11-H1-C0.tiff", - "s3_etag": "bfc0e583fb4ddbf764b5cbe65aab35b7", - "sha1": "5d833a37af8766382fabd4337b7e8ccbcad60815", - "sha256": "d1ec35fd392cf3d718332fa54250ecf8efd284f3120a1c8d60074e15b84f5377", - "size": 1600269, - "uuid": "6465a79b-714e-4286-835c-f510fcc744e8", - "version": "2019-04-03T105554.264803Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "73c913f4", - "indexed": false, - "name": "primary_image-fov_000-Z11-H1-C1.tiff", - "s3_etag": "bee5e534a6183e9308bdeb31977a213b", - "sha1": "49eb9d3550635011759d0f5c18ca341bf72a20b6", - "sha256": "3f952c140d5afa90976992b1a5c729b4603648bd12d19e601cdc91427d0cb49b", - "size": 1600269, - "uuid": "9a77ba3d-6773-4e07-ac91-61f0b9203183", - "version": "2019-04-03T105554.539793Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c026823a", - "indexed": false, - "name": "primary_image-fov_000-Z11-H1-C2.tiff", - "s3_etag": "89cee9ee67610a67152ecf11612fea08", - "sha1": "b5e4908efff59dcd7ad788bfaca249425f528af8", - "sha256": "ac1ffe203eb3ec5c71c7b75ed3fd052a99d8d1161f7ace904b6860ad7c82b129", - "size": 1600269, - "uuid": "fc091e1c-afc8-46e4-b9d3-68341242512a", - "version": "2019-04-03T105554.778615Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "44c7966c", - "indexed": false, - "name": "primary_image-fov_000-Z11-H1-C3.tiff", - "s3_etag": "0c1fb1c4fb4c8e371fae1aae894c0135", - "sha1": "a2a83424533f08979828792bb6fd54836a7a7b21", - "sha256": "8c06e4f22cbd47302f82585d2134b1230c4062e03215a7d83b801bbb72900e6d", - "size": 1600269, - "uuid": "e4021199-842a-489e-a65b-fc3160446904", - "version": "2019-04-03T105555.379342Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d7b7bf7a", - "indexed": false, - "name": "primary_image-fov_000-Z11-H2-C0.tiff", - "s3_etag": "d5e9649396c9c7f1f98f0672dcee3864", - "sha1": "b6ce1d39b6b2399b96af8eeb8bab755586acb152", - "sha256": "fdb06d5ef69715919d7ea4bdeeda0c7a81b838a0ef28268a87bf6abe4af8c898", - "size": 1600269, - "uuid": "1aa253f9-b137-4fd9-b65f-c307420bcfc4", - "version": "2019-04-03T105555.600718Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "88ae4d73", - "indexed": false, - "name": "primary_image-fov_000-Z11-H2-C1.tiff", - "s3_etag": "dd2287f120520149e017c264e72f3de6", - "sha1": "887e3e928d8afcdfda17e64a56f6bebef141d2e8", - "sha256": "30f20720e23acf0caff1ff1bdbe582de254d3a8ab93188a44b63d5cdd597fc28", - "size": 1600269, - "uuid": "22be2eb0-32f3-4b49-884a-e2d28c01706d", - "version": "2019-04-03T105555.855632Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4ae105be", - "indexed": false, - "name": "primary_image-fov_000-Z11-H2-C2.tiff", - "s3_etag": "72c1259fa055687565fc81b8cfa196e5", - "sha1": "342a81768acd7d32ba4b7f92f3ca11e7f17e0691", - "sha256": "8c1bb26f1be6c9196ef0e074a968bfee34806079e57474577fd3ba8947a07173", - "size": 1600269, - "uuid": "c99e944a-475c-4df4-9e6d-9ea50057cfb6", - "version": "2019-04-03T105556.233992Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ac587eaa", - "indexed": false, - "name": "primary_image-fov_000-Z11-H2-C3.tiff", - "s3_etag": "18fe5ebd9f1da1734d7e233b29b4f39e", - "sha1": "1db0756bba2080c9e1a91bbb6abc7b7fda196869", - "sha256": "30b35d9ebce19e936ca156ccc1669700a28819a57082b28b9390e863c21b9f6f", - "size": 1600269, - "uuid": "2a5f4fda-058f-4478-94dc-c12130be8969", - "version": "2019-04-03T105556.579317Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d02a9c3c", - "indexed": false, - "name": "primary_image-fov_000-Z12-H0-C0.tiff", - "s3_etag": "887f41fc2ff12774fef02765785202d1", - "sha1": "490d14a6d94736b991639b06b5a5690e68f03488", - "sha256": "616f5e816d18b75695af9ae3ca6bf250730ebaf7de10b43be96cdbb96d9c54c6", - "size": 1600269, - "uuid": "cca66a40-ea4e-4d2e-a9a5-084a9dd6241a", - "version": "2019-04-03T105556.968010Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "9b9bae44", - "indexed": false, - "name": "primary_image-fov_000-Z12-H0-C1.tiff", - "s3_etag": "b4adeb99c5cc807251a7c41114cb2ffe", - "sha1": "d804db3cc63cd09b7ede0a4706b4abd2b2d633e5", - "sha256": "add26fb8561728ddcc1da5b8019bf30c34a1a4724680eb8f4f297867123b6054", - "size": 1600269, - "uuid": "ab43f67c-1352-4344-9ab2-164ec39d5b23", - "version": "2019-04-03T105557.260494Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1aecea4a", - "indexed": false, - "name": "primary_image-fov_000-Z12-H0-C2.tiff", - "s3_etag": "789c4f2bf1ef3b375f0804110a733d7a", - "sha1": "749897eaf2fc13f1a61b2277d91173c3ac04bc18", - "sha256": "400a32e254cc7e8ff63c0f7ecbb06f46046180447674d1192404dab8d37a1202", - "size": 1600269, - "uuid": "78046a68-90a9-4761-85fe-bb8f1059a75e", - "version": "2019-04-03T105557.518156Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3b5afbfa", - "indexed": false, - "name": "primary_image-fov_000-Z12-H0-C3.tiff", - "s3_etag": "5a4deb28c50b741404bdbf9b482731b6", - "sha1": "d13f3bbade8b67796a019f3163b697a4de1f9f6f", - "sha256": "7bfd376a2be4d88c67c8d175c52423ea1391402a062b7a0392b0dc2dbfccfdb6", - "size": 1600269, - "uuid": "fbb1d9de-baca-44fd-82b4-1b5f9b76e126", - "version": "2019-04-03T105557.760815Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "16ce63ca", - "indexed": false, - "name": "primary_image-fov_000-Z12-H1-C0.tiff", - "s3_etag": "f4f92e4d0fe49222df6715b1eacfc860", - "sha1": "89495f8ee49f756930b7f9699716d720eff0250e", - "sha256": "2202bb6788f971004969c17f5d5013579ac627048d6bd25ad7c63e671e3687f2", - "size": 1600269, - "uuid": "d33aac64-f261-46d0-8712-543ccdc219c0", - "version": "2019-04-03T105558.079130Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8ee8eacd", - "indexed": false, - "name": "primary_image-fov_000-Z12-H1-C1.tiff", - "s3_etag": "b3986a3a15c69644873dd204270a63d2", - "sha1": "384ee670a45003c385d732abb08ffe4b5054b2b3", - "sha256": "3e99efc1c84bdf4f3022a35b02d6a310924388f5a64d245322abbb39179bac14", - "size": 1600269, - "uuid": "ea165ff1-76d8-4fc4-b5b1-46e13a92d61a", - "version": "2019-04-03T105558.419178Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b653f9f2", - "indexed": false, - "name": "primary_image-fov_000-Z12-H1-C2.tiff", - "s3_etag": "d9d98464887e0fd0e375a7ce2035fde6", - "sha1": "2f9ed661847addb7a1e508f7a64551d56e71055b", - "sha256": "91d3a98042a86c79996b0cf5713812607de53519f3b9c7227fcb5667fba95831", - "size": 1600269, - "uuid": "fbfd8b5e-6818-4204-8a1d-af17f654c63e", - "version": "2019-04-03T105558.880203Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5d2ad397", - "indexed": false, - "name": "primary_image-fov_000-Z12-H1-C3.tiff", - "s3_etag": "ead473980cdf361a40efde6487b5812e", - "sha1": "ee103d84ace151c7dfe68e579546b4445ecd0c89", - "sha256": "9ac81cb46bb7244b76dbec83afa406653bc80e5f50e8cec14bcf52da96f53a46", - "size": 1600269, - "uuid": "88045284-69d1-49a5-951a-ce861ed0dbee", - "version": "2019-04-03T105559.179305Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1b57836e", - "indexed": false, - "name": "primary_image-fov_000-Z12-H2-C0.tiff", - "s3_etag": "dc98cbd9f2ed861f4839edee92c741ac", - "sha1": "ee94e5cf8c841bba7be2a55582d83bf336b25b2e", - "sha256": "b0559f19893372f5d1e2eb022c8de33afab9460c5bfdc3fa43a1d132a553080c", - "size": 1600269, - "uuid": "29982631-185e-43c5-ae8c-daeba6e26c2b", - "version": "2019-04-03T105559.659913Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ab93140f", - "indexed": false, - "name": "primary_image-fov_000-Z12-H2-C1.tiff", - "s3_etag": "27f70fe14e7e3b07edd0dbf20bc14d9e", - "sha1": "ea798bb2f189c427a46b4d80219fc6d16e7e2818", - "sha256": "d18bcb7369e1a4c3fba02e006c593aeb12d3baf16115db0d5324404ee403db77", - "size": 1600269, - "uuid": "083944c0-37af-4c9c-80e1-2c101b95acc3", - "version": "2019-04-03T105559.998865Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "402e893b", - "indexed": false, - "name": "primary_image-fov_000-Z12-H2-C2.tiff", - "s3_etag": "05a62cd5712c3eeba56bfe96f267bb9a", - "sha1": "497da012af65c6fcaf0be9986227d77d45b94e80", - "sha256": "f19fd7d959fb5c7a48fe8cd776a0e4d7706bde6f11d8fec837ced211b64eca29", - "size": 1600269, - "uuid": "40cbb7e6-b5f1-48ad-825a-5159197c6803", - "version": "2019-04-03T105600.308174Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f843bf4e", - "indexed": false, - "name": "primary_image-fov_000-Z12-H2-C3.tiff", - "s3_etag": "a3ced1c2e181c3ae3b6c0175d034d4f5", - "sha1": "ac3087f9eb2e5a42b61bef858f5ff15cf7bdc36f", - "sha256": "88bd33e3488dffad8404a0dc27afaef8dbe5bada2d88ad5a59ddf43c3e8c0597", - "size": 1600269, - "uuid": "ebe33ee1-8e0b-4412-abb1-b26c5ead07e1", - "version": "2019-04-03T105600.586805Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "052f06bf", - "indexed": false, - "name": "primary_image-fov_000-Z13-H0-C0.tiff", - "s3_etag": "bcc9167532fe6d4332a6042181df7d1a", - "sha1": "d66ea4b0cb0b34be2de8e9e5a12926f49145dff3", - "sha256": "2b078043f0c405d3cb989c43456e5b7ac835f416bb620ea3c85e16c8962b3433", - "size": 1600269, - "uuid": "a94e0444-861c-418a-a338-16ed56e9b430", - "version": "2019-04-03T105600.867025Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d6ebd4ee", - "indexed": false, - "name": "primary_image-fov_000-Z13-H0-C1.tiff", - "s3_etag": "34c1ff12c674255cd44d44d5e7201890", - "sha1": "190094d40dfa2f357d761866860d24d687a8158d", - "sha256": "871f6921cdd3d12ec7b1670a59eb2c8e123a376e391e59f434efce751661da40", - "size": 1600269, - "uuid": "2e39b6d1-7755-4265-a044-f74cac9943a1", - "version": "2019-04-03T105601.179469Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "584d986e", - "indexed": false, - "name": "primary_image-fov_000-Z13-H0-C2.tiff", - "s3_etag": "2dfbbfab11c2528ce2f4beafdfdbe1be", - "sha1": "6403da61835d4362a70a2e5dfbd112984cd22d81", - "sha256": "dd7b8ec3c8a18855a787d282efaffe9b9c5927d29046b194bb405586fc0f4a6b", - "size": 1600269, - "uuid": "fcab0b60-14e5-441a-b5ab-492576785bfb", - "version": "2019-04-03T105601.420192Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a9ee4bc6", - "indexed": false, - "name": "primary_image-fov_000-Z13-H0-C3.tiff", - "s3_etag": "b36579dc19eb793dab6d74b099b3c094", - "sha1": "bdf15acace826820eb39fab732fc21b1c9b71ba5", - "sha256": "7c822e36225c6ae1ae17eeae2c3d8d036386e57b7c4a096e2f5412af9441a227", - "size": 1600269, - "uuid": "45caa165-0ccb-424e-a454-da6ee8c3debb", - "version": "2019-04-03T105601.721498Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6ff498a1", - "indexed": false, - "name": "primary_image-fov_000-Z13-H1-C0.tiff", - "s3_etag": "263ae72ab8c5b07cdb67115ead4b0581", - "sha1": "0b1851977e68f57322a9b9b610e28ad2a9ca59c2", - "sha256": "e2160976c70adaa0cbbe30ad556550978fb8e179c5c2c01d43e51eaf392fd8ec", - "size": 1600269, - "uuid": "cd27dad7-cd62-442b-ac93-1a492df1045e", - "version": "2019-04-03T105602.039781Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d3808e49", - "indexed": false, - "name": "primary_image-fov_000-Z13-H1-C1.tiff", - "s3_etag": "9825ecfc61e68ca25e40bef25e59ccfa", - "sha1": "ff0a443f513db573f55cc98e5ee1a37296bfae97", - "sha256": "bef348b002b6d232a391fb0d3f9c31506dbb24eaca6a82ea255e8e362affc71a", - "size": 1600269, - "uuid": "60dd0c9f-00a5-4d05-9e03-d3d9ed094144", - "version": "2019-04-03T105602.303691Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "559258c8", - "indexed": false, - "name": "primary_image-fov_000-Z13-H1-C2.tiff", - "s3_etag": "f36dfa34f3494ced8619bcf41f50b609", - "sha1": "8b42c0a67ebb80242e695de36af2704240a43541", - "sha256": "d122a74a78ee74b8ec52ad8c0e8c91a0da215f9ccaa8997d97ac19312792f3ec", - "size": 1600269, - "uuid": "c6feee87-37de-465d-b860-b9bd70da69c9", - "version": "2019-04-03T105602.620006Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7da89022", - "indexed": false, - "name": "primary_image-fov_000-Z13-H1-C3.tiff", - "s3_etag": "b8911343150f670d61645fc8a8d33ae5", - "sha1": "5bd3d9288289f0c69a6d4f56d3361d3743b423f2", - "sha256": "2170b2d5225a5c06b8e6a0d4c7baf98fedc829c55cf39384836319dde5cfd27b", - "size": 1600269, - "uuid": "bf2d918b-0a45-4f42-83b5-e38dd2c77084", - "version": "2019-04-03T105602.924316Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7855861f", - "indexed": false, - "name": "primary_image-fov_000-Z13-H2-C0.tiff", - "s3_etag": "adee3752465a14bac55600bb2ba15d49", - "sha1": "6ec29fd007cae668ee61a9fb88415817247f59c5", - "sha256": "8c8299f5933f6546bbca375bdd0258ccf642bae8cbed6cbad569037a21477389", - "size": 1600269, - "uuid": "31896233-7b29-42a4-94b0-208095c99f5f", - "version": "2019-04-03T105603.161708Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "aa188246", - "indexed": false, - "name": "primary_image-fov_000-Z13-H2-C1.tiff", - "s3_etag": "8a7c1094a104a9a7cc40ed6178fcb752", - "sha1": "0035dc38e3f4276b3442a308d0d7418a6eb24614", - "sha256": "cf7f002f384c6f5491b164dd7a571d9c768be9bf3e019401015b6dc69b957696", - "size": 1600269, - "uuid": "55001751-e224-4825-87c4-bd786345faef", - "version": "2019-04-03T105603.421325Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d735689c", - "indexed": false, - "name": "primary_image-fov_000-Z13-H2-C2.tiff", - "s3_etag": "6312ba6081f851b6a62ecd624764cad3", - "sha1": "53f3a2a46803321bfa6b0271c887130a4d87a94d", - "sha256": "4de7ef1850de8d30f292f26d5df973c15a37d0f09fcec7e36206c1380e74abcb", - "size": 1600269, - "uuid": "9e4aa7a1-045c-448d-9506-9f180646f31e", - "version": "2019-04-03T105603.652981Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3ede4f1c", - "indexed": false, - "name": "primary_image-fov_000-Z13-H2-C3.tiff", - "s3_etag": "c6cd4cc027b68101cdebd5cd9c8b4a67", - "sha1": "745fd35a8b5509b852148f57dbd9a4dbb4bd355a", - "sha256": "42173d6b156f00f205f92f20f694b7392ce3d7619033122df8388e1a45acdc73", - "size": 1600269, - "uuid": "54ddc5aa-4b48-48e5-a955-2f969478eb8d", - "version": "2019-04-03T105603.939697Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2567a82f", - "indexed": false, - "name": "primary_image-fov_000-Z14-H0-C0.tiff", - "s3_etag": "23d4e877ecb39a2bb4b4323ee3560bd9", - "sha1": "076ae34880e7546836d365851668aae082501850", - "sha256": "2c9e806302eecfe1fa003b8ed15beeed08d6cb6e93b2552c30c7d48a8253386b", - "size": 1600269, - "uuid": "9ab3b14e-52eb-45fe-8473-b166185732fa", - "version": "2019-04-03T105604.189833Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d89a7999", - "indexed": false, - "name": "primary_image-fov_000-Z14-H0-C1.tiff", - "s3_etag": "733724cfb40992f157c06a21429ce63b", - "sha1": "f81644e79659aa85009d30b5747126a4a4c3bf52", - "sha256": "c5554bc09b3722f4b63a015ccd5f952778d60b0e5c5b11e8e6850028cd41f4e6", - "size": 1600269, - "uuid": "e877a847-80aa-4d68-a069-6da3015bb19e", - "version": "2019-04-03T105604.480375Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6a6f2b31", - "indexed": false, - "name": "primary_image-fov_000-Z14-H0-C2.tiff", - "s3_etag": "caf29bdd34d04d56efa7ffe4e69bdf15", - "sha1": "178b19662651333bcd83ee5c979c5fb21a24ee3a", - "sha256": "8c77ea0a4a7e17738c3f1148a63b37d068acc1ffc8fc2d5c9e9f0dbcf88d02ce", - "size": 1600269, - "uuid": "f30fb34c-ea78-4c55-8342-666e028b1ec7", - "version": "2019-04-03T105604.725431Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8e7e28ba", - "indexed": false, - "name": "primary_image-fov_000-Z14-H0-C3.tiff", - "s3_etag": "50d4a2b1c64d9a6091118b0f3ba69082", - "sha1": "904cedf9d6d62d129da6d3a1d30fd7c74e21bdfe", - "sha256": "a6d97e21fea1d3cc28be720bccb70f9f2a0e3fca6ffbce383ade7612ed90ea13", - "size": 1600269, - "uuid": "a800e1a6-58b9-48ea-b33b-b2c58627e5f0", - "version": "2019-04-03T105605.006005Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f31ac427", - "indexed": false, - "name": "primary_image-fov_000-Z14-H1-C0.tiff", - "s3_etag": "8ffb788e265f2f239b5b23fa695e1119", - "sha1": "087a91c220f450a4baee76b805e81170384a1e63", - "sha256": "2f3af86421a5d9ec2101ff3943a8157d3ca2b257d04676bec5a1608241b9e93b", - "size": 1600269, - "uuid": "4971ef5d-cd50-48e1-a7f3-91e1ebf27dda", - "version": "2019-04-03T105605.420646Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "71e66e31", - "indexed": false, - "name": "primary_image-fov_000-Z14-H1-C1.tiff", - "s3_etag": "8c328a7008b42a8ca4dd7cea274cb679", - "sha1": "7da5e8987204a4abb4329c45a04e79eb5181006d", - "sha256": "c87288170e297bcacb92a8b685251eb3b8b5f61cd14cbf569ba7473e33bf289d", - "size": 1600269, - "uuid": "0fe0425a-1371-42d6-a6d2-36962c8a22f7", - "version": "2019-04-03T105605.641366Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "bb067245", - "indexed": false, - "name": "primary_image-fov_000-Z14-H1-C2.tiff", - "s3_etag": "072dfe78e868a7886774cb3aa04a0a7f", - "sha1": "04486bf2cabb0f3ce29603ce8605d0bbb5b36aa8", - "sha256": "9a1b23dff11928fe74e4779a3e9865b9cb732683a0bee85da64e5afb38959383", - "size": 1600269, - "uuid": "25ff77de-95eb-4737-9ba2-fff2969eca73", - "version": "2019-04-03T105605.904789Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "69c233e3", - "indexed": false, - "name": "primary_image-fov_000-Z14-H1-C3.tiff", - "s3_etag": "ab66d0e958e7ae0cd9f7de7b21edd2ee", - "sha1": "149743809ed468c9878334e4deabf25b5f0de6ff", - "sha256": "3afe34c5645c4c6ed4e8fd71882f8e84d62544eea7b926de3eddc31a81084854", - "size": 1600269, - "uuid": "f1bdabbf-13ed-483c-8492-a6c9c2f65db6", - "version": "2019-04-03T105606.322160Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f98fd263", - "indexed": false, - "name": "primary_image-fov_000-Z14-H2-C0.tiff", - "s3_etag": "1a39d83cd8e12cc23e42c24f6668dc33", - "sha1": "eaf2b358ed990a93bae6c6c2bcb9a462673901a4", - "sha256": "304439ad4583424ef116b6ac98a44c1d43a7622472b2a3a89677b54392acb577", - "size": 1600269, - "uuid": "5b57e6a7-e098-4605-b00a-d58652698580", - "version": "2019-04-03T105606.659307Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "9db56d08", - "indexed": false, - "name": "primary_image-fov_000-Z14-H2-C1.tiff", - "s3_etag": "dda12be46aeb27da4da7ecf1cbb44dd5", - "sha1": "9e1e7ad1c9c013feba08c3ed48c29e3b81f4469a", - "sha256": "9158ddf94cd4395252a02c2f61a4e2f3b179593839a2c22a2c89066dc053e5de", - "size": 1600269, - "uuid": "5cadfa19-ed60-4ba2-b04c-c23b6c0495f7", - "version": "2019-04-03T105607.139632Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7a76cc49", - "indexed": false, - "name": "primary_image-fov_000-Z14-H2-C2.tiff", - "s3_etag": "424a333527ec9d3651d09f2ae01ca8bb", - "sha1": "ab8ab11f26ccdeb60dbda96f689ff38939ef585e", - "sha256": "e49b7f981478d3e32fe3ffde7a952a2361d22a6df1cc55b8f6d364646149d425", - "size": 1600269, - "uuid": "f2fe8c9e-6ed6-4999-a98b-4fecf57da55a", - "version": "2019-04-03T105607.380785Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1ad0ed69", - "indexed": false, - "name": "primary_image-fov_000-Z14-H2-C3.tiff", - "s3_etag": "91f0b66a436c7f9a78827c3a3ccac38d", - "sha1": "49f4f1cc2731e44d68b362d30535d674a02b9e1c", - "sha256": "24612939c544d89c59e974d0283cafae98528f56a9e52d5761f70e7b8757a5fa", - "size": 1600269, - "uuid": "b8ab79bd-28c8-448b-9847-f8f10d3ccc45", - "version": "2019-04-03T105607.648634Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "0b2929e7", - "indexed": false, - "name": "primary_image-fov_000-Z15-H0-C0.tiff", - "s3_etag": "2f41176517472845c1720f78d268af09", - "sha1": "8c432af92536a457fbacd9f78a8c8591d6c116ca", - "sha256": "67b14eeac471ed074ca1063bbe78845143390c42914e8908ea4ef7341b10fb13", - "size": 1600269, - "uuid": "dcc63bdc-2c05-488c-98ce-905b6b1fcfe4", - "version": "2019-04-03T105607.955180Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "004524d0", - "indexed": false, - "name": "primary_image-fov_000-Z15-H0-C1.tiff", - "s3_etag": "9d4f239273a8134f9a0f3496f3fa931e", - "sha1": "5512afc374fe1b4acd0d7bfd009d33885bf820cd", - "sha256": "7652e6b69da6660427c7a985344ed04eef6970f43ad69af6e52bd92d90cceec0", - "size": 1600269, - "uuid": "f3926330-cfa4-4f64-b12c-3e50e06a7153", - "version": "2019-04-03T105608.221439Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1d122a71", - "indexed": false, - "name": "primary_image-fov_000-Z15-H0-C2.tiff", - "s3_etag": "aeb11c110398d407c6c2a4266d8c3349", - "sha1": "84198102a0a6dc4cf9b96da68ea81ef165ff8df6", - "sha256": "0551b9abc860383650a0fc551ee22f876d3041924377eeb5ec079917718fa75d", - "size": 1600269, - "uuid": "b134deb9-6a03-486f-a603-955348d1cb67", - "version": "2019-04-03T105608.540867Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ced5e43d", - "indexed": false, - "name": "primary_image-fov_000-Z15-H0-C3.tiff", - "s3_etag": "93e4975a342f3f4bd9e540e466807eba", - "sha1": "f488f82f0865e633c467aa3d807d3bf3b785a36c", - "sha256": "0d40beb93999b640ac48a7aff74214eb0e17fd80e40303be16f0d04f232dfaef", - "size": 1600269, - "uuid": "b9aef9b6-f326-4d1a-b912-41030791bc78", - "version": "2019-04-03T105608.782580Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "9621a4da", - "indexed": false, - "name": "primary_image-fov_000-Z15-H1-C0.tiff", - "s3_etag": "2e7af9b5ba0712fa9823898c582b1171", - "sha1": "592bc4308878410f03ada6e6c8ea5a7d39ff87cc", - "sha256": "42ed249546e37d66f631498a848e02d183fa919bc242d810333ac5b2ca94e7e8", - "size": 1600269, - "uuid": "e9f28e2b-b63c-4819-8385-18062c5411aa", - "version": "2019-04-03T105609.057230Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4f9f2476", - "indexed": false, - "name": "primary_image-fov_000-Z15-H1-C1.tiff", - "s3_etag": "caa6bab888b91f870d1dfc5eb758f541", - "sha1": "7304181ad037514a180bf43a1a79254c86301b42", - "sha256": "4c9493782169ea02a632b1d911b9b026c680569c1d87cada888458f025962129", - "size": 1600269, - "uuid": "a7309326-5690-413e-8b73-1f33f8897dab", - "version": "2019-04-03T105609.289499Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "570dd01a", - "indexed": false, - "name": "primary_image-fov_000-Z15-H1-C2.tiff", - "s3_etag": "626956c92c5187481a0c0276c7839812", - "sha1": "33752130b76286f50bcc5873000dd9613faaa16c", - "sha256": "dcdc7393bfb9721c8bb3062e1ddbfb6e5f6ea1108ebdca1afca0a797d05697c7", - "size": 1600269, - "uuid": "6bd9329f-5602-4c75-92c8-84882ba69685", - "version": "2019-04-03T105609.542553Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "84defed1", - "indexed": false, - "name": "primary_image-fov_000-Z15-H1-C3.tiff", - "s3_etag": "51ad1fb9bcded0393d1a2995c5861df3", - "sha1": "2ea4671d25ab754b32c564caa28ab7823d8d6ad2", - "sha256": "6b311490b4b187aa705716c5facca6e74d2248638d95af9be1b8fff6d0afccb4", - "size": 1600269, - "uuid": "0c9f682a-a5dd-45ed-bcaa-be4e5342771c", - "version": "2019-04-03T105609.824711Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d96c5e2a", - "indexed": false, - "name": "primary_image-fov_000-Z15-H2-C0.tiff", - "s3_etag": "92545335007f347406aacdbf892ebfdd", - "sha1": "86094e1e453f5831cf76f320aa3975ed986e8f86", - "sha256": "2bd656d393d3d3337ed6258b1e5e61f799370f6a5958a9fc5f816f1407adca4f", - "size": 1600269, - "uuid": "36063754-9a8a-4815-9783-1508974a6ca3", - "version": "2019-04-03T105610.096845Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1b71539b", - "indexed": false, - "name": "primary_image-fov_000-Z15-H2-C1.tiff", - "s3_etag": "027dfa4d7f544005e04f75be47ae1cdb", - "sha1": "9eedcc5e6e5bab401388effd57769e35ba897ee6", - "sha256": "8597d134ccea0e906080b36f8717c8be936bf90b682434d23c9eca0649bea27f", - "size": 1600269, - "uuid": "a601ed00-aadd-4ac3-95ef-25fc052c37db", - "version": "2019-04-03T105610.401438Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b7fd53a2", - "indexed": false, - "name": "primary_image-fov_000-Z15-H2-C2.tiff", - "s3_etag": "bf901bf83745da9c9c53c26e8852938d", - "sha1": "45a4b73120e37579508e9e6a9719e5944bbe0c78", - "sha256": "da60f26d4165e3fa29819338ce470d2101c02df2657b8b1272fd56be0919c280", - "size": 1600269, - "uuid": "e9da4b39-a542-4f3a-85af-c9da97172715", - "version": "2019-04-03T105610.683603Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7944dc17", - "indexed": false, - "name": "primary_image-fov_000-Z15-H2-C3.tiff", - "s3_etag": "ffd7b80c10d1e2654181a38485f457a8", - "sha1": "6708d5c43e6742546aca16c0ba9cd5585b72e56b", - "sha256": "b80a54f1e3efafb5aa6de7d3f0d6e309dc3973c957c91245e790cc36c08482b9", - "size": 1600269, - "uuid": "215ebd60-69d7-4509-8575-301f28d841b0", - "version": "2019-04-03T105611.022078Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6af55e11", - "indexed": false, - "name": "primary_image-fov_000-Z16-H0-C0.tiff", - "s3_etag": "a88aa7b3a586d4d26b8be621167c5b94", - "sha1": "66da568c0925617e3b3c6825fd6a541fdeea6f7e", - "sha256": "516ccfdda5551806152d5f3de11fc1f14ec21ca2b5452dc53e98416f5f47daea", - "size": 1600269, - "uuid": "47c1ab01-7bb9-4cc6-949e-aff889b78bc4", - "version": "2019-04-03T105611.559338Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "89ab529c", - "indexed": false, - "name": "primary_image-fov_000-Z16-H0-C1.tiff", - "s3_etag": "46fc4422fe7b8dc81ff4e5c614263b1f", - "sha1": "aad78416ba051f4e2d6b406292b8d7e0265e89e9", - "sha256": "68c9dfe824f02f572aa39d5dfc16d5cc92a0664ce4ec7fce21b513a5d5120400", - "size": 1600269, - "uuid": "bbaf020d-e851-4259-8784-832fc85b6c83", - "version": "2019-04-03T105611.801366Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "771e1a24", - "indexed": false, - "name": "primary_image-fov_000-Z16-H0-C2.tiff", - "s3_etag": "9fada1d9ff3394e4b113f8ad2bdba081", - "sha1": "6e43f11f0a5ca2f28378d8770e9af3d356fd644d", - "sha256": "1494d456f4a227f28525a90eaa34a68e76b852aee12b8e010331f6908dc73904", - "size": 1600269, - "uuid": "6c0ffe0f-19a5-4ed9-92e1-316f3d8cc1f9", - "version": "2019-04-03T105612.278469Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "77615d8f", - "indexed": false, - "name": "primary_image-fov_000-Z16-H0-C3.tiff", - "s3_etag": "40fc5c6cea15336a43a4dc4711a4ae00", - "sha1": "da32bedc5eeb2ce47908ded5a770610cc07f8c30", - "sha256": "33a6cd371f88a33bf0f1daa0345e47f414af1636f420e4fb1a1edcdd6687563b", - "size": 1600269, - "uuid": "60edf99d-ab78-4bab-b3de-801fabbb7116", - "version": "2019-04-03T105612.622653Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "735764c8", - "indexed": false, - "name": "primary_image-fov_000-Z16-H1-C0.tiff", - "s3_etag": "fdc28a410e4b61d3264243827629e74d", - "sha1": "75cd7a485c26b1559eb0ead8f71e3892037b9f38", - "sha256": "061cb156a427a7277fe5bfdada22068981a75546e1cb8cda89b6259a359e4c8a", - "size": 1600269, - "uuid": "bbb92406-a0df-4de1-97fa-fa10457198d8", - "version": "2019-04-03T105612.859568Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4043af28", - "indexed": false, - "name": "primary_image-fov_000-Z16-H1-C1.tiff", - "s3_etag": "a587f1d6e7b711ed13cec30e69c0c1b2", - "sha1": "37ae6779436a6a258606562697fa6d7ddfe44fc6", - "sha256": "bd0be59413d859115ff7f265726c32a303dacdd3660f5f70eecd9a9511db0ec1", - "size": 1600269, - "uuid": "0d38ed8b-ccdd-4a32-9be3-bfa62f535c5c", - "version": "2019-04-03T105613.080125Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a88f3cf2", - "indexed": false, - "name": "primary_image-fov_000-Z16-H1-C2.tiff", - "s3_etag": "b4e387ce74fcb5a511fd92cdfef07e13", - "sha1": "fee047cab4461e58350bc44a07aab0c5a067784a", - "sha256": "7c9e194ae38ba112afb630d03d686135c13cedbd0dca0a6a287b91a82af1ad9e", - "size": 1600269, - "uuid": "0bdded17-864c-4c7a-a499-24a4267b4dc8", - "version": "2019-04-03T105613.344358Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "261d6caf", - "indexed": false, - "name": "primary_image-fov_000-Z16-H1-C3.tiff", - "s3_etag": "fcee02cab9e177c39658cd9313183445", - "sha1": "f888e61fba8808efe439bda90dd47a06009a35a8", - "sha256": "f7833d340e6ba0fcfa3082241e16e54444576db840d73a911a2d40c62e6c7c42", - "size": 1600269, - "uuid": "e61824cb-b2e3-4131-a93c-0f809407e12a", - "version": "2019-04-03T105613.584363Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ffeec2e6", - "indexed": false, - "name": "primary_image-fov_000-Z16-H2-C0.tiff", - "s3_etag": "9961c3c49217e32c5ede426cf5171155", - "sha1": "2fc56166144927399d9e3e5d39c873e242580388", - "sha256": "341648c0b44a819c34a6c27d213e5d252d5edcef5e88d842f817832b09bfbcba", - "size": 1600269, - "uuid": "1cab431e-680b-491e-9f8a-9503230a602c", - "version": "2019-04-03T105613.859236Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b0e8ea39", - "indexed": false, - "name": "primary_image-fov_000-Z16-H2-C1.tiff", - "s3_etag": "0102cca9defd31c65585f717a10d5bda", - "sha1": "d5c57eff3c4be5edd22e442408c8231393bed2c8", - "sha256": "1360f3f3c583137c692923cc6b1fb416575482e6e248196a6bb1fecd5e27cd97", - "size": 1600269, - "uuid": "c8f06cec-ac9f-4241-8f0d-86daecbda3af", - "version": "2019-04-03T105614.120757Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2d57a1e1", - "indexed": false, - "name": "primary_image-fov_000-Z16-H2-C2.tiff", - "s3_etag": "c17ba6739bc7684046bfe0bb9ae5b549", - "sha1": "a0100b495ba6b92a6140a9483abe9e396dd79089", - "sha256": "144d25544bf2995a01f834cfe7e71f696d1cec67ff4ff355216189c25696301f", - "size": 1600269, - "uuid": "0fb666f0-0331-4532-8ed6-9ee27b383f96", - "version": "2019-04-03T105614.469912Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4c624098", - "indexed": false, - "name": "primary_image-fov_000-Z16-H2-C3.tiff", - "s3_etag": "d99948dce1012b3533fc8d8807372c4f", - "sha1": "eb2b7fc4b7c3c5e39fc623add18d5755173355a7", - "sha256": "9c4ffe1988df43cf7718d61790392096a85d294aabf389c177a3caf31df8e8a0", - "size": 1600269, - "uuid": "ebcf808e-8039-4d0f-9c6a-82ddf9bd6dc0", - "version": "2019-04-03T105614.720103Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1b85888c", - "indexed": false, - "name": "primary_image-fov_000-Z2-H0-C0.tiff", - "s3_etag": "8c3c48e91e7ae78c3ab1c7c64e764aa2", - "sha1": "d617c969390d82f651fe9fa0243ccf3ffe0c6686", - "sha256": "e4eb56824253d3871a1255644aacbc8a00214b68d774463d87a0a4913f61ac25", - "size": 1600269, - "uuid": "ae06e940-6a8d-44a1-9e5f-de404f802e0d", - "version": "2019-04-03T105614.967111Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "52c76c82", - "indexed": false, - "name": "primary_image-fov_000-Z2-H0-C1.tiff", - "s3_etag": "78532080864bd984fd9893f40046b488", - "sha1": "677b6148a4420ee93322f9d716b55e5a6df96450", - "sha256": "cd54522df1f749716b726df51c45563c3d7be47d9bcce9b5ac97576062e9f720", - "size": 1600269, - "uuid": "a3001444-768b-45bd-82f8-ffd492f8a9ff", - "version": "2019-04-03T105615.221216Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "49c661d3", - "indexed": false, - "name": "primary_image-fov_000-Z2-H0-C2.tiff", - "s3_etag": "85a90e2603bf8881499014d78c07a9c1", - "sha1": "72c98cb505fd875344a522431e5132e0e00e3f8a", - "sha256": "f280463e13ed0c1804280dfe839aeafc31978f5aa22fef71f998c05fa3981e1a", - "size": 1600269, - "uuid": "fcf35fc4-c4da-4643-9b4c-46ae410160ea", - "version": "2019-04-03T105615.545209Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c52334cd", - "indexed": false, - "name": "primary_image-fov_000-Z2-H0-C3.tiff", - "s3_etag": "c70b5e8025a12c00f90d64da288e0666", - "sha1": "f36222db39a0600e497c8547c40e057d69cce655", - "sha256": "1bf0530559802b92677858e96a43be30c77ba94dd170630b3bb2702b740eb5e2", - "size": 1600269, - "uuid": "a454ef32-a818-48bb-8986-59c91a3582d6", - "version": "2019-04-03T105615.780166Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "83b7b009", - "indexed": false, - "name": "primary_image-fov_000-Z2-H1-C0.tiff", - "s3_etag": "1477e3cfd21e5661b4f38c0002d622f3", - "sha1": "63188f3bcfe791d5e7ac797662c764857bbfb7a5", - "sha256": "04733ed9c6df06e23b249b23f985e61c66927e8be780f691e87f23b5cb01ad66", - "size": 1600269, - "uuid": "514c1928-88b2-4ee4-9a36-6df3a1ea6ad6", - "version": "2019-04-03T105616.144108Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a90594d4", - "indexed": false, - "name": "primary_image-fov_000-Z2-H1-C1.tiff", - "s3_etag": "cc4644e2e6ceeafae8135a4d6f9a8d0a", - "sha1": "2326bc68eee158ed0a04d6d985c18a75d18ad15a", - "sha256": "7300a8d3a2a5b2e2104979e3740320ee9595bba2483ef225e6d35134d1284d9f", - "size": 1600269, - "uuid": "7334d870-d87a-42c5-a56d-cad22755b2c4", - "version": "2019-04-03T105616.706622Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7f7b23b1", - "indexed": false, - "name": "primary_image-fov_000-Z2-H1-C2.tiff", - "s3_etag": "1dbebf9b99808edfb51ae30baff92a4a", - "sha1": "6117c5ba6b63412656028968a4a840bc68d0573d", - "sha256": "188f587144c32af04e345736189d8fe2ff0d937fcad34cd4245ab39df87f07d3", - "size": 1600269, - "uuid": "8f9a873c-db55-46f0-ac21-2675647a2553", - "version": "2019-04-03T105616.941310Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "548dcdb6", - "indexed": false, - "name": "primary_image-fov_000-Z2-H1-C3.tiff", - "s3_etag": "769b4c4c76ffb3bce4b616db20d034d5", - "sha1": "a08d40f28616ef6ae142b4c37b4d84c591efe435", - "sha256": "1fd2a0467af9e35362571370a84a6b64815813f78b265c2dd52f5def6d096f3d", - "size": 1600269, - "uuid": "6d2fd5c1-91d8-42b4-9958-41b9b7be2ee5", - "version": "2019-04-03T105617.319136Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "29d61c42", - "indexed": false, - "name": "primary_image-fov_000-Z2-H2-C0.tiff", - "s3_etag": "57c05571d8b8821b13e556be93da0d84", - "sha1": "fc0fff1511e1e4d84669d57033b6ffc39ed4405f", - "sha256": "b650b9e0da3106417bae5b48d9eb37eac1fce1448ec94f5c71be1ac7062fda2f", - "size": 1600269, - "uuid": "909dd3ed-d856-4a87-aa6a-7f5e0d390d2f", - "version": "2019-04-03T105617.543209Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f72a81a6", - "indexed": false, - "name": "primary_image-fov_000-Z2-H2-C1.tiff", - "s3_etag": "cce75b96e44777a01f2ad68299492f6d", - "sha1": "59611c72b8d9fcf13669eada705254fcdefdc7ff", - "sha256": "d2b61894955a168fb0ac7829cc9ee733143524604b1e80530485ea8e5011360a", - "size": 1600269, - "uuid": "b70a3092-a8b6-40ae-9cbb-34cbcb5a2cf0", - "version": "2019-04-03T105617.821595Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f5c2377d", - "indexed": false, - "name": "primary_image-fov_000-Z2-H2-C2.tiff", - "s3_etag": "67a34e735ffd103e596353c26fee3c3f", - "sha1": "792ba03c85920df2ce38be9c03eec054caa1047c", - "sha256": "650bf866b8fb87ab9cafe2bbfdee1efb65c72f63e95428af59c5e8c41d95ebac", - "size": 1600269, - "uuid": "b9efda80-7e16-4e5c-ba35-6129b824b553", - "version": "2019-04-03T105618.200496Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "d6429d4f", - "indexed": false, - "name": "primary_image-fov_000-Z2-H2-C3.tiff", - "s3_etag": "9296ab3ee1b462b5a5d65a56f214b997", - "sha1": "e49c58ddc0fb9e6290520a2f60d1ef891b56206f", - "sha256": "2386bc3553f1f52628afebecf6ea96b17f3312340de1a7b9386a4dcbb4d8fd10", - "size": 1600269, - "uuid": "8c4f42e5-8544-46a9-9744-7540c07e040e", - "version": "2019-04-03T105618.586702Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5aafd070", - "indexed": false, - "name": "primary_image-fov_000-Z3-H0-C0.tiff", - "s3_etag": "d062ee9eb1e0c4e80b71eef975768106", - "sha1": "e6d768504b4a0a608de93df16912d44b44da0e7b", - "sha256": "3d3c0fbe3d11decaacf6c24eed84bcf915c9cf6714962d290e12dbada9f3abd3", - "size": 1600269, - "uuid": "c9b04d1c-02ce-4db6-bfd5-b69edef36c55", - "version": "2019-04-03T105618.841432Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ef964528", - "indexed": false, - "name": "primary_image-fov_000-Z3-H0-C1.tiff", - "s3_etag": "9194049a53022defccc87e6e373c702e", - "sha1": "8dacd7cc7ccec6a231a1c2ef9ab8fc6ca5b1d567", - "sha256": "f53aff93086e8ff3abd65c5bdf385d44cda29bfd5cfb71bb2296a3e3bd0bc48c", - "size": 1600269, - "uuid": "70c7781a-b4b2-49db-b818-9582ae41c32f", - "version": "2019-04-03T105619.399696Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4820d355", - "indexed": false, - "name": "primary_image-fov_000-Z3-H0-C2.tiff", - "s3_etag": "9d48c889e143511f4ca118d57244795f", - "sha1": "b3c27cdfad9eb8676658dbe431aa25b084fe051e", - "sha256": "83a46a8f63f65099bb24b3a2ca046d0bb138915d48069cb1d598fb14418774ce", - "size": 1600269, - "uuid": "8a21baa6-cff7-4807-85f6-2815522f2305", - "version": "2019-04-03T105619.679038Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ad76dbb5", - "indexed": false, - "name": "primary_image-fov_000-Z3-H0-C3.tiff", - "s3_etag": "f4f641752b8c92b5e33846f971e2bb99", - "sha1": "54f1de46504eac499d5da453eb8fc09787c800f8", - "sha256": "48ed76ac22ccd6d9b378b605a2e6fd92618d49c684b7ba4e5a656dc94b825aa4", - "size": 1600269, - "uuid": "8ddd205f-c13f-4001-93ae-c9b834c762bc", - "version": "2019-04-03T105619.959849Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "da30f7e2", - "indexed": false, - "name": "primary_image-fov_000-Z3-H1-C0.tiff", - "s3_etag": "73ff3d828f234c4a34e41c43cb1b8e1a", - "sha1": "688dea42d4d0341008af68033eb471047d7448a0", - "sha256": "862916d173844e00fa7c89f2f569127dc9b4ea40ffced0685ba1f6c0366b6ec1", - "size": 1600269, - "uuid": "318fcac8-e540-4c30-840c-9baf19dd8ac1", - "version": "2019-04-03T105620.515721Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4acc4110", - "indexed": false, - "name": "primary_image-fov_000-Z3-H1-C1.tiff", - "s3_etag": "ba6d37a8269a9bf6c3788d52031b29bb", - "sha1": "913541ed4d6e6c3cb87e40e7c479f2520eb489df", - "sha256": "2dcba4d4d5519f97c2eca00e9840d3e16a585760fa5768dff9aa464d1c70b025", - "size": 1600269, - "uuid": "76690f93-b774-4a5b-8e44-ed1a15463d28", - "version": "2019-04-03T105620.763724Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "43cc3f48", - "indexed": false, - "name": "primary_image-fov_000-Z3-H1-C2.tiff", - "s3_etag": "97b6d5bf0fd61b5f513efa2b409b9edf", - "sha1": "315da7494e53e2b8017b5a83f6add784aac12d6b", - "sha256": "e3632c252f3e5ed30bb19bf77c1a9689e68d4e62749a22903eba05181f6b118b", - "size": 1600269, - "uuid": "a5c6ec42-6651-416f-8bf2-a75d19067701", - "version": "2019-04-03T105621.035316Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ba844c65", - "indexed": false, - "name": "primary_image-fov_000-Z3-H1-C3.tiff", - "s3_etag": "dc45a53df4bcdbe0f43c5413905aba1f", - "sha1": "87120245035e23c44389cb116f9cb669618b9f0d", - "sha256": "572b1a336be5579f17ba32ae2100148ac7375673f8e44b9d23e27fee815b861d", - "size": 1600269, - "uuid": "08360384-d64d-423c-b393-ac77e55f5b54", - "version": "2019-04-03T105621.335645Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a22c482c", - "indexed": false, - "name": "primary_image-fov_000-Z3-H2-C0.tiff", - "s3_etag": "762d5e4141197e0c63b8b038de8d6782", - "sha1": "5ddf8c065eefec37b866ac74b577fe05638c18f7", - "sha256": "5d614db01b19b9ca8cd948080d29026bfbdaa175e49cdf9e2f7462525b640d20", - "size": 1600269, - "uuid": "9fced6a6-70df-414b-ac73-dff271a5dbf5", - "version": "2019-04-03T105621.654577Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "93e07072", - "indexed": false, - "name": "primary_image-fov_000-Z3-H2-C1.tiff", - "s3_etag": "e3d9685615d21051daa9b834083d3d96", - "sha1": "1b8656a4a26eca4adaba32a328e1963cd6296a61", - "sha256": "3ca858c6ec4f2703e14b6b32f8823c108155400b89ee6bed925a7ae8185ee2f3", - "size": 1600269, - "uuid": "a05d672e-b664-412e-a050-a57c205edabe", - "version": "2019-04-03T105621.895551Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f3907f41", - "indexed": false, - "name": "primary_image-fov_000-Z3-H2-C2.tiff", - "s3_etag": "a9632bd5ab7fe1c532115b21830bcf93", - "sha1": "4b47753bfd6d202f885abb97da2533b7bd333a9d", - "sha256": "a0529f39e6739c75a7967c08cf06f3368676fee4ad8608e7fb44807583116479", - "size": 1600269, - "uuid": "186d9626-1b8b-4bc2-ac7c-745ae7479019", - "version": "2019-04-03T105622.164338Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1dafc649", - "indexed": false, - "name": "primary_image-fov_000-Z3-H2-C3.tiff", - "s3_etag": "619b8ccde9982a5537734b1ce393368e", - "sha1": "ac208729e50fb9db5975b6451093f635cf38d2f1", - "sha256": "dcacf37924188294b6f2ec83cddb037ed8477a4500ac8ece18e1499863a3f87c", - "size": 1600269, - "uuid": "db870673-6390-488f-998f-c96d02a17238", - "version": "2019-04-03T105622.575382Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "e812fa56", - "indexed": false, - "name": "primary_image-fov_000-Z4-H0-C0.tiff", - "s3_etag": "b86ff8c077a32dc884738059d569152d", - "sha1": "d768db2b3899d10c260b912d87160d27de8aa1a9", - "sha256": "fbdbe7a0b4a3a51e684b5a1bacb0ac4a993133d784f9eebcdaf20643396a0142", - "size": 1600269, - "uuid": "56ecf18f-2cf1-4db1-8acf-a82a04b55ddd", - "version": "2019-04-03T105622.895893Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "daa4be7d", - "indexed": false, - "name": "primary_image-fov_000-Z4-H0-C1.tiff", - "s3_etag": "059da13f286d8489c3cb3dbaa28a3f8b", - "sha1": "85115eaeed5919dce2dbfd3177377032850caab3", - "sha256": "868c1a7e2880dfc0018ecd373afe8dbb4a7d99288abb66443153f49641c631b3", - "size": 1600269, - "uuid": "a79ce39b-a4ed-4b97-a047-afb96e4ce398", - "version": "2019-04-03T105623.199025Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5cedc9de", - "indexed": false, - "name": "primary_image-fov_000-Z4-H0-C2.tiff", - "s3_etag": "4d963c867351acbb456f9058467b5a39", - "sha1": "d113362b2d7d9b8270b27b255c5fac598548cf86", - "sha256": "1bd2f114e642e4fba400ed901f4a45bc6c7b4eff683a36f9ad66d693c5234385", - "size": 1600269, - "uuid": "4f29d438-3acb-4a71-af29-e3191f071a44", - "version": "2019-04-03T105623.525898Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "a618c91c", - "indexed": false, - "name": "primary_image-fov_000-Z4-H0-C3.tiff", - "s3_etag": "df6da4b2926b1d8f8f89a2032651a430", - "sha1": "3d35e6e7ea83ab7c2e3cf11d002f89a8ecd483f4", - "sha256": "236595504636b01cc3493f1191584b64b12b79f4471938f8b5da36aa41ce6048", - "size": 1600269, - "uuid": "9578fe1c-6623-49ee-afd7-8e6c4d85d8fd", - "version": "2019-04-03T105623.779296Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b92778d5", - "indexed": false, - "name": "primary_image-fov_000-Z4-H1-C0.tiff", - "s3_etag": "453f91d8dd3b445904d6f0f85ab6becd", - "sha1": "54d59f36669cc295891467c014cd4f69cbe6253e", - "sha256": "bb52f37c1253132ca1f2575e0dd3cbd445cfb2ae821967968de96530844dc17a", - "size": 1600269, - "uuid": "24fc3772-5e01-4a34-8bd8-98d745595571", - "version": "2019-04-03T105624.055806Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "aedae183", - "indexed": false, - "name": "primary_image-fov_000-Z4-H1-C1.tiff", - "s3_etag": "fd1d5c55761ad8e46e70a8c49e2252e8", - "sha1": "ba3212180c1c65ce661492c22140c9781049ddaa", - "sha256": "b46abde44f1fb374d8d796c7bf1e5ecd3f65b80eef3229107cfc975b60407c30", - "size": 1600269, - "uuid": "af10a2c0-5f84-448a-a429-7e88bcf8d2d4", - "version": "2019-04-03T105624.344848Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "53cd4995", - "indexed": false, - "name": "primary_image-fov_000-Z4-H1-C2.tiff", - "s3_etag": "a7d7945c407b8d014f92a2f292dfbe65", - "sha1": "6fa31c4a9d846a353a5149a538a1ceb6b48293d7", - "sha256": "b39e60b7133221fbc35eff41ca912aaab4c7492bfe8197ada75fb5c5ae81ba8f", - "size": 1600269, - "uuid": "ceb1e477-69a0-4fa0-90c9-ee35e16c6d33", - "version": "2019-04-03T105624.610737Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8579d287", - "indexed": false, - "name": "primary_image-fov_000-Z4-H1-C3.tiff", - "s3_etag": "fa4ef541c7993436f3cda78604b8b5b6", - "sha1": "0dbd02794fbb3b7541f22220e8f882baeee12b2d", - "sha256": "bd1775fa1eaeab9ca466e3cdfc758760d43e3c1f866138f62965ab94a6f69725", - "size": 1600269, - "uuid": "be9b7636-fbb5-462b-af38-a351e006b334", - "version": "2019-04-03T105624.895931Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "8a9835bb", - "indexed": false, - "name": "primary_image-fov_000-Z4-H2-C0.tiff", - "s3_etag": "ae02ec63016b9abdd620536f859d69bb", - "sha1": "d5d346e6aa8fd1ceda276aed39620fd326da934e", - "sha256": "67f9709da7392cfcc65d8e6460d9b353617de5b56e3480573e5ca8c7bd582037", - "size": 1600269, - "uuid": "a01e972b-5d55-4816-9589-0c016a8eceef", - "version": "2019-04-03T105625.257370Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "98a57d8d", - "indexed": false, - "name": "primary_image-fov_000-Z4-H2-C1.tiff", - "s3_etag": "e84bc9fd5931d981c7ade8b43df6cd77", - "sha1": "ac170164ac57262e00deab61c41757b410cda006", - "sha256": "878d36ccf128a83cf8bba81022d55d30fc4781ab16f0c92952938dfd6eac5a54", - "size": 1600269, - "uuid": "e2ec1f14-7d7f-4693-bb0c-ec5a6f417803", - "version": "2019-04-03T105625.515250Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "aaa60b26", - "indexed": false, - "name": "primary_image-fov_000-Z4-H2-C2.tiff", - "s3_etag": "f4debfc643dd4c87c943390f9f0927b8", - "sha1": "c60896cd90c6eba3f25b3ad43809e9e4b0e175ba", - "sha256": "0e097b54b24ddce69cecd5b38e194c3b8bc501f7557b8641f90268b84711b109", - "size": 1600269, - "uuid": "707f043c-a115-45ee-8fad-2962f55ff58e", - "version": "2019-04-03T105626.011308Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "03952f13", - "indexed": false, - "name": "primary_image-fov_000-Z4-H2-C3.tiff", - "s3_etag": "fb57bffe031aac808b3f763a95b55a19", - "sha1": "be462c01298c1cc2c37e6f3e36775fd36514f179", - "sha256": "5d7170e3cf1805663408e69eed861a2dd604cefe911cc1887575252210147770", - "size": 1600269, - "uuid": "0bf3e1df-6d4e-4fe2-b608-95a23ed4e5a0", - "version": "2019-04-03T105626.396309Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "428ef5bb", - "indexed": false, - "name": "primary_image-fov_000-Z5-H0-C0.tiff", - "s3_etag": "a142720da87ce8c6ada038aa5d49a169", - "sha1": "cd4a508c87fe959f211edb71c11bbd7fbfafd37e", - "sha256": "a0ce165b659ef69ad056ad76b6e93d3dfa999f7845762c3d6d305dcb835885ed", - "size": 1600269, - "uuid": "d90b7354-47b4-4aec-8d4c-ac8805467b6a", - "version": "2019-04-03T105626.655715Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "39397452", - "indexed": false, - "name": "primary_image-fov_000-Z5-H0-C1.tiff", - "s3_etag": "4707b7fa9f888219b829054ca0be4c14", - "sha1": "a56b208676f6a45450b96c5708672d809bb7cdba", - "sha256": "0d77858e76d5a1f29df86674f4732744cd22ebe67739ee0f73430e15124e190c", - "size": 1600269, - "uuid": "dfb213e1-e9c1-4996-a0fb-1da6ea5e6992", - "version": "2019-04-03T105626.976077Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "73578068", - "indexed": false, - "name": "primary_image-fov_000-Z5-H0-C2.tiff", - "s3_etag": "425d807333615faee9e53384c99d1525", - "sha1": "33ca4a69c8fb9c36678b6f43165c22594f4470f9", - "sha256": "b06202c2da34f93e9888e7b227ec8bc955d0a7eb655f43605272fe8d3f76f8e9", - "size": 1600269, - "uuid": "58d7e9ca-9c4f-4a92-8335-d03a007b4b3a", - "version": "2019-04-03T105627.218596Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ce40d3ac", - "indexed": false, - "name": "primary_image-fov_000-Z5-H0-C3.tiff", - "s3_etag": "38ea4d04b518aa2faebfab95c00879ca", - "sha1": "1a0876b3528a7c5a979e0b3f8593989c09ccd060", - "sha256": "8f2919c5a7a173b660fdb1a268f6a8b501e725b1cc4014c46c17900a1c7b40ac", - "size": 1600269, - "uuid": "a7e2a1b2-a3b0-4c19-9baa-17da6bfc9c60", - "version": "2019-04-03T105627.502876Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ab01a9d0", - "indexed": false, - "name": "primary_image-fov_000-Z5-H1-C0.tiff", - "s3_etag": "b7b0f23db471b2ba161a37bbbb49dacb", - "sha1": "a5335cd38929f7454e0661780b49b4c8d3e4c3ef", - "sha256": "10965856cd7ff817b66b2770367587844c69cf3897907c422b9285f5a5240b43", - "size": 1600269, - "uuid": "a2366fa7-fba6-4899-a2da-d297f781ed4a", - "version": "2019-04-03T105627.790236Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7ea6bda4", - "indexed": false, - "name": "primary_image-fov_000-Z5-H1-C1.tiff", - "s3_etag": "e15f3bdc49f3eece05d6b91c433e7f56", - "sha1": "62b7d1490a78d98165468dbe5bb2f3a6424dda14", - "sha256": "bf275b7057317795046a4371e0da5d060dd7db54b43f8af451b6f69dd6d9d179", - "size": 1600269, - "uuid": "3f058b01-c8fc-43e8-b4f9-9c10449bf12c", - "version": "2019-04-03T105628.115924Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c11084d8", - "indexed": false, - "name": "primary_image-fov_000-Z5-H1-C2.tiff", - "s3_etag": "15c1b90d42d37afd77efb11c5dece01c", - "sha1": "ecf9e80d36eaefd41ffb2b2c8cc338a7f65af317", - "sha256": "95b7f3c4382bc8230e8e7497150cdabcdf6a979bf05e469ecdae77c6ce996d6e", - "size": 1600269, - "uuid": "b28492e5-5b71-4048-8261-82b20ef55540", - "version": "2019-04-03T105628.372925Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1e451967", - "indexed": false, - "name": "primary_image-fov_000-Z5-H1-C3.tiff", - "s3_etag": "0898d4a1d00f1aa862dc33cced7b0c9d", - "sha1": "ba2f5515bceff182e8bb2ce6b1fe644e865fb5be", - "sha256": "723f48bc1a4bac1847199bdd6709ea7531c0bf1d4f53d812923f3fe3ef56f0c2", - "size": 1600269, - "uuid": "c5684e6e-6461-4360-bae9-fab162dfe7da", - "version": "2019-04-03T105628.797211Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "dbab5433", - "indexed": false, - "name": "primary_image-fov_000-Z5-H2-C0.tiff", - "s3_etag": "ae3f68ee7ff45d011ca9c39e96f92093", - "sha1": "24768b34064040f3e115af28c05bfbd60c8ae118", - "sha256": "6de64340a14313461ca2cbe4a30c368cb82566f77909afd64beed0048c1aed87", - "size": 1600269, - "uuid": "97b5dded-4ea8-4404-8c9a-449ba9fb8269", - "version": "2019-04-03T105629.135928Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c12f70f8", - "indexed": false, - "name": "primary_image-fov_000-Z5-H2-C1.tiff", - "s3_etag": "15b094ffd10bf74d2dbf06c63afce6f0", - "sha1": "1a3a7e964c90e3330ef6934e27ad20a6b74f5d1c", - "sha256": "acb8c3fe3a17d12b5354c2ccb7625d132140a15af70dea14288e627d54ce2c96", - "size": 1600269, - "uuid": "e879b6b4-3fc2-4436-b8ff-eb9df73d3ed2", - "version": "2019-04-03T105629.377960Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b524a465", - "indexed": false, - "name": "primary_image-fov_000-Z5-H2-C2.tiff", - "s3_etag": "abce483fa1f38c6eff3adc8c139838fe", - "sha1": "4f51deacf61528b2c5e913cc7b90a27b27fbd07b", - "sha256": "11f0f0fc92c2d30e0c5f6113b542e2642f7311db72775ae75d9104e963f5bd7a", - "size": 1600269, - "uuid": "53781f5a-928a-451e-addf-57873b35b752", - "version": "2019-04-03T105629.795795Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1def4990", - "indexed": false, - "name": "primary_image-fov_000-Z5-H2-C3.tiff", - "s3_etag": "4978c445486bca4c2448ef12aa04ca51", - "sha1": "a0c842723a0445c494ec6893045e3e5af44a4634", - "sha256": "f1e583acebdebb6c0fa20e100eb1cd5d6489c8aafd5e1090754dd45bd1dc6901", - "size": 1600269, - "uuid": "e6f008b0-bf18-46bb-be73-2705c748a25d", - "version": "2019-04-03T105630.050748Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f0c87133", - "indexed": false, - "name": "primary_image-fov_000-Z6-H0-C0.tiff", - "s3_etag": "f81727967edfe177a6d063a95dd36e00", - "sha1": "30fe4f671719c78fd7de1b0f28938142fc5990fd", - "sha256": "4f52e11e66b921de450714aa0091d3fec21f96fbc62dade12de2a69dd5438746", - "size": 1600269, - "uuid": "4f5e3c36-fd75-4ee0-8b18-cf54422d037b", - "version": "2019-04-03T105630.396132Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ed8bf4f8", - "indexed": false, - "name": "primary_image-fov_000-Z6-H0-C1.tiff", - "s3_etag": "ecfc2fda1eabe6b5276007a200fdcc11", - "sha1": "ae1728de3c363dff7e8e776c5b74f12109745958", - "sha256": "976128eba622c8b5f5ec780f37ae7ac1410f32130a518bbd1e595c2cfe5da14f", - "size": 1600269, - "uuid": "4ffb1482-0d3c-4796-9a4d-e714d6b943fb", - "version": "2019-04-03T105630.713724Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "bdf3643f", - "indexed": false, - "name": "primary_image-fov_000-Z6-H0-C2.tiff", - "s3_etag": "f9a9614b6742ae7b70059efe0faa4f1e", - "sha1": "3269e888f787f08a92bcf8f641918ddf7dd7363e", - "sha256": "dc35f4a49dfcb2d1b8d1381612dd19651ceabca0b69f18279a96d8d40e76584e", - "size": 1600269, - "uuid": "a173a354-3997-4205-83f2-19e37e174996", - "version": "2019-04-03T105631.296167Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "02ca92c5", - "indexed": false, - "name": "primary_image-fov_000-Z6-H0-C3.tiff", - "s3_etag": "829b50d687a0edc863b03dec0e62c83b", - "sha1": "709535f9930c30f8c2d77112f0039eb0878204c2", - "sha256": "8e489fb561fbd17c7a72f577038dd2be247ec95e8d72dce76a3f59abe8e9ccc6", - "size": 1600269, - "uuid": "410082ea-b30c-410a-9aa1-9dc4d7c16346", - "version": "2019-04-03T105631.687118Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "cd171abf", - "indexed": false, - "name": "primary_image-fov_000-Z6-H1-C0.tiff", - "s3_etag": "5ecfab98c0ffd40322de4c4096a7af18", - "sha1": "7a42648e778cd5c5cf562edefb283b9b9e4f3613", - "sha256": "686dea8aa0155de53310fb9717465eb88f5435c676e2561bdb5bbd17f1ada351", - "size": 1600269, - "uuid": "ea4feacf-2273-4faa-bccb-16e694e14de0", - "version": "2019-04-03T105631.942387Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "653c9b7a", - "indexed": false, - "name": "primary_image-fov_000-Z6-H1-C1.tiff", - "s3_etag": "36d6f6dd8df14136f191373a7af2f4c1", - "sha1": "9da58900ca057df2c53738723dae3b66eb0f717b", - "sha256": "4c684d7b345db1d204134bd77a4b536134d3c2abcebe677e292c0a503d104bf9", - "size": 1600269, - "uuid": "7e6e78b0-a7a4-4b5d-9217-76780babe1dc", - "version": "2019-04-03T105632.208582Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "e148b974", - "indexed": false, - "name": "primary_image-fov_000-Z6-H1-C2.tiff", - "s3_etag": "599e4babff80285e97242bd4cd08f7e3", - "sha1": "d564342f4a3c0cdadaf0df852f0e197e972d82a6", - "sha256": "1a4a4d532775f1fb0df3a7808db2fb297dce720e6fdbafcaa4e0ff382193c998", - "size": 1600269, - "uuid": "ef0dbdf9-5adf-4503-b48b-c59cf84f30f4", - "version": "2019-04-03T105632.536420Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "553155b3", - "indexed": false, - "name": "primary_image-fov_000-Z6-H1-C3.tiff", - "s3_etag": "0e1a664c446d81fb18223b4149e8b2ac", - "sha1": "7fe65a76887149fb1f50c86f27859d689311674b", - "sha256": "c5d5c84a9c0efd4abf05b4dd557dae8cafe485608a1b62f3d565d772fd1158fc", - "size": 1600269, - "uuid": "4ad6424c-538b-4387-b54a-70aaac5e0a01", - "version": "2019-04-03T105632.798766Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f4752a9d", - "indexed": false, - "name": "primary_image-fov_000-Z6-H2-C0.tiff", - "s3_etag": "168337b82e797db619902e906292bb14", - "sha1": "efedb0f65e78da53fc026c6275b60695e30987de", - "sha256": "37e84417d3876f66a9d669d401977fe0efd36d538b95047daa57ae3d88773593", - "size": 1600269, - "uuid": "e54926ec-cfc5-4a80-952a-961a98d01264", - "version": "2019-04-03T105633.035247Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "62f80682", - "indexed": false, - "name": "primary_image-fov_000-Z6-H2-C1.tiff", - "s3_etag": "b280fa6859fd8571e68682c0d3d6f181", - "sha1": "0c70628b53eaeb6d425583bce2f98b085bace46a", - "sha256": "72f7df5e3c5965bd88315189329887ba47bf8d51e3f9464646e5faebdab1b1a7", - "size": 1600269, - "uuid": "1a98673d-9d2d-4083-a0d5-b128c5d267de", - "version": "2019-04-03T105633.297846Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "978bc625", - "indexed": false, - "name": "primary_image-fov_000-Z6-H2-C2.tiff", - "s3_etag": "d87a672aaa65722044eec823981cbaf5", - "sha1": "f90814c037f00b4d41efed7d9e1f2e00efd69205", - "sha256": "49b58722e29ddd4a2468439e672dccc23e171f283232e13f98ca5f1475f618eb", - "size": 1600269, - "uuid": "a9477ea9-35a8-449c-a157-4ec3b9057989", - "version": "2019-04-03T105633.619365Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ed432bf7", - "indexed": false, - "name": "primary_image-fov_000-Z6-H2-C3.tiff", - "s3_etag": "440b9064ae05440988d3ffad8e9b629d", - "sha1": "e9463d9b903587304016899a06170eb7323cd381", - "sha256": "bba29e16735e9620268b88bc2db40d656771c3b30948489e84add2bda58ce0a5", - "size": 1600269, - "uuid": "ca573914-fead-42c2-acc3-3a9536d720a4", - "version": "2019-04-03T105634.196322Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "7f1c78ad", - "indexed": false, - "name": "primary_image-fov_000-Z7-H0-C0.tiff", - "s3_etag": "cb0c4a925ce2e8464672ad3053ddae1c", - "sha1": "1210c56cddbb77d129a2e3bdbb6ad45ea318c191", - "sha256": "6e044a88160ce6f2480840525804b5fc7f115f3d787e15594ae2b9d3d635a354", - "size": 1600269, - "uuid": "03e3dcc3-d45a-4c83-bc0b-817e563e19a9", - "version": "2019-04-03T105634.597173Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "f5f7ed24", - "indexed": false, - "name": "primary_image-fov_000-Z7-H0-C1.tiff", - "s3_etag": "1b2683b7a2ee7678f79731c3cc75690d", - "sha1": "86964dff4fdc8cf47e6a873b3baab70e4d933718", - "sha256": "9efe951da0f64c505dabcd815234e3960626ebc09bcbb31c26ae9885fd573892", - "size": 1600269, - "uuid": "202940df-87ab-4deb-9ee3-565408ba1316", - "version": "2019-04-03T105634.889498Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5cd6ee04", - "indexed": false, - "name": "primary_image-fov_000-Z7-H0-C2.tiff", - "s3_etag": "e196eb320d1fdb6cb9924932fcd91e6a", - "sha1": "bbef2157f75133fa93b1da4c130fb4c25384502b", - "sha256": "e9435a040e8d6a92506516e18edbf5017effc9e5d60358f0bf91fa7c9ad4a094", - "size": 1600269, - "uuid": "3a044d9b-72cf-4c00-a331-b920f8bbef8f", - "version": "2019-04-03T105635.152162Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "217ea5dd", - "indexed": false, - "name": "primary_image-fov_000-Z7-H0-C3.tiff", - "s3_etag": "a908d34dbf74e09c25de5b9f7273ff21", - "sha1": "6919b4ef62136cf8056f10c9035eaf34350be210", - "sha256": "bc27ec72db5a5da93908b49865f479cafdd06e54a5ea02145cf5fc437bcf8c1e", - "size": 1600269, - "uuid": "9ca4cd36-67c4-4a19-9e65-82b70a73f820", - "version": "2019-04-03T105635.416620Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "be84f068", - "indexed": false, - "name": "primary_image-fov_000-Z7-H1-C0.tiff", - "s3_etag": "a0ea29c8f6b4ed700405d0b7b9f25508", - "sha1": "74769dc49f9243e25fe628f7761cd68d943c0a52", - "sha256": "d4700ed483bb7a10c940c309765d07f28e25897d67d9890636a0ed9a9b89ea11", - "size": 1600269, - "uuid": "62d38039-7672-472b-8847-c63bf52bfb6e", - "version": "2019-04-03T105635.669528Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "bf3a8200", - "indexed": false, - "name": "primary_image-fov_000-Z7-H1-C1.tiff", - "s3_etag": "72c4457ab957a85df4a9115a34f109dd", - "sha1": "5c44bb630300766ff7b359d96dbec03f4db98b5c", - "sha256": "a112cd97673c1085b02fe6a9efb24f643ee42cc12a5e6d226aac67531451ec1d", - "size": 1600269, - "uuid": "c0fe4ea4-1562-4402-80fb-78cec6415fb6", - "version": "2019-04-03T105636.216303Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "177eb23a", - "indexed": false, - "name": "primary_image-fov_000-Z7-H1-C2.tiff", - "s3_etag": "bba07940f0a5aaa5957f81c9e0065e61", - "sha1": "3db85d8e823b23f1aa680053951e9c33ff485aa7", - "sha256": "552e403f54a98bb55ff0803f6b58ad6270ac38b7a39d1a0763bb2120b0b92985", - "size": 1600269, - "uuid": "92351261-9885-477b-8d2a-227901e6ffc7", - "version": "2019-04-03T105636.729218Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "0c632a10", - "indexed": false, - "name": "primary_image-fov_000-Z7-H1-C3.tiff", - "s3_etag": "d3179c0a7294de7f691d8c7db3666e3e", - "sha1": "7c3d00508196f32958021c50778fb38a6082d357", - "sha256": "e3dc5487b384395b8f935206ed5b6a95afd4cc6e3c4815bf9483ed47c156a1b9", - "size": 1600269, - "uuid": "bdf53fbd-fb66-456a-976c-d97414d1ab3b", - "version": "2019-04-03T105637.056125Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "aa061cbb", - "indexed": false, - "name": "primary_image-fov_000-Z7-H2-C0.tiff", - "s3_etag": "b3dbbd62b9b385661d35955aae4b9513", - "sha1": "5aace9b7444f82c5b3640fc9ed2a79b1a9e12e27", - "sha256": "3d7b47e0d89808e906e6fa93b41cddafa38a3b2886441a8bcda381f0f44d06e4", - "size": 1600269, - "uuid": "f76cf7a7-8ae0-4cc2-8c49-497d8eeb4bd5", - "version": "2019-04-03T105637.312587Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1321fee4", - "indexed": false, - "name": "primary_image-fov_000-Z7-H2-C1.tiff", - "s3_etag": "dc1eadd4622eeba183ce61f908d093da", - "sha1": "1b1f67ce1f6db8cc0249b9f499734d01b9dc9519", - "sha256": "a62a5092a92c76327e49883c2652e3ebaea9953c2a48afca5c165a47b10e4f90", - "size": 1600269, - "uuid": "ccdd0669-ecf0-42d0-9eed-e6f32f4e2137", - "version": "2019-04-03T105637.562208Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "65556d46", - "indexed": false, - "name": "primary_image-fov_000-Z7-H2-C2.tiff", - "s3_etag": "29efa087a59c0d3e0a180290bea0bf7b", - "sha1": "f7f4cd42d06294f61ad5fef654a0406618b95f49", - "sha256": "fcefebbbbb13678824196b57eecdf5a290d936dc8809f8fbc1ccdd29d1b96e18", - "size": 1600269, - "uuid": "599e9909-55d0-4d43-bef2-c94997a9b5ed", - "version": "2019-04-03T105637.875619Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3193e54b", - "indexed": false, - "name": "primary_image-fov_000-Z7-H2-C3.tiff", - "s3_etag": "08175c1691b34c11dc647d01d1c3065f", - "sha1": "813943f84b4375657844bef235fdb2ddc6e1b830", - "sha256": "3a277e268ebdbd068dc4513ba21820455b81ba7c06a0172210a91706ddddf8c4", - "size": 1600269, - "uuid": "b6642034-460c-4628-8995-959aed6daf4c", - "version": "2019-04-03T105638.140553Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b20225fc", - "indexed": false, - "name": "primary_image-fov_000-Z8-H0-C0.tiff", - "s3_etag": "d82f9b12e1c2ae0df138faa1ea08d33f", - "sha1": "174399a0891dfebe57176fb5852103fa69513ea0", - "sha256": "9788637a05eb6abaf9202ce9f80219686edb82669af2d5f53bee50b35f430126", - "size": 1600269, - "uuid": "43a3a428-155b-4174-b22e-8fa69be8d792", - "version": "2019-04-03T105638.472919Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "592b9781", - "indexed": false, - "name": "primary_image-fov_000-Z8-H0-C1.tiff", - "s3_etag": "bc52bd93291f0673d856257761ea8252", - "sha1": "2d734ec0a0cf384feb7de9d08b984da7b41fc24f", - "sha256": "7dc04a42f36d4535311bccefc01ac3c3993c52cd9fd900f556cf943705ed0e88", - "size": 1600269, - "uuid": "12b0c950-9687-4b28-979c-6b370ace1cd3", - "version": "2019-04-03T105638.747128Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "22ecfc52", - "indexed": false, - "name": "primary_image-fov_000-Z8-H0-C2.tiff", - "s3_etag": "e1af122e50eea65daa022f8571517bfd", - "sha1": "0c0b67437f1e48770ddc9002c09d5e281bc97d1e", - "sha256": "39c47edd52b1c74758d90dbc21977a9fda7ae4de554cb9238e7bf0903b8fdea2", - "size": 1600269, - "uuid": "d0d46791-b50d-4622-a375-300d35ef1ba4", - "version": "2019-04-03T105638.999068Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2b09e4ff", - "indexed": false, - "name": "primary_image-fov_000-Z8-H0-C3.tiff", - "s3_etag": "ccfc7c9f94dd6e47d59c20e2e76d0f16", - "sha1": "1b5c3493b162347b528a4f0e22a9879e4c7d766a", - "sha256": "5c86130e5dc26548c71301779426353401667b0b373fd5b2fa0886d8ecb54328", - "size": 1600269, - "uuid": "6cfbdd29-5799-40c9-9329-917cfe98fb3a", - "version": "2019-04-03T105639.334527Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "42e96812", - "indexed": false, - "name": "primary_image-fov_000-Z8-H1-C0.tiff", - "s3_etag": "60febe6a957ecea63058bfb412e570a5", - "sha1": "94a507aa40e4b3f93f17ad8d15d9e4780571a914", - "sha256": "56a67c43ffb995edaa30ce0ce151f0df38ea08827d93c1e57b902bebe78e1cc7", - "size": 1600269, - "uuid": "c665c520-397f-4410-abed-1cd9e23fe942", - "version": "2019-04-03T105639.905452Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b18acdbe", - "indexed": false, - "name": "primary_image-fov_000-Z8-H1-C1.tiff", - "s3_etag": "09f753ef93d7ae051a784a327cc79e95", - "sha1": "ae87ab3d3d51095ea4cc74dda5475b47d344875b", - "sha256": "49f068eaae48dbfa68b9f63876e10fa94a613115a7285dd0fad6ee7438d1624e", - "size": 1600269, - "uuid": "fdac5e58-f0bb-40b1-9a58-b49f43bc4238", - "version": "2019-04-03T105640.178722Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "af59c8a5", - "indexed": false, - "name": "primary_image-fov_000-Z8-H1-C2.tiff", - "s3_etag": "3ae21db88d4c1d098bcf3354adc846f2", - "sha1": "801f806cd3df94b5d4038b4441a8854e065682ba", - "sha256": "b16291cd500218be60bc2069d6e58dbe4f81cabb070f130aedb7ab04612a2465", - "size": 1600269, - "uuid": "bf5e1454-492c-4748-811b-b8ef68548d79", - "version": "2019-04-03T105640.476175Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "c323197b", - "indexed": false, - "name": "primary_image-fov_000-Z8-H1-C3.tiff", - "s3_etag": "75d5ca11e181f3120f46ac2c12be6d5f", - "sha1": "c53ecb067ac777473317f7e19440495bfdc305ab", - "sha256": "ae4b6948a3008f08f364741085ad1cec433765c359e69736fc4097557d43edc7", - "size": 1600269, - "uuid": "37a2c628-29f7-4845-ace9-62ed637c7c74", - "version": "2019-04-03T105640.730992Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "e7e994f8", - "indexed": false, - "name": "primary_image-fov_000-Z8-H2-C0.tiff", - "s3_etag": "3da7df800a70d2d6e8726bcc76b3b24e", - "sha1": "9ee95d06a5b17fd363fce5c4fed6e8fbb0f05258", - "sha256": "25aede1f80b6e87f0333cd85db66008ef1034eda88ca645fc15a4d0a6b00f675", - "size": 1600269, - "uuid": "1e18aaa0-df92-4bab-81dc-7e225e2c8a09", - "version": "2019-04-03T105641.356591Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "e62e1b96", - "indexed": false, - "name": "primary_image-fov_000-Z8-H2-C1.tiff", - "s3_etag": "ab7076ebad2e8ab1fe3a2ba36c9d4a05", - "sha1": "5f72db56bea0fbfe4060b03644c49ae514013a01", - "sha256": "f61291d855a579b62e4b92f6119c8682c2784bb5e60cddf3ddc016b1bf9c2543", - "size": 1600269, - "uuid": "682e7e32-5795-4fc3-ad31-5c5f5e737c55", - "version": "2019-04-03T105641.597762Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "eb94ca22", - "indexed": false, - "name": "primary_image-fov_000-Z8-H2-C2.tiff", - "s3_etag": "b19708d148c785414fd0f61e7fd497d0", - "sha1": "80e40c2765dbcd3874274020fed22714a4675a38", - "sha256": "745c2423dd6f6a0c53b0be8b4d3f01fa4f52e09e499fb3400885ebe61562eb59", - "size": 1600269, - "uuid": "3b5bde9d-8af7-4253-9013-61bc6917eac4", - "version": "2019-04-03T105642.155558Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "30148627", - "indexed": false, - "name": "primary_image-fov_000-Z8-H2-C3.tiff", - "s3_etag": "8d555490d25c9b375e1f798726f75c8e", - "sha1": "c97a2af4b2500b157661443dbde450170b7be1de", - "sha256": "887cc80db875bf5d704c18bea2ecde0e311f94a1db43e96ad2b71fbae2228ba5", - "size": 1600269, - "uuid": "e6f193a6-c235-4357-b1c8-bd075e0be111", - "version": "2019-04-03T105642.455372Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "01ece1c6", - "indexed": false, - "name": "primary_image-fov_000-Z9-H0-C0.tiff", - "s3_etag": "0ad31b3db47ab0cc64feab103cd95c06", - "sha1": "1011cca6dff2b136733eaa0fc9ed427dbcbd724f", - "sha256": "33afd30928b802f9b37e1761eea55b04aa17d9c246bbf015174fc46e6ffbbc6d", - "size": 1600269, - "uuid": "33b9e890-93dd-46bf-a464-0b293605ca13", - "version": "2019-04-03T105642.695635Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "3a56f81e", - "indexed": false, - "name": "primary_image-fov_000-Z9-H0-C1.tiff", - "s3_etag": "6463c0af4aad289aa06ab596accd7f72", - "sha1": "0e55731c16adc0a5423f2476793d2c423b1deb6a", - "sha256": "5337ba319da091c05651d7da158e1cd3719f9befb1f2f6db1344338e0ac70449", - "size": 1600269, - "uuid": "1a57ba61-0aaa-4a98-8714-44ef51295163", - "version": "2019-04-03T105642.933998Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "4f573958", - "indexed": false, - "name": "primary_image-fov_000-Z9-H0-C2.tiff", - "s3_etag": "662e5f08087f7cc4ee6454f6ed734c66", - "sha1": "96feb27dc74eb05d307d6d5f8a66826962cb037b", - "sha256": "8e7b543d6baf164527bb6ec8b391acd79cd52d61a88ecba8b72db31ade03ff95", - "size": 1600269, - "uuid": "e1a484a8-5557-440d-8196-38a39c8acc3e", - "version": "2019-04-03T105643.266340Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "5fd73b1d", - "indexed": false, - "name": "primary_image-fov_000-Z9-H0-C3.tiff", - "s3_etag": "b89d1752986854195217fda6c5f7c246", - "sha1": "f0b6ea2f3b8c3f166db793d6f02498041141a527", - "sha256": "3a328ccdc6f19fa663c1e703efe15cb80fd8f5c260eb679ac64222aead8fa19c", - "size": 1600269, - "uuid": "4a836a20-3f30-4e33-8374-c9837de94790", - "version": "2019-04-03T105643.598363Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "2335b62b", - "indexed": false, - "name": "primary_image-fov_000-Z9-H1-C0.tiff", - "s3_etag": "a45f76cccdd8e3688c03f9afb3a48e42", - "sha1": "5acfa2d86b69216cb8b25dd5e0ff44e2353a7a2a", - "sha256": "89c07cd8d4d7a47f7d7c85c4e9918e937b9dd248275c3597b520bb29685fd275", - "size": 1600269, - "uuid": "fa8e2052-2f21-420b-84bb-dee4e2ce79ab", - "version": "2019-04-03T105643.915023Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "61289ac4", - "indexed": false, - "name": "primary_image-fov_000-Z9-H1-C1.tiff", - "s3_etag": "859abbee84741bc542fd3c1916e6c76f", - "sha1": "e0a1535468297319590ac1edea0f9f17b1fcbbc3", - "sha256": "3f15a6b5d60834705355dfe79c38f4a8cae0a1fcaf3dbf61bdd2be8eeadf213b", - "size": 1600269, - "uuid": "c605b91e-3b62-442d-bd3e-2d58a213a4bf", - "version": "2019-04-03T105644.156708Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "081bc6e9", - "indexed": false, - "name": "primary_image-fov_000-Z9-H1-C2.tiff", - "s3_etag": "154e0e39f4e0598830e28c466f606604", - "sha1": "095bcb4c03fd228f69c2cff4e55d75a55f3de86a", - "sha256": "ceb0e9ae90e00e9fe53a63807eac2bb319974203ac92a4ca7ebd9c3287de2284", - "size": 1600269, - "uuid": "d6621482-70a1-42ac-895d-8398aa0bb2b7", - "version": "2019-04-03T105644.436640Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "b65a523e", - "indexed": false, - "name": "primary_image-fov_000-Z9-H1-C3.tiff", - "s3_etag": "44e91c2235e2933c382881c9260e729e", - "sha1": "98be3ab0b504f834c06b8cff450da4d2f27ddb93", - "sha256": "4a722651fc388de26b1dbfcffa7be65c448b26a31d1738e5363857dfea81ea61", - "size": 1600269, - "uuid": "1d051231-9ed8-44fd-8086-93da3a04dd0b", - "version": "2019-04-03T105644.954210Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "6e9add20", - "indexed": false, - "name": "primary_image-fov_000-Z9-H2-C0.tiff", - "s3_etag": "89384b0fb6345d99cb41c07570b88ac9", - "sha1": "27cc8de22a7967083534b80d11537d38e1adfb2a", - "sha256": "d19fd3d6fececce2aaa3877f38d1c775f76419ec07374b7cff010b9867a12854", - "size": 1600269, - "uuid": "bba231df-4b9b-44fe-a9e9-df314fc8f75d", - "version": "2019-04-03T105645.222571Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "bd266ca9", - "indexed": false, - "name": "primary_image-fov_000-Z9-H2-C1.tiff", - "s3_etag": "59d0ae52331b02c2ad8c8868f7ef97c8", - "sha1": "931b276a47bc715902e1a06f3ed7a264756b1e62", - "sha256": "e1144263f89f3b3b2c4812ca0599274d78057636dcca1d09fdebc30e0d327ced", - "size": 1600269, - "uuid": "6c85c7e1-832c-476c-add9-e2cc509f8de0", - "version": "2019-04-03T105645.515825Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "1285ec2c", - "indexed": false, - "name": "primary_image-fov_000-Z9-H2-C2.tiff", - "s3_etag": "9952c98d3f77cce10a633a2b7af2ad10", - "sha1": "d88ae8998890e877ff4bcb7d9c901ebf6c0f87fa", - "sha256": "b66e916f703c1bccfccb6ad7fcc95fb3af42ac4e6868bbdcea424de9e40a12af", - "size": 1600269, - "uuid": "9a71aa79-aa5e-41ca-89ed-2d5eaea98840", - "version": "2019-04-03T105645.832519Z" - }, - { - "content-type": "image/tiff; dcp-type=data", - "crc32c": "ee12e15f", - "indexed": false, - "name": "primary_image-fov_000-Z9-H2-C3.tiff", - "s3_etag": "34fa837a2fb39db2dddfabd84e6a560d", - "sha1": "e0ff15a11a35119aae3feb4e2afb3a0708daa28f", - "sha256": "9f447baf510beb7f942054f980818c6819a12bf9b12e5cadc2cff30af37d9674", - "size": 1600269, - "uuid": "bec2697f-31b6-4db5-888a-024379f3d13f", - "version": "2019-04-03T105646.096587Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "d148a0e3", - "indexed": false, - "name": "primary_image-fov_000.json", - "s3_etag": "c9bae9cb31bf1356ad858eba63ca3cb8", - "sha1": "bf49d7043b7e4c528a3ec7fdd1d80a49913125b6", - "sha256": "b7d0787c0f9b656331d4e56c4249dc2762ae8bd04f87995910e5ce3c30cde8d2", - "size": 55640, - "uuid": "194db0d1-dfca-44d7-9ad7-194a9e091d32", - "version": "2019-04-03T105646.365296Z" - }, - { - "content-type": "application/json; dcp-type=data", - "crc32c": "3c1c81b7", - "indexed": false, - "name": "primary_image.json", - "s3_etag": "512105655a1319dc48a63ce1b6034d61", - "sha1": "d623f185225a0edd5334fde5eba07204bf9891dd", - "sha256": "23e8dbd4385ec7be7ce90ba0fdcd00f5357735e8dc77538caa993506e0ce0307", - "size": 119, - "uuid": "57e036f8-063a-47fe-b668-499222390e95", - "version": "2019-04-03T105646.657106Z" - } -] diff --git a/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/metadata.json b/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/metadata.json deleted file mode 100644 index 41b547638..000000000 --- a/test/hca_metadata_api/cans/staging/94f2ba52-30c8-4de0-a78e-f95a3f8deb9c/2019-04-03T103426.471000Z/metadata.json +++ /dev/null @@ -1,6398 +0,0 @@ -{ - "imaged_specimen_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/2.0.7/imaged_specimen", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "420508-10-1", - "biomaterial_name": "420508 coronal sections slice 10-1", - "biomaterial_description": "mouse brain coronal section 20um", - "ncbi_taxon_id": [ - 10090 - ], - "supplementary_files": [ - "point1nissl10x.tar.gz" - ] - }, - "slice_thickness": 20.0, - "internal_anatomical_structures": [ - { - "text": "V1, Provided files are Neurotrace stain and DIC images of the half brain slice imaged at 10x" - } - ], - "provenance": { - "document_id": "87f58f88-ef8b-4323-bd19-cde1a2497b59", - "submission_date": "2019-04-03T10:13:40.000Z", - "update_date": "2019-04-03T10:13:50.866Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/9.0.0/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "420508_specimen", - "biomaterial_name": "fresh frozen brain", - "ncbi_taxon_id": [ - 10090 - ], - "genotype": "wt" - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090", - "ontology_label": "Mus musculus" - } - ], - "organ": { - "text": "brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "preservation_storage": { - "storage_method": "fresh", - "preservation_method": "fresh" - }, - "collection_time": "2018-09-18T10:00:00Z", - "provenance": { - "document_id": "edd1d525-a6ae-4658-a6bf-6c31d7ab6948", - "submission_date": "2019-04-03T10:13:39.992Z", - "update_date": "2019-04-03T10:13:45.512Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/14.0.7/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "420508", - "biomaterial_name": "C57BL6J-420508", - "ncbi_taxon_id": [ - 10090 - ], - "genotype": "wt" - }, - "mouse_specific": { - "strain": [ - { - "text": "C57BL6J", - "ontology": "EFO:0000606", - "ontology_label": "C57BL/6J" - } - ] - }, - "death": { - "cause_of_death": "euthanasia under anesthesia", - "cold_perfused": false, - "days_on_ventilator": 0.0, - "hardy_scale": 1, - "time_of_death": "2018-09-18T10:00:00Z" - }, - "genus_species": [ - { - "text": "Mus musculus", - "ontology": "NCBITaxon:10090", - "ontology_label": "Mus musculus" - } - ], - "organism_age": "56", - "organism_age_unit": { - "text": "days", - "ontology": "UO:0000033", - "ontology_label": "day" - }, - "development_stage": { - "text": "adult", - "ontology": "EFO:0001272", - "ontology_label": "adult" - }, - "is_living": "no", - "sex": "male", - "provenance": { - "document_id": "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4", - "submission_date": "2019-04-03T10:13:39.984Z", - "update_date": "2019-04-03T10:13:45.427Z" - } - }, - "image_file_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "codebook.json", - "file_format": "json" - }, - "provenance": { - "document_id": "6baa3aff-b2a5-4e49-82f7-25c108a6107a", - "submission_date": "2019-04-03T10:13:40.056Z", - "update_date": "2019-04-03T10:15:44.995Z" - } - }, - "image_file_1.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "experiment.json", - "file_format": "json" - }, - "provenance": { - "document_id": "06dcfc33-21da-485f-8e50-49d294713a9e", - "submission_date": "2019-04-03T10:13:40.066Z", - "update_date": "2019-04-03T10:15:44.993Z" - } - }, - "image_file_2.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z0-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", - "submission_date": "2019-04-03T10:13:40.076Z", - "update_date": "2019-04-03T10:15:51.032Z" - } - }, - "image_file_3.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z1-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", - "submission_date": "2019-04-03T10:13:40.085Z", - "update_date": "2019-04-03T10:15:47.812Z" - } - }, - "image_file_4.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z10-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "76e52f76-ede7-4088-b7f6-d6e5f6152292", - "submission_date": "2019-04-03T10:13:40.093Z", - "update_date": "2019-04-03T10:15:51.115Z" - } - }, - "image_file_5.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z11-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", - "submission_date": "2019-04-03T10:13:40.102Z", - "update_date": "2019-04-03T10:15:54.073Z" - } - }, - "image_file_6.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z12-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "be66141d-84a3-457d-a8d2-2f0da8c91dff", - "submission_date": "2019-04-03T10:13:40.111Z", - "update_date": "2019-04-03T10:15:51.125Z" - } - }, - "image_file_7.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z13-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "680cf532-ef0c-4155-b44d-a6ec3920743a", - "submission_date": "2019-04-03T10:13:40.120Z", - "update_date": "2019-04-03T10:15:50.982Z" - } - }, - "image_file_8.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z14-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "08609f14-cf43-4188-b743-4a0b55b17347", - "submission_date": "2019-04-03T10:13:40.128Z", - "update_date": "2019-04-03T10:15:47.817Z" - } - }, - "image_file_9.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z15-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "d10827a1-38f7-457d-9c9f-695f2fc7689c", - "submission_date": "2019-04-03T10:13:40.137Z", - "update_date": "2019-04-03T10:15:44.996Z" - } - }, - "image_file_10.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z16-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6f8eb2e5-7a0c-4c98-8da0-276457357071", - "submission_date": "2019-04-03T10:13:40.145Z", - "update_date": "2019-04-03T10:15:47.821Z" - } - }, - "image_file_11.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z2-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ca480df3-71bb-4634-8f71-b6a75aeb9f05", - "submission_date": "2019-04-03T10:13:40.154Z", - "update_date": "2019-04-03T10:15:47.796Z" - } - }, - "image_file_12.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z3-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "03ae5f5e-65ac-4491-b0ce-eefc940e0224", - "submission_date": "2019-04-03T10:13:40.166Z", - "update_date": "2019-04-03T10:15:48.018Z" - } - }, - "image_file_13.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z4-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", - "submission_date": "2019-04-03T10:13:40.176Z", - "update_date": "2019-04-03T10:15:51.040Z" - } - }, - "image_file_14.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z5-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "887f3d73-94d2-44ac-9047-67aca5225882", - "submission_date": "2019-04-03T10:13:40.186Z", - "update_date": "2019-04-03T10:15:51.029Z" - } - }, - "image_file_15.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z6-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "896dfacd-206b-4e4f-a846-ba5b070060d9", - "submission_date": "2019-04-03T10:13:40.197Z", - "update_date": "2019-04-03T10:15:47.819Z" - } - }, - "image_file_16.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z7-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "23303c88-01b1-47d0-b770-dca6802caa13", - "submission_date": "2019-04-03T10:13:40.207Z", - "update_date": "2019-04-03T10:15:47.812Z" - } - }, - "image_file_17.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z8-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3c1a388d-0577-4417-9cd2-ff33bfed9140", - "submission_date": "2019-04-03T10:13:40.217Z", - "update_date": "2019-04-03T10:15:47.821Z" - } - }, - "image_file_18.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000-Z9-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "67e71b34-7157-4a37-b495-0d740772b480", - "submission_date": "2019-04-03T10:13:40.227Z", - "update_date": "2019-04-03T10:15:51.111Z" - } - }, - "image_file_19.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei-fov_000.json", - "file_format": "json" - }, - "provenance": { - "document_id": "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", - "submission_date": "2019-04-03T10:13:40.236Z", - "update_date": "2019-04-03T10:15:51.054Z" - } - }, - "image_file_20.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "nuclei.json", - "file_format": "json" - }, - "provenance": { - "document_id": "5fbcb75e-3ee3-4429-8ede-b243afa0789f", - "submission_date": "2019-04-03T10:13:40.246Z", - "update_date": "2019-04-03T10:15:51.028Z" - } - }, - "image_file_21.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "09226b24-6b11-4e4f-8052-2b544be461aa", - "submission_date": "2019-04-03T10:13:40.256Z", - "update_date": "2019-04-03T10:15:51.126Z" - } - }, - "image_file_22.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f67473fd-fbf8-4d69-9db1-556938ab5b87", - "submission_date": "2019-04-03T10:13:40.266Z", - "update_date": "2019-04-03T10:15:54.317Z" - } - }, - "image_file_23.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", - "submission_date": "2019-04-03T10:13:40.276Z", - "update_date": "2019-04-03T10:15:50.940Z" - } - }, - "image_file_24.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "017a2c88-4f6e-418e-bb96-f42f3a220f87", - "submission_date": "2019-04-03T10:13:40.286Z", - "update_date": "2019-04-03T10:15:50.977Z" - } - }, - "image_file_25.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "30305240-004d-4632-84d4-37d7e7378782", - "submission_date": "2019-04-03T10:13:40.296Z", - "update_date": "2019-04-03T10:15:51.136Z" - } - }, - "image_file_26.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", - "submission_date": "2019-04-03T10:13:40.306Z", - "update_date": "2019-04-03T10:15:51.052Z" - } - }, - "image_file_27.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3fd2781b-6855-4eaa-b2fb-81db386adb18", - "submission_date": "2019-04-03T10:13:40.315Z", - "update_date": "2019-04-03T10:15:51.027Z" - } - }, - "image_file_28.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "40474d53-44a4-4ab2-9f20-61b71291f8aa", - "submission_date": "2019-04-03T10:13:40.325Z", - "update_date": "2019-04-03T10:15:47.810Z" - } - }, - "image_file_29.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "aaa97d47-7124-4763-a3fc-f6d66eb6d990", - "submission_date": "2019-04-03T10:13:40.334Z", - "update_date": "2019-04-03T10:15:50.958Z" - } - }, - "image_file_30.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "4adbed13-1cb6-4405-b892-fe8165050691", - "submission_date": "2019-04-03T10:13:40.344Z", - "update_date": "2019-04-03T10:15:51.040Z" - } - }, - "image_file_31.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", - "submission_date": "2019-04-03T10:13:40.354Z", - "update_date": "2019-04-03T10:15:51.020Z" - } - }, - "image_file_32.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z0-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "5402916f-6de1-4842-8585-fc25c153992b", - "submission_date": "2019-04-03T10:13:40.364Z", - "update_date": "2019-04-03T10:15:51.039Z" - } - }, - "image_file_33.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", - "submission_date": "2019-04-03T10:13:40.375Z", - "update_date": "2019-04-03T10:16:00.740Z" - } - }, - "image_file_34.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", - "submission_date": "2019-04-03T10:13:40.386Z", - "update_date": "2019-04-03T10:16:00.295Z" - } - }, - "image_file_35.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cb92dd92-570c-4075-8893-eb19dbd837b8", - "submission_date": "2019-04-03T10:13:40.396Z", - "update_date": "2019-04-03T10:16:00.289Z" - } - }, - "image_file_36.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b36948c4-0646-42be-9db2-16626a757343", - "submission_date": "2019-04-03T10:13:40.405Z", - "update_date": "2019-04-03T10:15:57.643Z" - } - }, - "image_file_37.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c974f4eb-27b8-4ec3-913e-a6eb19572a51", - "submission_date": "2019-04-03T10:13:40.414Z", - "update_date": "2019-04-03T10:15:57.265Z" - } - }, - "image_file_38.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "febb760d-1e9e-4432-9b88-ce2869a43c44", - "submission_date": "2019-04-03T10:13:40.423Z", - "update_date": "2019-04-03T10:16:03.118Z" - } - }, - "image_file_39.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "054f40a4-68d0-41db-81e9-00239042d9fa", - "submission_date": "2019-04-03T10:13:40.432Z", - "update_date": "2019-04-03T10:15:54.056Z" - } - }, - "image_file_40.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", - "submission_date": "2019-04-03T10:13:40.441Z", - "update_date": "2019-04-03T10:15:57.262Z" - } - }, - "image_file_41.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "819e3227-cc54-4919-95af-c1f8194bf729", - "submission_date": "2019-04-03T10:13:40.450Z", - "update_date": "2019-04-03T10:16:00.245Z" - } - }, - "image_file_42.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b1e2b9d1-6973-41dc-acdf-95474303561f", - "submission_date": "2019-04-03T10:13:40.458Z", - "update_date": "2019-04-03T10:16:00.392Z" - } - }, - "image_file_43.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "41ffc783-5ad4-4197-8fd1-c029903c43c0", - "submission_date": "2019-04-03T10:13:40.467Z", - "update_date": "2019-04-03T10:16:00.242Z" - } - }, - "image_file_44.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z1-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", - "submission_date": "2019-04-03T10:13:40.475Z", - "update_date": "2019-04-03T10:15:54.163Z" - } - }, - "image_file_45.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9014bbaf-a047-4b69-8e28-8356cc99f84e", - "submission_date": "2019-04-03T10:13:40.484Z", - "update_date": "2019-04-03T10:15:54.097Z" - } - }, - "image_file_46.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f7acf90c-2b32-463b-b832-8daa8529f727", - "submission_date": "2019-04-03T10:13:40.492Z", - "update_date": "2019-04-03T10:15:51.110Z" - } - }, - "image_file_47.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", - "submission_date": "2019-04-03T10:13:40.501Z", - "update_date": "2019-04-03T10:15:54.068Z" - } - }, - "image_file_48.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "db22deab-498a-409c-8386-5bf4e60a080c", - "submission_date": "2019-04-03T10:13:40.509Z", - "update_date": "2019-04-03T10:15:54.171Z" - } - }, - "image_file_49.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "07d600bc-0d55-4a8d-9a48-390fc4169845", - "submission_date": "2019-04-03T10:13:40.518Z", - "update_date": "2019-04-03T10:15:54.155Z" - } - }, - "image_file_50.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "d0a032bb-cd0e-4873-b346-5cb19e45c202", - "submission_date": "2019-04-03T10:13:40.526Z", - "update_date": "2019-04-03T10:15:54.147Z" - } - }, - "image_file_51.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a161f60f-af92-4b09-9df0-dd7ff2bf571a", - "submission_date": "2019-04-03T10:13:40.536Z", - "update_date": "2019-04-03T10:15:54.146Z" - } - }, - "image_file_52.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", - "submission_date": "2019-04-03T10:13:40.545Z", - "update_date": "2019-04-03T10:15:57.073Z" - } - }, - "image_file_53.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f10fd9e2-5747-4d7a-8c0c-beba81749011", - "submission_date": "2019-04-03T10:13:40.553Z", - "update_date": "2019-04-03T10:15:54.011Z" - } - }, - "image_file_54.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "553b6aab-4745-45f8-98ab-de6aadbf48e4", - "submission_date": "2019-04-03T10:13:40.562Z", - "update_date": "2019-04-03T10:15:54.255Z" - } - }, - "image_file_55.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3572abe9-6e42-4266-8671-ff24b592065c", - "submission_date": "2019-04-03T10:13:40.571Z", - "update_date": "2019-04-03T10:15:54.233Z" - } - }, - "image_file_56.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z10-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6882abf6-c247-4167-a18d-e3fec24bcba2", - "submission_date": "2019-04-03T10:13:40.579Z", - "update_date": "2019-04-03T10:15:54.124Z" - } - }, - "image_file_57.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "15f8b73e-937c-444d-8362-fdf458abb651", - "submission_date": "2019-04-03T10:13:40.588Z", - "update_date": "2019-04-03T10:15:54.117Z" - } - }, - "image_file_58.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "33b4e374-20ad-4fee-b682-aaa4fc12bec2", - "submission_date": "2019-04-03T10:13:40.596Z", - "update_date": "2019-04-03T10:15:54.178Z" - } - }, - "image_file_59.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "0e83c507-2211-4561-b75a-92326fb2d4fd", - "submission_date": "2019-04-03T10:13:40.605Z", - "update_date": "2019-04-03T10:15:54.229Z" - } - }, - "image_file_60.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "912c55cf-0774-4838-8874-352766984715", - "submission_date": "2019-04-03T10:13:40.613Z", - "update_date": "2019-04-03T10:15:54.213Z" - } - }, - "image_file_61.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", - "submission_date": "2019-04-03T10:13:40.622Z", - "update_date": "2019-04-03T10:15:50.981Z" - } - }, - "image_file_62.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "5b8e3d96-e625-46b6-9689-110fa84fd721", - "submission_date": "2019-04-03T10:13:40.630Z", - "update_date": "2019-04-03T10:15:54.097Z" - } - }, - "image_file_63.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", - "submission_date": "2019-04-03T10:13:40.639Z", - "update_date": "2019-04-03T10:15:57.225Z" - } - }, - "image_file_64.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6f3272d7-4a62-4a3c-8c44-11dda8756956", - "submission_date": "2019-04-03T10:13:40.647Z", - "update_date": "2019-04-03T10:15:53.957Z" - } - }, - "image_file_65.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "168422c5-e89d-466c-9085-f29c02160143", - "submission_date": "2019-04-03T10:13:40.656Z", - "update_date": "2019-04-03T10:15:54.119Z" - } - }, - "image_file_66.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7331367a-cc43-4af0-8750-a2921d513f97", - "submission_date": "2019-04-03T10:13:40.664Z", - "update_date": "2019-04-03T10:15:57.287Z" - } - }, - "image_file_67.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "edf83a09-2e60-4571-b650-abf4c7ff757b", - "submission_date": "2019-04-03T10:13:40.672Z", - "update_date": "2019-04-03T10:15:54.149Z" - } - }, - "image_file_68.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z11-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", - "submission_date": "2019-04-03T10:13:40.681Z", - "update_date": "2019-04-03T10:15:54.166Z" - } - }, - "image_file_69.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "be9d12b6-f8dd-407c-b1d7-844deb6a5023", - "submission_date": "2019-04-03T10:13:40.689Z", - "update_date": "2019-04-03T10:15:54.168Z" - } - }, - "image_file_70.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e3e59792-61e3-4bf0-a985-2acec75acafd", - "submission_date": "2019-04-03T10:13:40.698Z", - "update_date": "2019-04-03T10:15:57.350Z" - } - }, - "image_file_71.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "095ee09c-1605-4c07-9324-b5382f20b78e", - "submission_date": "2019-04-03T10:13:40.707Z", - "update_date": "2019-04-03T10:15:51.023Z" - } - }, - "image_file_72.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "77b96424-accb-4c6b-884c-756f2bb40929", - "submission_date": "2019-04-03T10:13:40.715Z", - "update_date": "2019-04-03T10:15:54.145Z" - } - }, - "image_file_73.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", - "submission_date": "2019-04-03T10:13:40.724Z", - "update_date": "2019-04-03T10:15:57.414Z" - } - }, - "image_file_74.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "78518dc1-d38e-4230-88b8-887bdd83f965", - "submission_date": "2019-04-03T10:13:40.733Z", - "update_date": "2019-04-03T10:15:54.195Z" - } - }, - "image_file_75.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "652dd3c5-6467-41ee-89b3-e4b3361fb533", - "submission_date": "2019-04-03T10:13:40.741Z", - "update_date": "2019-04-03T10:15:54.138Z" - } - }, - "image_file_76.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cae3d214-d485-4350-8cd2-f4142aca4aef", - "submission_date": "2019-04-03T10:13:40.749Z", - "update_date": "2019-04-03T10:15:54.152Z" - } - }, - "image_file_77.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", - "submission_date": "2019-04-03T10:13:40.758Z", - "update_date": "2019-04-03T10:15:54.144Z" - } - }, - "image_file_78.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "de282263-0944-48d4-9819-6182636c76bd", - "submission_date": "2019-04-03T10:13:40.766Z", - "update_date": "2019-04-03T10:15:50.968Z" - } - }, - "image_file_79.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bfdbe9b5-42ac-419a-b297-843095de2cc2", - "submission_date": "2019-04-03T10:13:40.775Z", - "update_date": "2019-04-03T10:15:57.263Z" - } - }, - "image_file_80.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z12-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", - "submission_date": "2019-04-03T10:13:40.783Z", - "update_date": "2019-04-03T10:15:57.144Z" - } - }, - "image_file_81.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e2763cda-3236-487e-9944-5169c0cb8856", - "submission_date": "2019-04-03T10:13:40.792Z", - "update_date": "2019-04-03T10:15:57.230Z" - } - }, - "image_file_82.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "37018bd8-8537-47c3-a5a9-efb43552f30c", - "submission_date": "2019-04-03T10:13:40.801Z", - "update_date": "2019-04-03T10:15:57.364Z" - } - }, - "image_file_83.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a6c9b1ce-2054-4a48-b262-bb0723b8a567", - "submission_date": "2019-04-03T10:13:40.809Z", - "update_date": "2019-04-03T10:15:57.302Z" - } - }, - "image_file_84.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8319ee38-f199-49d7-989a-25b451656b38", - "submission_date": "2019-04-03T10:13:40.818Z", - "update_date": "2019-04-03T10:15:54.124Z" - } - }, - "image_file_85.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "022841b6-8b7c-4d0c-b65f-06ba14253540", - "submission_date": "2019-04-03T10:13:40.826Z", - "update_date": "2019-04-03T10:15:54.250Z" - } - }, - "image_file_86.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "299dfbe5-05f5-48a7-816b-61036f0e435a", - "submission_date": "2019-04-03T10:13:40.835Z", - "update_date": "2019-04-03T10:15:54.232Z" - } - }, - "image_file_87.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6b8b11aa-3600-4a63-a980-93465e681c9c", - "submission_date": "2019-04-03T10:13:40.844Z", - "update_date": "2019-04-03T10:15:50.951Z" - } - }, - "image_file_88.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "35716168-df43-4273-b52f-72e3d18a47bc", - "submission_date": "2019-04-03T10:13:40.853Z", - "update_date": "2019-04-03T10:15:57.202Z" - } - }, - "image_file_89.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6be783ec-c132-4e09-90e0-0958efaf6619", - "submission_date": "2019-04-03T10:13:40.862Z", - "update_date": "2019-04-03T10:15:57.305Z" - } - }, - "image_file_90.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a11956c9-c24e-4efb-8af8-1167b3081e70", - "submission_date": "2019-04-03T10:13:40.871Z", - "update_date": "2019-04-03T10:15:57.283Z" - } - }, - "image_file_91.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", - "submission_date": "2019-04-03T10:13:40.880Z", - "update_date": "2019-04-03T10:15:51.102Z" - } - }, - "image_file_92.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z13-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "753c2a57-b5f1-4984-b874-b2b10d582847", - "submission_date": "2019-04-03T10:13:40.889Z", - "update_date": "2019-04-03T10:16:00.454Z" - } - }, - "image_file_93.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e0b93b3d-075b-482b-838a-e36d8849607b", - "submission_date": "2019-04-03T10:13:40.899Z", - "update_date": "2019-04-03T10:15:57.655Z" - } - }, - "image_file_94.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", - "submission_date": "2019-04-03T10:13:40.908Z", - "update_date": "2019-04-03T10:15:57.378Z" - } - }, - "image_file_95.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c647964a-7796-4dd2-9fa8-b23f012ac14e", - "submission_date": "2019-04-03T10:13:40.917Z", - "update_date": "2019-04-03T10:15:54.078Z" - } - }, - "image_file_96.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "87a63649-9834-49b8-89a0-310211c1b5b3", - "submission_date": "2019-04-03T10:13:40.926Z", - "update_date": "2019-04-03T10:15:57.378Z" - } - }, - "image_file_97.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b2eb5b20-fd1a-403c-8b55-9eec5972d482", - "submission_date": "2019-04-03T10:13:40.936Z", - "update_date": "2019-04-03T10:15:54.167Z" - } - }, - "image_file_98.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "4b3b36cb-cd90-4526-978d-2e7e8f7add39", - "submission_date": "2019-04-03T10:13:40.953Z", - "update_date": "2019-04-03T10:15:57.225Z" - } - }, - "image_file_99.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cdc774f8-3310-4f1f-8c67-03579c253640", - "submission_date": "2019-04-03T10:13:40.968Z", - "update_date": "2019-04-03T10:15:57.258Z" - } - }, - "image_file_100.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "607370e0-7e7e-4d25-ba5c-957c00a73ac1", - "submission_date": "2019-04-03T10:13:40.979Z", - "update_date": "2019-04-03T10:16:00.280Z" - } - }, - "image_file_101.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3240d7ab-568b-4be5-adba-3178b3e8f85e", - "submission_date": "2019-04-03T10:13:40.990Z", - "update_date": "2019-04-03T10:16:00.280Z" - } - }, - "image_file_102.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c0b6ee98-677a-41d9-9d80-9ac63d251b08", - "submission_date": "2019-04-03T10:13:41.002Z", - "update_date": "2019-04-03T10:15:57.303Z" - } - }, - "image_file_103.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f34c01ec-06df-49e6-bc2f-c50c7f398851", - "submission_date": "2019-04-03T10:13:41.020Z", - "update_date": "2019-04-03T10:16:00.436Z" - } - }, - "image_file_104.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z14-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2047311b-f3ee-4137-8338-a45166e01d53", - "submission_date": "2019-04-03T10:13:41.032Z", - "update_date": "2019-04-03T10:15:50.968Z" - } - }, - "image_file_105.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "44ea335a-1991-4504-be12-04f1a332ddfb", - "submission_date": "2019-04-03T10:13:41.044Z", - "update_date": "2019-04-03T10:16:00.403Z" - } - }, - "image_file_106.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", - "submission_date": "2019-04-03T10:13:41.054Z", - "update_date": "2019-04-03T10:15:54.147Z" - } - }, - "image_file_107.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", - "submission_date": "2019-04-03T10:13:41.065Z", - "update_date": "2019-04-03T10:16:00.681Z" - } - }, - "image_file_108.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6af3cb41-9e64-4b11-b272-be87adf0fa94", - "submission_date": "2019-04-03T10:13:41.076Z", - "update_date": "2019-04-03T10:15:57.097Z" - } - }, - "image_file_109.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7541d176-dfba-4e05-ba45-0c6964271dff", - "submission_date": "2019-04-03T10:13:41.087Z", - "update_date": "2019-04-03T10:15:57.397Z" - } - }, - "image_file_110.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8ee1e829-a507-40a5-87ac-7fd8379b87ce", - "submission_date": "2019-04-03T10:13:41.097Z", - "update_date": "2019-04-03T10:15:57.618Z" - } - }, - "image_file_111.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8e57554a-abb2-4664-87b6-a397f4da6555", - "submission_date": "2019-04-03T10:13:41.107Z", - "update_date": "2019-04-03T10:16:00.218Z" - } - }, - "image_file_112.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", - "submission_date": "2019-04-03T10:13:41.117Z", - "update_date": "2019-04-03T10:15:57.372Z" - } - }, - "image_file_113.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", - "submission_date": "2019-04-03T10:13:41.127Z", - "update_date": "2019-04-03T10:15:57.219Z" - } - }, - "image_file_114.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", - "submission_date": "2019-04-03T10:13:41.136Z", - "update_date": "2019-04-03T10:16:00.319Z" - } - }, - "image_file_115.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", - "submission_date": "2019-04-03T10:13:41.146Z", - "update_date": "2019-04-03T10:16:00.829Z" - } - }, - "image_file_116.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z15-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f0cb4244-e19a-46a0-89f1-04143548872d", - "submission_date": "2019-04-03T10:13:41.156Z", - "update_date": "2019-04-03T10:16:00.414Z" - } - }, - "image_file_117.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "73074f55-d009-41a2-929e-6fd9949bb1dd", - "submission_date": "2019-04-03T10:13:41.166Z", - "update_date": "2019-04-03T10:15:57.285Z" - } - }, - "image_file_118.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", - "submission_date": "2019-04-03T10:13:41.176Z", - "update_date": "2019-04-03T10:16:03.247Z" - } - }, - "image_file_119.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", - "submission_date": "2019-04-03T10:13:41.185Z", - "update_date": "2019-04-03T10:15:51.101Z" - } - }, - "image_file_120.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "146231bb-1b13-4db5-8157-9d9962cc3a3a", - "submission_date": "2019-04-03T10:13:41.195Z", - "update_date": "2019-04-03T10:16:00.042Z" - } - }, - "image_file_121.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", - "submission_date": "2019-04-03T10:13:41.205Z", - "update_date": "2019-04-03T10:15:57.650Z" - } - }, - "image_file_122.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7fe17380-3090-4fc3-9504-02b3f8ed95b6", - "submission_date": "2019-04-03T10:13:41.215Z", - "update_date": "2019-04-03T10:16:00.270Z" - } - }, - "image_file_123.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "fc405b01-60ca-436f-a06c-2f38f7156a87", - "submission_date": "2019-04-03T10:13:41.225Z", - "update_date": "2019-04-03T10:16:00.160Z" - } - }, - "image_file_124.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bae92b53-c6c7-4712-865e-6cff3cba506e", - "submission_date": "2019-04-03T10:13:41.235Z", - "update_date": "2019-04-03T10:16:00.763Z" - } - }, - "image_file_125.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "83662ec5-a202-42ab-9a47-a701d4f19de3", - "submission_date": "2019-04-03T10:13:41.246Z", - "update_date": "2019-04-03T10:16:00.067Z" - } - }, - "image_file_126.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "a04957c6-8ce8-4fa6-950d-71812ff3d698", - "submission_date": "2019-04-03T10:13:41.256Z", - "update_date": "2019-04-03T10:15:57.271Z" - } - }, - "image_file_127.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9284d3a4-73bd-4aa0-847c-ab273d14185a", - "submission_date": "2019-04-03T10:13:41.266Z", - "update_date": "2019-04-03T10:16:00.765Z" - } - }, - "image_file_128.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z16-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "4d664562-c333-4aaf-bb8b-641e0568733e", - "submission_date": "2019-04-03T10:13:41.276Z", - "update_date": "2019-04-03T10:16:00.166Z" - } - }, - "image_file_129.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b533685d-3c60-4483-841b-a054f0a69fec", - "submission_date": "2019-04-03T10:13:41.286Z", - "update_date": "2019-04-03T10:15:54.188Z" - } - }, - "image_file_130.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", - "submission_date": "2019-04-03T10:13:41.296Z", - "update_date": "2019-04-03T10:15:57.291Z" - } - }, - "image_file_131.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", - "submission_date": "2019-04-03T10:13:41.305Z", - "update_date": "2019-04-03T10:16:00.394Z" - } - }, - "image_file_132.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3e8510c9-7e31-49bd-bb90-cb55577c2f25", - "submission_date": "2019-04-03T10:13:41.315Z", - "update_date": "2019-04-03T10:16:00.298Z" - } - }, - "image_file_133.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "463aff9a-ec7e-40d0-be42-c6686af9130d", - "submission_date": "2019-04-03T10:13:41.325Z", - "update_date": "2019-04-03T10:16:00.374Z" - } - }, - "image_file_134.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", - "submission_date": "2019-04-03T10:13:41.334Z", - "update_date": "2019-04-03T10:16:00.331Z" - } - }, - "image_file_135.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "868efb99-df36-462b-91a2-bb6ca27e842a", - "submission_date": "2019-04-03T10:13:41.344Z", - "update_date": "2019-04-03T10:15:57.472Z" - } - }, - "image_file_136.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", - "submission_date": "2019-04-03T10:13:41.354Z", - "update_date": "2019-04-03T10:15:57.134Z" - } - }, - "image_file_137.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "36ded48a-869f-4fa8-971f-56bc28298276", - "submission_date": "2019-04-03T10:13:41.363Z", - "update_date": "2019-04-03T10:16:00.039Z" - } - }, - "image_file_138.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", - "submission_date": "2019-04-03T10:13:41.373Z", - "update_date": "2019-04-03T10:15:57.347Z" - } - }, - "image_file_139.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e72742a4-23ba-4e5d-a29b-ad449abe8101", - "submission_date": "2019-04-03T10:13:41.382Z", - "update_date": "2019-04-03T10:15:57.374Z" - } - }, - "image_file_140.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z2-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cd6e1096-f8c3-4eda-957d-b09741d60901", - "submission_date": "2019-04-03T10:13:41.392Z", - "update_date": "2019-04-03T10:16:00.117Z" - } - }, - "image_file_141.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "903ea376-5153-4fb8-8ffa-e2948951409c", - "submission_date": "2019-04-03T10:13:41.401Z", - "update_date": "2019-04-03T10:15:57.150Z" - } - }, - "image_file_142.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", - "submission_date": "2019-04-03T10:13:41.411Z", - "update_date": "2019-04-03T10:16:00.258Z" - } - }, - "image_file_143.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8381d167-c4dd-49a2-b5df-1ae815bbe42e", - "submission_date": "2019-04-03T10:13:41.421Z", - "update_date": "2019-04-03T10:15:57.334Z" - } - }, - "image_file_144.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", - "submission_date": "2019-04-03T10:13:41.430Z", - "update_date": "2019-04-03T10:15:57.150Z" - } - }, - "image_file_145.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cf305c60-bb2c-41af-82bf-0631c2a7b0be", - "submission_date": "2019-04-03T10:13:41.440Z", - "update_date": "2019-04-03T10:15:57.290Z" - } - }, - "image_file_146.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "074290a9-35e1-422f-a3af-e5ed58781b4d", - "submission_date": "2019-04-03T10:13:41.450Z", - "update_date": "2019-04-03T10:15:57.347Z" - } - }, - "image_file_147.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", - "submission_date": "2019-04-03T10:13:41.460Z", - "update_date": "2019-04-03T10:16:00.451Z" - } - }, - "image_file_148.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", - "submission_date": "2019-04-03T10:13:41.470Z", - "update_date": "2019-04-03T10:16:03.144Z" - } - }, - "image_file_149.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "5165cc56-ff89-42bf-b000-fec4bd57176e", - "submission_date": "2019-04-03T10:13:41.479Z", - "update_date": "2019-04-03T10:16:00.708Z" - } - }, - "image_file_150.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "545be634-5893-45e0-93b2-dd4ea93e00db", - "submission_date": "2019-04-03T10:13:41.489Z", - "update_date": "2019-04-03T10:16:00.405Z" - } - }, - "image_file_151.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2d2e58c6-7c24-4089-bbe9-d47b7482be46", - "submission_date": "2019-04-03T10:13:41.499Z", - "update_date": "2019-04-03T10:16:00.253Z" - } - }, - "image_file_152.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z3-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", - "submission_date": "2019-04-03T10:13:41.509Z", - "update_date": "2019-04-03T10:15:57.292Z" - } - }, - "image_file_153.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "81214e49-318f-4221-bf2c-4ef00cfa916b", - "submission_date": "2019-04-03T10:13:41.519Z", - "update_date": "2019-04-03T10:16:00.761Z" - } - }, - "image_file_154.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7fc97754-1121-468b-b1e4-839bde86b6c8", - "submission_date": "2019-04-03T10:13:41.529Z", - "update_date": "2019-04-03T10:15:57.316Z" - } - }, - "image_file_155.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7d70d44c-b5d7-47be-9687-e9a775e86251", - "submission_date": "2019-04-03T10:13:41.539Z", - "update_date": "2019-04-03T10:16:00.785Z" - } - }, - "image_file_156.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", - "submission_date": "2019-04-03T10:13:41.552Z", - "update_date": "2019-04-03T10:15:57.619Z" - } - }, - "image_file_157.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b7607809-e975-4c32-bff7-375cb2d8276f", - "submission_date": "2019-04-03T10:13:41.564Z", - "update_date": "2019-04-03T10:15:57.213Z" - } - }, - "image_file_158.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b8a6c863-626d-4fbf-863b-610cffaac37d", - "submission_date": "2019-04-03T10:13:41.579Z", - "update_date": "2019-04-03T10:16:00.707Z" - } - }, - "image_file_159.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "45077a5c-ee96-47c0-a84f-9d46cf799338", - "submission_date": "2019-04-03T10:13:41.590Z", - "update_date": "2019-04-03T10:15:57.619Z" - } - }, - "image_file_160.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "49d82b74-6f1a-415c-93ab-958c60f083b6", - "submission_date": "2019-04-03T10:13:41.601Z", - "update_date": "2019-04-03T10:15:57.323Z" - } - }, - "image_file_161.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "753b51b7-a909-44e7-bb21-cf2cd18328f8", - "submission_date": "2019-04-03T10:13:41.612Z", - "update_date": "2019-04-03T10:16:00.722Z" - } - }, - "image_file_162.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c7ab6349-b2bb-4ba3-9c9b-27d270550052", - "submission_date": "2019-04-03T10:13:41.624Z", - "update_date": "2019-04-03T10:16:00.390Z" - } - }, - "image_file_163.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7be770fc-4a56-4f82-a4cf-3cf908d54dca", - "submission_date": "2019-04-03T10:13:41.635Z", - "update_date": "2019-04-03T10:16:00.789Z" - } - }, - "image_file_164.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z4-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3f5f8537-c1af-4d2e-a732-53b6d4275588", - "submission_date": "2019-04-03T10:13:41.646Z", - "update_date": "2019-04-03T10:16:00.749Z" - } - }, - "image_file_165.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", - "submission_date": "2019-04-03T10:13:41.657Z", - "update_date": "2019-04-03T10:15:57.145Z" - } - }, - "image_file_166.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f986c2c2-2823-45a0-80cf-5e6f67958afb", - "submission_date": "2019-04-03T10:13:41.668Z", - "update_date": "2019-04-03T10:16:00.833Z" - } - }, - "image_file_167.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7d17d6d6-d038-40c6-b965-6de41ce9c931", - "submission_date": "2019-04-03T10:13:41.680Z", - "update_date": "2019-04-03T10:15:57.652Z" - } - }, - "image_file_168.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3d208b38-62c8-492d-9434-21bb66ead16e", - "submission_date": "2019-04-03T10:13:41.692Z", - "update_date": "2019-04-03T10:16:03.214Z" - } - }, - "image_file_169.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9a982898-77c6-4a56-8e54-9cb83ff0b235", - "submission_date": "2019-04-03T10:13:41.704Z", - "update_date": "2019-04-03T10:16:03.249Z" - } - }, - "image_file_170.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", - "submission_date": "2019-04-03T10:13:41.715Z", - "update_date": "2019-04-03T10:16:00.293Z" - } - }, - "image_file_171.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "24b6366f-03ce-4e4d-b50f-90687f3e2b94", - "submission_date": "2019-04-03T10:13:41.726Z", - "update_date": "2019-04-03T10:16:00.295Z" - } - }, - "image_file_172.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ec1d0987-fb49-48b8-aaeb-321c659fb67f", - "submission_date": "2019-04-03T10:13:41.736Z", - "update_date": "2019-04-03T10:16:03.247Z" - } - }, - "image_file_173.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", - "submission_date": "2019-04-03T10:13:41.746Z", - "update_date": "2019-04-03T10:16:03.243Z" - } - }, - "image_file_174.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6fbcb1c7-ce98-46db-8054-b451b6bca205", - "submission_date": "2019-04-03T10:13:41.756Z", - "update_date": "2019-04-03T10:16:03.126Z" - } - }, - "image_file_175.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", - "submission_date": "2019-04-03T10:13:41.766Z", - "update_date": "2019-04-03T10:16:00.740Z" - } - }, - "image_file_176.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z5-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "aa6fca0d-6a70-4016-a0e4-307878e9ff45", - "submission_date": "2019-04-03T10:13:41.776Z", - "update_date": "2019-04-03T10:16:00.704Z" - } - }, - "image_file_177.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ee62cd8d-fb93-4082-980b-213c7a8a0c47", - "submission_date": "2019-04-03T10:13:41.785Z", - "update_date": "2019-04-03T10:16:03.200Z" - } - }, - "image_file_178.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bbd60a79-3572-42c0-8e53-b0c566a72f06", - "submission_date": "2019-04-03T10:13:41.795Z", - "update_date": "2019-04-03T10:16:00.196Z" - } - }, - "image_file_179.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", - "submission_date": "2019-04-03T10:13:41.805Z", - "update_date": "2019-04-03T10:16:03.144Z" - } - }, - "image_file_180.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", - "submission_date": "2019-04-03T10:13:41.816Z", - "update_date": "2019-04-03T10:16:00.186Z" - } - }, - "image_file_181.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "240a67cc-e827-41bf-8ac8-a66bc2797f13", - "submission_date": "2019-04-03T10:13:41.827Z", - "update_date": "2019-04-03T10:16:00.772Z" - } - }, - "image_file_182.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7a9b6534-fa1d-4282-a064-11e60e57a322", - "submission_date": "2019-04-03T10:13:41.838Z", - "update_date": "2019-04-03T10:15:57.638Z" - } - }, - "image_file_183.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "b0af6371-4379-45f0-8c09-f6610833fc46", - "submission_date": "2019-04-03T10:13:41.848Z", - "update_date": "2019-04-03T10:15:57.644Z" - } - }, - "image_file_184.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f5ce7a96-cfc0-42c4-852b-386f9a27111d", - "submission_date": "2019-04-03T10:13:41.859Z", - "update_date": "2019-04-03T10:16:00.829Z" - } - }, - "image_file_185.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", - "submission_date": "2019-04-03T10:13:41.869Z", - "update_date": "2019-04-03T10:16:00.329Z" - } - }, - "image_file_186.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3dff4add-7d6f-418c-afba-e46864af51d2", - "submission_date": "2019-04-03T10:13:41.880Z", - "update_date": "2019-04-03T10:16:00.156Z" - } - }, - "image_file_187.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ab2b7c67-8f13-4388-acd7-e2abb0091f30", - "submission_date": "2019-04-03T10:13:41.895Z", - "update_date": "2019-04-03T10:16:00.743Z" - } - }, - "image_file_188.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z6-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "d9912d93-3d92-48d2-9f75-826fbba3d94e", - "submission_date": "2019-04-03T10:13:41.907Z", - "update_date": "2019-04-03T10:16:03.046Z" - } - }, - "image_file_189.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "8b37aba2-be5e-4963-8e6f-51a2df8e143e", - "submission_date": "2019-04-03T10:13:41.917Z", - "update_date": "2019-04-03T10:16:00.282Z" - } - }, - "image_file_190.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", - "submission_date": "2019-04-03T10:13:41.927Z", - "update_date": "2019-04-03T10:16:00.805Z" - } - }, - "image_file_191.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "2d7e88dd-bddd-4289-9556-27d301be0b83", - "submission_date": "2019-04-03T10:13:41.937Z", - "update_date": "2019-04-03T10:16:03.188Z" - } - }, - "image_file_192.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", - "submission_date": "2019-04-03T10:13:41.947Z", - "update_date": "2019-04-03T10:16:03.221Z" - } - }, - "image_file_193.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", - "submission_date": "2019-04-03T10:13:41.958Z", - "update_date": "2019-04-03T10:16:00.822Z" - } - }, - "image_file_194.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", - "submission_date": "2019-04-03T10:13:41.969Z", - "update_date": "2019-04-03T10:16:03.130Z" - } - }, - "image_file_195.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e834d3df-8432-40ba-b67d-c7cd0bd7328d", - "submission_date": "2019-04-03T10:13:41.979Z", - "update_date": "2019-04-03T10:16:03.234Z" - } - }, - "image_file_196.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "d8908d6d-5daa-454d-9082-726054cfddc1", - "submission_date": "2019-04-03T10:13:41.990Z", - "update_date": "2019-04-03T10:16:03.189Z" - } - }, - "image_file_197.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c5a7142e-4702-4e84-b7aa-239df2a71ba8", - "submission_date": "2019-04-03T10:13:42.000Z", - "update_date": "2019-04-03T10:16:00.189Z" - } - }, - "image_file_198.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "f69e44ef-cf23-4571-8dad-e44222697974", - "submission_date": "2019-04-03T10:13:42.011Z", - "update_date": "2019-04-03T10:16:03.186Z" - } - }, - "image_file_199.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "ea72f81c-2c58-43e2-acca-294254f470f7", - "submission_date": "2019-04-03T10:13:42.021Z", - "update_date": "2019-04-03T10:16:03.138Z" - } - }, - "image_file_200.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z7-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", - "submission_date": "2019-04-03T10:13:42.031Z", - "update_date": "2019-04-03T10:16:03.194Z" - } - }, - "image_file_201.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6928ac1b-fd1d-436c-bfc6-4087c65809d7", - "submission_date": "2019-04-03T10:13:42.042Z", - "update_date": "2019-04-03T10:16:03.234Z" - } - }, - "image_file_202.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "07a7b938-435b-4804-b140-c255957b6532", - "submission_date": "2019-04-03T10:13:42.052Z", - "update_date": "2019-04-03T10:16:03.185Z" - } - }, - "image_file_203.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3d532a7b-55e7-4461-afbc-65ef76403384", - "submission_date": "2019-04-03T10:13:42.062Z", - "update_date": "2019-04-03T10:16:00.225Z" - } - }, - "image_file_204.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bab40245-28bd-49a2-8be0-ba109fe41c91", - "submission_date": "2019-04-03T10:13:42.072Z", - "update_date": "2019-04-03T10:16:03.171Z" - } - }, - "image_file_205.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9d577bd4-3a27-48be-ad7c-8c44cf803cda", - "submission_date": "2019-04-03T10:13:42.082Z", - "update_date": "2019-04-03T10:16:03.221Z" - } - }, - "image_file_206.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", - "submission_date": "2019-04-03T10:13:42.093Z", - "update_date": "2019-04-03T10:16:03.221Z" - } - }, - "image_file_207.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "21a043b6-6dde-41b9-b20e-74b961da8b88", - "submission_date": "2019-04-03T10:13:42.104Z", - "update_date": "2019-04-03T10:16:03.210Z" - } - }, - "image_file_208.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "11280200-1803-4110-aa84-2808776c2d50", - "submission_date": "2019-04-03T10:13:42.114Z", - "update_date": "2019-04-03T10:16:03.231Z" - } - }, - "image_file_209.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "86df5269-576b-4d18-a0ce-6e2b2a36d51b", - "submission_date": "2019-04-03T10:13:42.124Z", - "update_date": "2019-04-03T10:16:03.201Z" - } - }, - "image_file_210.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e524ff4e-95fa-4561-bfd3-276cba79e664", - "submission_date": "2019-04-03T10:13:42.134Z", - "update_date": "2019-04-03T10:16:03.251Z" - } - }, - "image_file_211.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "3d5737da-b1ab-48cb-a26f-d420e53edccd", - "submission_date": "2019-04-03T10:13:42.144Z", - "update_date": "2019-04-03T10:16:03.057Z" - } - }, - "image_file_212.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z8-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "44cf15ec-3d4e-4698-bb14-107c34891191", - "submission_date": "2019-04-03T10:13:42.154Z", - "update_date": "2019-04-03T10:16:03.206Z" - } - }, - "image_file_213.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H0-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "6242cdf3-fd6d-4479-a08a-1747818fd978", - "submission_date": "2019-04-03T10:13:42.164Z", - "update_date": "2019-04-03T10:16:03.054Z" - } - }, - "image_file_214.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H0-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "bc60bbd4-8b09-425c-b507-9da24a84f412", - "submission_date": "2019-04-03T10:13:42.174Z", - "update_date": "2019-04-03T10:16:00.270Z" - } - }, - "image_file_215.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H0-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", - "submission_date": "2019-04-03T10:13:42.184Z", - "update_date": "2019-04-03T10:16:03.187Z" - } - }, - "image_file_216.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H0-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", - "submission_date": "2019-04-03T10:13:42.195Z", - "update_date": "2019-04-03T10:16:03.267Z" - } - }, - "image_file_217.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H1-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "5f67c32c-a154-4620-8603-0b64979b04a4", - "submission_date": "2019-04-03T10:13:42.207Z", - "update_date": "2019-04-03T10:16:03.116Z" - } - }, - "image_file_218.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H1-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", - "submission_date": "2019-04-03T10:13:42.219Z", - "update_date": "2019-04-03T10:16:00.148Z" - } - }, - "image_file_219.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H1-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "dcee6df0-9e87-4935-8873-f8d30d449d76", - "submission_date": "2019-04-03T10:13:42.230Z", - "update_date": "2019-04-03T10:16:03.250Z" - } - }, - "image_file_220.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H1-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", - "submission_date": "2019-04-03T10:13:42.242Z", - "update_date": "2019-04-03T10:16:03.126Z" - } - }, - "image_file_221.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H2-C0.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e6d00b0c-3641-4ec4-a553-8fd742193dba", - "submission_date": "2019-04-03T10:13:42.254Z", - "update_date": "2019-04-03T10:16:03.321Z" - } - }, - "image_file_222.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H2-C1.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "e5034863-0528-4f55-be95-c8501c29f9fe", - "submission_date": "2019-04-03T10:13:42.272Z", - "update_date": "2019-04-03T10:16:03.187Z" - } - }, - "image_file_223.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H2-C2.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", - "submission_date": "2019-04-03T10:13:42.284Z", - "update_date": "2019-04-03T10:16:03.190Z" - } - }, - "image_file_224.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000-Z9-H2-C3.tiff", - "file_format": "tiff" - }, - "provenance": { - "document_id": "33d332c9-aefe-4db5-8830-b8daddaed0d2", - "submission_date": "2019-04-03T10:13:42.295Z", - "update_date": "2019-04-03T10:16:03.189Z" - } - }, - "image_file_225.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image-fov_000.json", - "file_format": "json" - }, - "provenance": { - "document_id": "bb3b6fc7-0902-432d-bad1-6b3f61951314", - "submission_date": "2019-04-03T10:13:42.306Z", - "update_date": "2019-04-03T10:15:51.086Z" - } - }, - "image_file_226.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/file/1.0.4/image_file", - "schema_type": "file", - "file_core": { - "file_name": "primary_image.json", - "file_format": "json" - }, - "provenance": { - "document_id": "2b734e88-3a33-4c73-92bb-82e0b8f8c13b", - "submission_date": "2019-04-03T10:13:42.318Z", - "update_date": "2019-04-03T10:16:00.280Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/project/11.0.1/project", - "schema_type": "project", - "project_core": { - "project_short_name": "barista_seq", - "project_title": "1 FOV BaristaSeq mouse SpaceTx dataset", - "project_description": "1 FOV BaristaSeq mouse SpaceTx dataset" - }, - "supplementary_links": [ - "https://github.com/spacetx" - ], - "funders": [ - { - "grant_title": "grant", - "grant_id": "1", - "organization": "funder" - } - ], - "provenance": { - "document_id": "ae5237b4-633f-403a-afc6-cb87e6f90db1", - "submission_date": "2019-04-03T10:13:39.976Z", - "update_date": "2019-04-03T10:13:45.439Z" - } - }, - "imaging_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/imaging/11.0.12/imaging_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "zador_singlerolseq_1" - }, - "microscope_setup_description": "PerkinElmer Ultraview Vox Spinning disk (Nikon Ti-E, Yokogawa CSU-X1, Hamamatsu orca-R2, ASI MS-2000 xyz stage, Nikon Plan Apo 10x 0.45 and Nikon Plan Apo 20x 0.75)", - "microscopy_technique": { - "text": "spinning disk confocal" - }, - "magnification": "20x", - "numerical_aperture": 0.75, - "immersion_medium_type": "air", - "immersion_medium_refractive_index": 1.0, - "pixel_size": 322.5, - "number_of_tiles": 25, - "tile_size_y": 433.0, - "tile_size_x": 330.0, - "z_stack_step_size": 3000.0, - "number_of_z_steps": 17, - "overlapping_tiles": "yes", - "target": [ - { - "molecule_name": "Ank1", - "molecule_id": "NM_001277289", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggcccacactcattccagagaaggatcaccaccatccaaggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ank1", - "molecule_id": "NM_001277289", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggactgggataaacagggttccacagcggtacacccgcaagaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ank1", - "molecule_id": "NM_001277289", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agcagcgagttcacgcccgaatcacagactcaccctcagtgag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnmb2", - "molecule_id": "NM_028231", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gtgggagacaaagctggtgagatcactcccagtaaactgactgg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnmb2", - "molecule_id": "NM_028231", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cctgaccaaactctacagctccaatgtgctgttccattctctct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnmb2", - "molecule_id": "NM_028231", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttcagctgtgggcccgactgttggaagctctctcagtacccttg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ankrd55", - "molecule_id": "NM_001168404", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agggcccgtccattatcaactacgacgacgagagtgggaaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ankrd55", - "molecule_id": "NM_001168404", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgcagagcctgatgtgaggctcctcatagtcctgctgcagca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ankrd55", - "molecule_id": "NM_001168404", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgtgtgagtctgctcagaaacggtgccaagcacaacatcccag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc32a1", - "molecule_id": "NM_009508", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tcttcacgctgctcatggccatctacgtgccacacttcgcgct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc32a1", - "molecule_id": "NM_009508", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tatccgttgcccttcttcgcggccgtcgaagtgctggagaagt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc32a1", - "molecule_id": "NM_009508", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tcaacatcctggtcatcgcttactgtctctctcgcgcgcgtgatt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Btbd11", - "molecule_id": "NM_001017525", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgagatcatggagcttctgtctgctgctaaatttttccagctggag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Btbd11", - "molecule_id": "NM_001017525", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cgtgaagtatcccatcttccagctcgtcatgcagtatctctactac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Btbd11", - "molecule_id": "NM_001017525", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcttgttcacagcctctcccaggttcaaggccctcctctcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arx", - "molecule_id": "NM_001305940", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agcattttggcgctctatgttgatttaagcgcggcccggctaaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arx", - "molecule_id": "NM_001305940", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caaggcagttcttggcgctaaaggatgtggcacctcctccact", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arx", - "molecule_id": "NM_001305940", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atggaaacagaggaccagctcactcccaagaaggcacagacag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx1", - "molecule_id": "NM_010053", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgtaaacatgttgcacaagcttagcctctttccgttctgttgtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx1", - "molecule_id": "NM_010053", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "taagacacaagcagcggctcgaccacagaacacaagtcatcaccct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx1", - "molecule_id": "NM_010053", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcacagtaacttttgtacttggctgaaatgcagaaagggaaaac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad2", - "molecule_id": "NM_008078", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaaggtggcgccagtgattaaagccagaatgatggagtatggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad2", - "molecule_id": "NM_008078", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agtgttcagctctcctggttagagaggagggactgatgcagagct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad2", - "molecule_id": "NM_008078", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tactgatgtcccggaaacacaagtggaagctgagtggagtagaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pvalb", - "molecule_id": "NM_013645", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgcttggtactgagtgctcatgtgggccacctcgttcaatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pvalb", - "molecule_id": "NM_013645", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggagaaacaataaaggctgtaccaatcggacaccacctgtaggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pvalb", - "molecule_id": "NM_013645", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcctcagatgccagagacttgtctgctaaagaaacaaagacgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pdgfra", - "molecule_id": "NM_001083316", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgggcaagaggaacagacacagctcacagacttcggaagagag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pdgfra", - "molecule_id": "NM_001083316", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaaaagattcacctggacttcctaaagagtgaccatccggccgt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pdgfra", - "molecule_id": "NM_001083316", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agtgagcccgagaagagaccctccttctaccacctcagcgagata", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph4", - "molecule_id": "NM_183297", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aattgccacgtggaatatgagaagacaaaccgcgctcgcaag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph4", - "molecule_id": "NM_183297", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cacaattcgtccagcctgggtaacctaagcgtcagtatcgtgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph4", - "molecule_id": "NM_183297", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgtgcataccctcaagttctcgctgttggtgaccggcaagatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car3", - "molecule_id": "NM_007606", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cattgtgtggctgctgctcaaagagcccatgactgtgagctc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car3", - "molecule_id": "NM_007606", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "catcatgcctgttccctgcttgccgggactattggacctatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car3", - "molecule_id": "NM_007606", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gggagaaaggcgagttccagattcttcttgatgccctggacaaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a8", - "molecule_id": "NM_001310710", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaactcaaccacgagactttcgtaagtcccagaaagaagatgtct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a8", - "molecule_id": "NM_001310710", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggctttgctatttcaggcttcaatgtcaaccacctggacattgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a8", - "molecule_id": "NM_001310710", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgctcctggtggttggattttcccataccaaaggagtggctatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Syt6", - "molecule_id": "NM_001276679", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cgagacgctgattgtgcgcatcctgaaggcctttgacctccct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Syt6", - "molecule_id": "NM_001276679", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agatgcatgtctccagcgtggactatggcaatgagctgccgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Syt6", - "molecule_id": "NM_001276679", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acaaagctgcagcgacagaccacagagccagcatcctccacca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rspo1", - "molecule_id": "NM_138683", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagaagaggaagctgtgcggtttccggaagggatcggaagag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rspo1", - "molecule_id": "NM_138683", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gtgtcaggagggcttgtacttacacaagggccgctgctatcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rspo1", - "molecule_id": "NM_138683", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cccaagctcttcattctgctggagaggaacgacatccgccaggt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fam84b", - "molecule_id": "NM_001162926", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcctggaggacttgatcatggagaagcggcgcaacgaccagat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fam84b", - "molecule_id": "NM_001162926", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aacgatctgtatcgctacaagccactgagccctagcgctgtagt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fam84b", - "molecule_id": "NM_001162926", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aacaagtgcagtccgggtgacctggtggagtttgtatcgcaggc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Deptor", - "molecule_id": "NM_001037937", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcaggagacgcatgacagtcccttctgtctgaggaagcagag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Deptor", - "molecule_id": "NM_001037937", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcaacctcctctaccagttcagaatgaacttccgtcggaggcgga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Deptor", - "molecule_id": "NM_001037937", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagaggcagagcagctttgccaccggcttatggaccatgggatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ndnf", - "molecule_id": "NM_172399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caccagaaagaaatcagagaaggtcctttgcaaatacttccacag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ndnf", - "molecule_id": "NM_172399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agcttttgacaagctacgtacctgctcttcagttacggtggcat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ndnf", - "molecule_id": "NM_172399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aggcaacaggaaaggagcatcaaagctgaaaatactggcgacca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chrna2", - "molecule_id": "NM_144803", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagcactagaaggtgtacactacattgctgaccacctgaggtct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chrna2", - "molecule_id": "NM_144803", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tcattggctggagaccaacatggatgctgaagaaagggaggag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chrna2", - "molecule_id": "NM_144803", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgtcttcctgctgctcatcacagaaattatcccatccacctcac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Calb1", - "molecule_id": "NM_009788", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cacccaaagcacctctgtgctgcttctatctggcggaagggat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Calb1", - "molecule_id": "NM_009788", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cgaacagaccttgctcttattctttctgctggagacaactagagtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Calb1", - "molecule_id": "NM_009788", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgcgaggaattcatgaagacttggagaaagtatgatactgaccac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sncg", - "molecule_id": "NM_011430", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gttgcccaagttctctgtccctagcccagtgccacaagtcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sncg", - "molecule_id": "NM_011430", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gagaatgaagaggccaagagtggagaagactagaaggctgccag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sncg", - "molecule_id": "NM_011430", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tggtcagcagcgtcaacacagtggccaacaagaccgtggagga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Th", - "molecule_id": "NM_009377", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gacaagctcaggaactatgcctctcgtatccagcgcccattctc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Th", - "molecule_id": "NM_009377", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgggacacgtacccatgttggctgaccgcacatttgcccagtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Th", - "molecule_id": "NM_009377", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gtttcagtgcacacagtacatccgtcatgcctcctcacctatgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad1", - "molecule_id": "NM_001312900", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgatcgctccaccaaggttctggatttccaccacccacacca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad1", - "molecule_id": "NM_001312900", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tccaagaacctgctttcctgtgaaaacagtgaccagggtgccc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gad1", - "molecule_id": "NM_001312900", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tctgtggcttcttacaaaggaccaatagcctggaagagaagagtcg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a7", - "molecule_id": "NM_182993", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atcgctgactttttgcgcagtcgtcacataatgtccactaccaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a7", - "molecule_id": "NM_182993", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caccctggaggcgcttctttacgtccatgcccgtctatgccat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc17a7", - "molecule_id": "NM_182993", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tatggcagcttcgggatcttttggtacctgttctggttgcttgtct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod1", - "molecule_id": "NM_010894", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gatcctgcgctcaggcaaaagccctgatctggtctccttcgta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod1", - "molecule_id": "NM_010894", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cttgctactccaagacccagaaactgtctaaaatagagacactgcg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod1", - "molecule_id": "NM_010894", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcgcgcctagaacgttttaaattaaggcgcatgaaggccaacg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rorb", - "molecule_id": "NM_146095", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctttgcgaagaatctgtgttccttgcagctgactgaggaagagat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rorb", - "molecule_id": "NM_146095", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccacacctacgaggaaatcaaggcgtatcaaagcaagtccaggga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rorb", - "molecule_id": "NM_146095", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgcacagaacatcattaagtcccatttggagacatgtcagtacac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fezf2", - "molecule_id": "NM_080433", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gctttcaccaaaaagggaactacaagaatcacaagctcacccaca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fezf2", - "molecule_id": "NM_080433", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttcaatcgcagctccacgctcaacacgcacatccgcatccac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fezf2", - "molecule_id": "NM_080433", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agctagaccgtttgtgtgcaaagtctgtggcaaaggcttccg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adarb2", - "molecule_id": "NM_001289530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ataccgacaaaacaggcctctccttagtggcgtgagtcacgca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adarb2", - "molecule_id": "NM_001289530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atcgagcctgtgtacctccacagcatcattgtgggcagcctgca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adarb2", - "molecule_id": "NM_001289530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cagacttgaacagcagcaaacacatcgtcaggaagttccgaggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lamp5", - "molecule_id": "NM_029530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgactttgtcttcagtgaagaacataaatgtccagtggatgagc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lamp5", - "molecule_id": "NM_029530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tttctctggcctccagtgaccctcagaagactgtcaccatgatcct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lamp5", - "molecule_id": "NM_029530", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcagaatgctctttgtaaaggaaagtcacaacacttccaaagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vip", - "molecule_id": "NM_001313969", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gggtcagatttctgccaaaaaataccttgagtcactcattggcaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vip", - "molecule_id": "NM_001313969", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcagaaaatggcacaccctattatgatgtgtcaagaaatgccaggc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vip", - "molecule_id": "NM_001313969", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccttctgtagtgagtaggctggatgacaggatgccgtttgaagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lhx6", - "molecule_id": "NM_001083127", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cgcatccattacgacaccatgatcgagaacctcaagagggcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lhx6", - "molecule_id": "NM_001083127", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctggcatgtttcgcctgcttttcctgcaagcgccagctatcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Lhx6", - "molecule_id": "NM_001083127", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atttggaaccaagtgcgcccggtgcggcagacaaatctatgcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chodl", - "molecule_id": "NM_139134", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggtgcaacatgaagcacaattacatctgcaagtatgaaccagaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chodl", - "molecule_id": "NM_139134", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aatgtgtagtcatgtaccaccaaccaactgccaatcctggccta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Chodl", - "molecule_id": "NM_139134", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaacatcgggtgcctgcccagatctctaccagtggtctgatggaag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fa2h", - "molecule_id": "NM_178086", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tacctgcacttcggctctccacacaagggctcctacctgtacaac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fa2h", - "molecule_id": "NM_178086", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gattgccttcttctatgtgttcctgcggctcattctgcctgaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fa2h", - "molecule_id": "NM_178086", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gccattacctcatcatgttgcattttgtcatgcacggccagcac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly86", - "molecule_id": "NM_010745", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggcttggaagtagtctaccagagctgtgatcccttacaggattttg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly86", - "molecule_id": "NM_010745", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "attctgacttctccgagcagcagtgaccatggcagcgaaaatg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly86", - "molecule_id": "NM_010745", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atggcaaaaggctcttctattctgaactactcctatcccctttg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dcn", - "molecule_id": "NM_007833", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caggtcgtctaccttcacaacaacaacatctccgcagttgggcaaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dcn", - "molecule_id": "NM_007833", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tctcactgaagtgcatctagatggcaacaagatcaccaaggttgat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dcn", - "molecule_id": "NM_007833", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agggactgaagagtctctcatacattcgcatctcagacaccaacat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fgfr3", - "molecule_id": "NM_001163216", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cctcactgtgacatcaaccgacgagtacttggacctctccgt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fgfr3", - "molecule_id": "NM_001163216", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgtacatgatcatgcgggaatgttggcatgcggtgccttcacag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Fgfr3", - "molecule_id": "NM_001163216", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgctggtggagtacgcagccaagggcaatctccgggagttcctt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Map3k7cl", - "molecule_id": "NM_144854", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagctacctatcgttcagacacaccgttgagtgaatgcagaattag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Map3k7cl", - "molecule_id": "NM_144854", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cctttgtgttagcacacagtggtcacatttgccttggccgtgtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Map3k7cl", - "molecule_id": "NM_144854", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gagcctaaatgctttcttgtgaaaatatcagcaggcgtgtgtcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph1", - "molecule_id": "NM_008751", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gattccaagtccttcaactgtcgcattgagtatgagaaggttgac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph1", - "molecule_id": "NM_008751", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tctgggactggctgaggaactccacagatcttcaggagcctcg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nxph1", - "molecule_id": "NM_008751", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gtcggctcctctcacagactttccgtggtaaagaaaatgacac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pcp4", - "molecule_id": "NM_008791", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agaagaaaaaggcaggatcacagtcctagtggtgaagctgcttc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pcp4", - "molecule_id": "NM_008791", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggcagaagaaagtccaagaagaatttgatatcgacatggatgcacc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Pcp4", - "molecule_id": "NM_008791", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tagctgcggagtcaggccaacatgagtgagagacaaagtgccgg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod6", - "molecule_id": "NM_009717", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccaactacaaacttggtggcaggctgcttacagctcaacgcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod6", - "molecule_id": "NM_009717", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttacatctgggcactttctgaaattctgaggattggcaagagacc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Neurod6", - "molecule_id": "NM_009717", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggtcaagttcaggagacaggaagctaatgcgcgcgagaggaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrn1", - "molecule_id": "NM_153529", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "actcacccacactcacaccatgctcccggaaatcgagaggaata", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrn1", - "molecule_id": "NM_153529", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "accgtgtgcacatactgggaggatttccacagctgcacggtc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrn1", - "molecule_id": "NM_153529", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cttttcagactgtttgctcaagctgggcgacagcatggccaacta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrgn", - "molecule_id": "NM_022029", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttctttgtttatgcaaaagcctcctgagcgcctggaggctcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrgn", - "molecule_id": "NM_022029", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcccgctcttctttgtttatgcaaaagcctcctgagcgcctgga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nrgn", - "molecule_id": "NM_022029", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccaagccagacgacgatattcttgacatcccgctggatgatcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptn", - "molecule_id": "NM_008973", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caatgctgactgtcagaaaactgtcaccatctccaagccctgtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptn", - "molecule_id": "NM_008973", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccttcctggcattgattttcatcttggcagctgtggacactgct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptn", - "molecule_id": "NM_008973", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaaggcagccagctagtcagcgaggacctctgcaagccaaaaaatg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cck", - "molecule_id": "NM_031161", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgccgaggactacgaatacccatcgtagtgggccagcgtctt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cck", - "molecule_id": "NM_031161", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tacatccagcaggtccgcaaagctccttctggccgcatgtccgtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cck", - "molecule_id": "NM_031161", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagagcggcgtatgtctgtgcgtggtgatggcagtcctagctgct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Synpr", - "molecule_id": "NM_001163032", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgatgtcagcttgcaagcagccttccaacaagtgcatggctg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Synpr", - "molecule_id": "NM_001163032", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gactttatcgtcactgtagtcttttcattcttgtggctggtgg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Synpr", - "molecule_id": "NM_001163032", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tttctctactccctggctgccacggtcgtgtacattttcttccag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc6a1", - "molecule_id": "NM_178703", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "catcattgtggcgggcgtgtttctcttcagtgctgtgcagatg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc6a1", - "molecule_id": "NM_178703", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgtcaaccggttctatgacaacatccaggagatggttggctcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Slc6a1", - "molecule_id": "NM_178703", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctcttcattgctgccgtgtgcatcgtgtcctacctgattggc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx6", - "molecule_id": "NM_010057", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cacaccaggacaccatgcagagaccacagatgatgtgacttctc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx6", - "molecule_id": "NM_010057", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgtcaccacgatcaccagccctgcctccagtgtgggacgtttct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Dlx6", - "molecule_id": "NM_010057", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccatcgctttcagcagactcaatacctggcccttcccgagaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Atp1a3", - "molecule_id": "NM_001290469", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "actgggatgatcgcactgtcaatgacctagaagacagttatggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Atp1a3", - "molecule_id": "NM_001290469", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cccacgcacagacaaactggtcaacgaaaggctcatcagcatg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Atp1a3", - "molecule_id": "NM_001290469", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cctgagatcacacccttcctgctcttcatcatggctaacatccc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arpp19", - "molecule_id": "NM_021548", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caatgcatctccaccatttgatatgcaataggacactgcctgt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arpp19", - "molecule_id": "NM_021548", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcccactgtaagcacttcacttacattttctaaagcaccgtcttg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Arpp19", - "molecule_id": "NM_021548", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagcaggtagcctctgggaagagctattctgatggttaccaagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cxcl14", - "molecule_id": "NM_019568", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acagcactgttctctgagttaggatgttaggacgatcctgcgcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cxcl14", - "molecule_id": "NM_019568", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aagggaagatgcaggattagatgcaggacacacagccagagcta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cxcl14", - "molecule_id": "NM_019568", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tactgctccgctccaggcttacaaagcttccgctcagagagcct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rab3b", - "molecule_id": "NM_023537", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cttttccaataagtgtgatcccgtcgcttggaatcctgcccaag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rab3b", - "molecule_id": "NM_023537", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gctggtatcaggcccagtgatcaaatgaaagggccaaatagag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rab3b", - "molecule_id": "NM_023537", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aggtaaagggagctctatagggaagcaggctcaggctgtagtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cryab", - "molecule_id": "NM_001289785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaacaggtgtctggccctgagcgcaccattcccatcacccgtgaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cryab", - "molecule_id": "NM_001289785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggcttcatctccagggagttccacaggaagtaccggatccca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cryab", - "molecule_id": "NM_001289785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gatgcgtttggagaaggacagattctctgtgaatctggacgtgaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Penk", - "molecule_id": "NM_001002927", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gctgaaagagctactgggaacgggagacaaccgtgcgaaagac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Penk", - "molecule_id": "NM_001002927", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggtacggaggcttcatgaagaagatggacgagctatatcccatg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Penk", - "molecule_id": "NM_001002927", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acatcgacatgtacaaagacagcagcaaacaggatgagagccac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Crh", - "molecule_id": "NM_205769", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcaagctcacagcaacaggaaactgatggagattatcgggaaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Crh", - "molecule_id": "NM_205769", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cgcccatctctctggatctcaccttccaccttctgcgggaagt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Crh", - "molecule_id": "NM_205769", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaacctgcaggaggcatcctgagagaagtccctctgcagaggca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Caln1", - "molecule_id": "NM_021371", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tccatcccgcaccagcatcttggaatctgcagagagcctggct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Caln1", - "molecule_id": "NM_021371", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gccacctctatccatgacccaattctttcaacccagggaccc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Caln1", - "molecule_id": "NM_021371", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgctttcttttcgtcttggaattccagtagccatccagatagca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip1", - "molecule_id": "NM_027398", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gatcatgtgcaaatggtacttccagacagcacctcttttctaat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip1", - "molecule_id": "NM_027398", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctctatggctcaggagaggcaagttgtgacaaagggtggttagt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip1", - "molecule_id": "NM_027398", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccaaatgtgcaccatcctccgatggcctcccaagccaatgtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gm11549", - "molecule_id": "NR_040411", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aactcagacatccgcctgcctctgcctcctgagtgctgggatta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gm11549", - "molecule_id": "NR_040411", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggctattgtatgtacagttcacaccattctcgtgtgtgtgtgt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Gm11549", - "molecule_id": "NR_040411", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acagcctacgtactggccaagccgagggagaagaaacacttcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ctxn1", - "molecule_id": "NM_183315", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gactcacattggacgctgcctacctataatgcacggtacagtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ctxn1", - "molecule_id": "NM_183315", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agggcgttcggagaagtccagtccttacctaccttagctacccat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ctxn1", - "molecule_id": "NM_183315", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgttcgccttcgtgctctgcctgctcgtggtgttggttctgtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car4", - "molecule_id": "NM_007607", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aacttcctccagtaatggcccacttctggatatctgacctctga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car4", - "molecule_id": "NM_007607", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaaggacaagtttgcagtgctggcatttatgattgaggtaggag", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Car4", - "molecule_id": "NM_007607", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaatgacaacggttcagagcacagtattgatgggagacactttgc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nfib", - "molecule_id": "NM_008687", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atgacatgaactctggtgtgaacctgcagaggtcgctgtcttct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nfib", - "molecule_id": "NM_008687", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gagtatccagaacacccataacccagggaactggagtcaacttcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Nfib", - "molecule_id": "NM_008687", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acaatcaggaagtccaagccacagtgatcctgccaagaatcctc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Id2", - "molecule_id": "NM_010496", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aaggaattgcccaatgtaagcagactttgccttttcacaaaggtgg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Id2", - "molecule_id": "NM_010496", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcggaaggaaaactaaggatgatcgtcttgcccaggtgtcgttct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Id2", - "molecule_id": "NM_010496", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acccgatgagtctgctctacaacatgaacgactgctactccaagc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Igfbp6", - "molecule_id": "NM_008344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcctttgccagtgtctccagatggtcaaggaagcactcagtg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Igfbp6", - "molecule_id": "NM_008344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgggctctatgtgccaaactgtgacctcagaggcttctaccg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Igfbp6", - "molecule_id": "NM_008344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aggagtgtacagggcaaaaactctgaccatgacctgggatgggct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Itpka", - "molecule_id": "NM_146125", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cttcgtgcatgaccattgccatcgtgctggtgtgtggctcatc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Itpka", - "molecule_id": "NM_146125", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gcctacagcagatccgggataccctggagatctctgatttcttt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Itpka", - "molecule_id": "NM_146125", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acgaagccgagagcaagtgacccgtgtctttgaggagttcatgca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptprd", - "molecule_id": "NM_001352630", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccgccttgttaatattatgccatatgaatccacaagggtgtgcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptprd", - "molecule_id": "NM_001352630", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atccatgatgcactgttagaagcagtgacatgtggaaataccgaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ptprd", - "molecule_id": "NM_001352630", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aatcctccagatgcagggccaatggtggtacactgcagtgctggt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sv2b", - "molecule_id": "NM_001109753", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tttggcaacagcgagtctgcgatgatcggctggcaatgcctgtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sv2b", - "molecule_id": "NM_001109753", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gctcatggacagaattggaagactcaagatgattggcggctccat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sv2b", - "molecule_id": "NM_001109753", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ggactttgaagaggacaatgattttctgatttacctcgtcagct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vxn", - "molecule_id": "NM_178399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ctgagcatctgaccctcatgtccaaacatagtctggacacttgg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vxn", - "molecule_id": "NM_178399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acatggcggtaagtcaaacccagacttccaggctcttgcctt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Vxn", - "molecule_id": "NM_178399", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgaactgtttgggtatcaggcttgcttctgctgttctgtggattct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Reln", - "molecule_id": "NM_001310464", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aggagttctactgcgctggtggcagccacgccacaatggaaca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Reln", - "molecule_id": "NM_001310464", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atcacctggcacgtcatcgctcagcaccagccgaaggacttcaca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Reln", - "molecule_id": "NM_001310464", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cactcgagcaagcaaaattatgtttgtcttgcaaattgggagcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rprml", - "molecule_id": "NM_001033212", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aacgaagtacctcgcaccacccgggtctggacaccataggact", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rprml", - "molecule_id": "NM_001033212", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cttgccagagttgaagcaccgcgaggaagagactacggagcct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Rprml", - "molecule_id": "NM_001033212", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tcaagtccgagagcatgatcaactttctgatgcaggagcgcagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cnr1", - "molecule_id": "NM_007726", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gagacatgctttccgcagcatgttcccttcatgtgaaggcact", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cnr1", - "molecule_id": "NM_007726", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgaacaagcttatcaagacggtgtttgccttctgtagtatgctct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cnr1", - "molecule_id": "NM_007726", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atccagcgtggaacccagaaaagcatcatcattcacacctcaga", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cacna2d3", - "molecule_id": "NM_009785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaatcccttaagtgtgaacggttaaaggctcagaagatcagacgac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cacna2d3", - "molecule_id": "NM_009785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tggtggtggacagtagctgtctctgtgagtccgtggctcctata", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Cacna2d3", - "molecule_id": "NM_009785", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agaccacagggaacattgcttgcgaagactgctccaagtcct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Plpp4", - "molecule_id": "NM_001080963", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaggagtgattggcctcatttttgcctatatttgctacagacaac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Plpp4", - "molecule_id": "NM_001080963", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgctgccatcttgcccttgtactgtgccatgatgatcgccct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Plpp4", - "molecule_id": "NM_001080963", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttctcgggcctcggtttcacaacattctacctggctggcaagc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adcy2", - "molecule_id": "NM_153534", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caataagcactccttcaacgacttcaaacttcgagtgggtatcaac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adcy2", - "molecule_id": "NM_153534", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "atacatggcagccacgggtctgagtgctgtacccagtcaggagca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Adcy2", - "molecule_id": "NM_153534", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aggagttgtaccaccagtcctacgattgtgtctgtgtcatgtt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip4", - "molecule_id": "NM_030265", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgcctagtgacgcttattaacaagtaaccctaacagcagtaaagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip4", - "molecule_id": "NM_030265", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ccatgcagctctttgaaaatgtgatctagaatgtcagcacctcctc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Kcnip4", - "molecule_id": "NM_030265", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gaagatgagctggagatggctactgtcaggcatcggcctgaa", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sparcl1", - "molecule_id": "NM_010097", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caggatcttgacacactctgaacttgctcctctgcgagcttccct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sparcl1", - "molecule_id": "NM_010097", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cggatgagagactggctcaaaaacatcctcatgcagctttatgaac", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sparcl1", - "molecule_id": "NM_010097", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "acaccaactgcagctggattacttcggagcttgcaaatctattc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Brinp3", - "molecule_id": "NM_001145807", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tatgcctgtgagtgagagcagctttccagactgggagcggacta", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Brinp3", - "molecule_id": "NM_001145807", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "actctgcaagcctgaagtcgctgagtcaaccgatcactacattg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Brinp3", - "molecule_id": "NM_001145807", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gctctttagccttagcaaacggtgccacaagcagcctctcatca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Snrpn", - "molecule_id": "NM_013670", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caagccaaagaatgcaaaacagccagaacgtgaagaaaaacggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Snrpn", - "molecule_id": "NM_013670", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "agaggtggttaaagcagtattgcaacttcaaggtggtggaattca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Snrpn", - "molecule_id": "NM_013670", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caagagtgtcacttgtacccacgacgttctcagcaacagcaagt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly6c2", - "molecule_id": "NM_001099217", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gccatttagttgtggatctctattcttggccctggaggcatgt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly6c2", - "molecule_id": "NM_001099217", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tcctgttgcagcgaagacctctgcaatgcagcagttcccact", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Ly6c2", - "molecule_id": "NM_001099217", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caaagaaggaaactaaagacccgtcagtgcctttctttctgcc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Npy", - "molecule_id": "NM_023456", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gtctgcctgtcccaccaatgcatgccaccactaggctggact", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Npy", - "molecule_id": "NM_023456", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cattctggctgaggggtacccctccaagccggacaatccg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Npy", - "molecule_id": "NM_023456", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "cactacatcaatctcatcaccagacagagatatggcaagagatcca", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Tesc", - "molecule_id": "NM_021344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "caagatgcacattcgtttcctcaacatggagaccatcgccctct", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Tesc", - "molecule_id": "NM_021344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "aatgtggtggaggagctgctctcgggaaaccctcacattgaaaagg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Tesc", - "molecule_id": "NM_021344", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "tgactatcatgtcctacttccggcccatcgacaccaccctggg", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sst", - "molecule_id": "NM_009215", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gggaaacaggaactggccaagtacttcttggcagagctgctgtc", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sst", - "molecule_id": "NM_009215", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "gagcccaaccagacagagaatgatgccctggagcccgaggattt", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - }, - { - "molecule_name": "Sst", - "molecule_id": "NM_009215", - "subcellular_structure": { - "text": "cytoplasmic" - }, - "probe_sequence": "ttcttggcagagctgctgtccgagcccaaccagacagagaat", - "assay_type": { - "text": "in situ sequencing" - }, - "multiplexed": "yes" - } - ], - "channel": [ - { - "channel_id": "nissl", - "excitation_wavelength": 440.0, - "filter_range": "455-515", - "multiplexed": "no", - "target_fluorophore": "Neurotrace 435/455", - "exposure_time": 400.0 - }, - { - "channel_id": "G", - "excitation_wavelength": 514.0, - "filter_range": "525-575", - "multiplexed": "yes", - "target_fluorophore": "Illumina G", - "exposure_time": 1000.0 - }, - { - "channel_id": "T", - "excitation_wavelength": 561.0, - "filter_range": "580-650", - "multiplexed": "yes", - "target_fluorophore": "Illumina Y", - "exposure_time": 240.0 - }, - { - "channel_id": "A", - "excitation_wavelength": 640.0, - "filter_range": "661-691", - "multiplexed": "yes", - "target_fluorophore": "Illumina A", - "exposure_time": 500.0 - }, - { - "channel_id": "C", - "excitation_wavelength": 640.0, - "filter_range": "705-845", - "multiplexed": "yes", - "target_fluorophore": "Illumina C", - "exposure_time": 1000.0 - } - ], - "provenance": { - "document_id": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8", - "submission_date": "2019-04-03T10:13:40.043Z", - "update_date": "2019-04-03T10:13:45.902Z" - } - }, - "imaging_preparation_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/imaging/2.0.3/imaging_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "zador_baristaseq_1", - "protocol_name": "BaristaSeq for genes", - "protocol_description": "BaristaSeq for targeted endogenous mRNA sequencing without gapfilling" - }, - "imaged_slice_thickness": 20.0, - "final_slicing_method": "cryosectioning", - "fiducial_marker": "rolonies", - "expansion_factor": 1.0, - "provenance": { - "document_id": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38", - "submission_date": "2019-04-03T10:13:40.034Z", - "update_date": "2019-04-03T10:13:45.426Z" - } - }, - "collection_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/9.0.0/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "col_protocol_1", - "protocol_name": "Fresh frozen mouse brain embedded in OCT", - "protocol_description": "Fresh mouse brain was dissected and embedded in OCT, frozen, and stored at -80C." - }, - "method": { - "text": "organ extraction", - "ontology": "EFO:0009124", - "ontology_label": "organ extraction" - }, - "provenance": { - "document_id": "caf94c25-8327-4379-b88e-2a6642cd7513", - "submission_date": "2019-04-03T10:13:40.027Z", - "update_date": "2019-04-03T10:13:45.505Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "zador_baristaseq_1" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "da265acd-5601-49c5-855e-d792d51b4042", - "submission_date": "2019-04-03T10:13:42.362Z", - "update_date": "2019-04-03T10:14:03.513Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_2" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", - "submission_date": "2019-04-03T10:13:42.335Z", - "update_date": "2019-04-03T10:13:53.863Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/7.0.0/process", - "provenance": { - "document_id": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", - "submission_date": "2019-04-03T10:13:42.326Z", - "update_date": "2019-04-03T10:13:53.834Z" - } - }, - "links.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/system/1.1.5/links", - "schema_type": "link_bundle", - "schema_version": "1.1.5", - "links": [ - { - "process": "da265acd-5601-49c5-855e-d792d51b4042", - "inputs": [ - "87f58f88-ef8b-4323-bd19-cde1a2497b59" - ], - "input_type": "biomaterial", - "outputs": [ - "6baa3aff-b2a5-4e49-82f7-25c108a6107a", - "06dcfc33-21da-485f-8e50-49d294713a9e", - "404dd50b-4bc9-4c82-8c18-f53c68eed2fc", - "5ceb5dc3-9194-494a-b1df-42bb75ab1a04", - "76e52f76-ede7-4088-b7f6-d6e5f6152292", - "2e496fe6-f500-4e27-b7f5-3c87fe43bbe5", - "be66141d-84a3-457d-a8d2-2f0da8c91dff", - "680cf532-ef0c-4155-b44d-a6ec3920743a", - "08609f14-cf43-4188-b743-4a0b55b17347", - "d10827a1-38f7-457d-9c9f-695f2fc7689c", - "6f8eb2e5-7a0c-4c98-8da0-276457357071", - "ca480df3-71bb-4634-8f71-b6a75aeb9f05", - "03ae5f5e-65ac-4491-b0ce-eefc940e0224", - "ff117ecb-767e-4e72-baa9-2bda4fcd3e62", - "887f3d73-94d2-44ac-9047-67aca5225882", - "896dfacd-206b-4e4f-a846-ba5b070060d9", - "23303c88-01b1-47d0-b770-dca6802caa13", - "3c1a388d-0577-4417-9cd2-ff33bfed9140", - "67e71b34-7157-4a37-b495-0d740772b480", - "cd3e5e62-6145-42d9-9a5b-046e1b49cf26", - "5fbcb75e-3ee3-4429-8ede-b243afa0789f", - "09226b24-6b11-4e4f-8052-2b544be461aa", - "f67473fd-fbf8-4d69-9db1-556938ab5b87", - "16acc1f2-9f1c-43c8-8ffe-4a9ea674e6ff", - "017a2c88-4f6e-418e-bb96-f42f3a220f87", - "30305240-004d-4632-84d4-37d7e7378782", - "20c5a14a-aaf3-40e1-9ab7-f95c06ea4200", - "3fd2781b-6855-4eaa-b2fb-81db386adb18", - "40474d53-44a4-4ab2-9f20-61b71291f8aa", - "aaa97d47-7124-4763-a3fc-f6d66eb6d990", - "4adbed13-1cb6-4405-b892-fe8165050691", - "2bbf0125-b9cc-4413-8dd7-78ea72beaa17", - "5402916f-6de1-4842-8585-fc25c153992b", - "75b78bfc-8d15-4a07-a07a-c62ae6d656b5", - "8a78224e-4106-41d4-96cb-4d9a8b9ecad2", - "cb92dd92-570c-4075-8893-eb19dbd837b8", - "b36948c4-0646-42be-9db2-16626a757343", - "c974f4eb-27b8-4ec3-913e-a6eb19572a51", - "febb760d-1e9e-4432-9b88-ce2869a43c44", - "054f40a4-68d0-41db-81e9-00239042d9fa", - "ec7f06aa-e4f9-4f4f-afd1-0ecd39b2e3f5", - "819e3227-cc54-4919-95af-c1f8194bf729", - "b1e2b9d1-6973-41dc-acdf-95474303561f", - "41ffc783-5ad4-4197-8fd1-c029903c43c0", - "ec9c70f0-3ed8-461c-ad0b-2475bd48ac8f", - "9014bbaf-a047-4b69-8e28-8356cc99f84e", - "f7acf90c-2b32-463b-b832-8daa8529f727", - "fae4f8b8-e6ad-4c1f-8126-e03ba8aca46e", - "db22deab-498a-409c-8386-5bf4e60a080c", - "07d600bc-0d55-4a8d-9a48-390fc4169845", - "d0a032bb-cd0e-4873-b346-5cb19e45c202", - "a161f60f-af92-4b09-9df0-dd7ff2bf571a", - "25c6b755-7f62-49a3-a1b5-aafbc772b5dd", - "f10fd9e2-5747-4d7a-8c0c-beba81749011", - "553b6aab-4745-45f8-98ab-de6aadbf48e4", - "3572abe9-6e42-4266-8671-ff24b592065c", - "6882abf6-c247-4167-a18d-e3fec24bcba2", - "15f8b73e-937c-444d-8362-fdf458abb651", - "33b4e374-20ad-4fee-b682-aaa4fc12bec2", - "0e83c507-2211-4561-b75a-92326fb2d4fd", - "912c55cf-0774-4838-8874-352766984715", - "b2f32e7c-fea2-44c2-a6ae-832c1c7b9e37", - "5b8e3d96-e625-46b6-9689-110fa84fd721", - "de43f9bc-ddec-4326-9cb1-7b9c5f76a84f", - "6f3272d7-4a62-4a3c-8c44-11dda8756956", - "168422c5-e89d-466c-9085-f29c02160143", - "7331367a-cc43-4af0-8750-a2921d513f97", - "edf83a09-2e60-4571-b650-abf4c7ff757b", - "24bdb70c-4bd1-41e0-b5c2-a3a2e0e4ce5b", - "be9d12b6-f8dd-407c-b1d7-844deb6a5023", - "e3e59792-61e3-4bf0-a985-2acec75acafd", - "095ee09c-1605-4c07-9324-b5382f20b78e", - "77b96424-accb-4c6b-884c-756f2bb40929", - "a0c2a5b4-7cc2-47f5-97a7-6b59019155da", - "78518dc1-d38e-4230-88b8-887bdd83f965", - "652dd3c5-6467-41ee-89b3-e4b3361fb533", - "cae3d214-d485-4350-8cd2-f4142aca4aef", - "2ab7ea06-08e0-4669-88e0-23c1e74a3b49", - "de282263-0944-48d4-9819-6182636c76bd", - "bfdbe9b5-42ac-419a-b297-843095de2cc2", - "0ef6ffa4-e40f-476c-8ac9-10732ef6e42d", - "e2763cda-3236-487e-9944-5169c0cb8856", - "37018bd8-8537-47c3-a5a9-efb43552f30c", - "a6c9b1ce-2054-4a48-b262-bb0723b8a567", - "8319ee38-f199-49d7-989a-25b451656b38", - "022841b6-8b7c-4d0c-b65f-06ba14253540", - "299dfbe5-05f5-48a7-816b-61036f0e435a", - "6b8b11aa-3600-4a63-a980-93465e681c9c", - "35716168-df43-4273-b52f-72e3d18a47bc", - "6be783ec-c132-4e09-90e0-0958efaf6619", - "a11956c9-c24e-4efb-8af8-1167b3081e70", - "b69a349b-0e07-4fbe-9e3b-9f2cea828b96", - "753c2a57-b5f1-4984-b874-b2b10d582847", - "e0b93b3d-075b-482b-838a-e36d8849607b", - "96c8ed8d-8bd6-49f3-b97b-025b0d6bc9ec", - "c647964a-7796-4dd2-9fa8-b23f012ac14e", - "87a63649-9834-49b8-89a0-310211c1b5b3", - "b2eb5b20-fd1a-403c-8b55-9eec5972d482", - "4b3b36cb-cd90-4526-978d-2e7e8f7add39", - "cdc774f8-3310-4f1f-8c67-03579c253640", - "607370e0-7e7e-4d25-ba5c-957c00a73ac1", - "3240d7ab-568b-4be5-adba-3178b3e8f85e", - "c0b6ee98-677a-41d9-9d80-9ac63d251b08", - "f34c01ec-06df-49e6-bc2f-c50c7f398851", - "2047311b-f3ee-4137-8338-a45166e01d53", - "44ea335a-1991-4504-be12-04f1a332ddfb", - "59f3d0ab-1fe1-4cc8-b343-c12b520d769d", - "58f9fb1a-b6be-42c4-98ed-a5c091a3c716", - "6af3cb41-9e64-4b11-b272-be87adf0fa94", - "7541d176-dfba-4e05-ba45-0c6964271dff", - "8ee1e829-a507-40a5-87ac-7fd8379b87ce", - "8e57554a-abb2-4664-87b6-a397f4da6555", - "88fa5ec5-db7d-49bf-8c7e-86f348fbc84c", - "a2b4ab97-84bd-4808-884d-bd8cc5e7b922", - "56c83f8e-3ef2-4a3a-b808-52cc1e96ac8e", - "8af22b64-2c3f-4aad-a2d5-5d9b122a7b1c", - "f0cb4244-e19a-46a0-89f1-04143548872d", - "73074f55-d009-41a2-929e-6fd9949bb1dd", - "0c2a3965-fbd7-4dc2-bcf0-9c51650a7331", - "3774ecbd-d397-4b46-ba08-a7cbc6da0c07", - "146231bb-1b13-4db5-8157-9d9962cc3a3a", - "1d1b3f27-4f67-4338-bb36-173fd6ecf14b", - "7fe17380-3090-4fc3-9504-02b3f8ed95b6", - "fc405b01-60ca-436f-a06c-2f38f7156a87", - "bae92b53-c6c7-4712-865e-6cff3cba506e", - "83662ec5-a202-42ab-9a47-a701d4f19de3", - "a04957c6-8ce8-4fa6-950d-71812ff3d698", - "9284d3a4-73bd-4aa0-847c-ab273d14185a", - "4d664562-c333-4aaf-bb8b-641e0568733e", - "b533685d-3c60-4483-841b-a054f0a69fec", - "3f14c88e-58db-4f76-b6e0-4b483ded1ca3", - "32d0b267-f399-408a-b35f-f1ebc7d0fc1f", - "3e8510c9-7e31-49bd-bb90-cb55577c2f25", - "463aff9a-ec7e-40d0-be42-c6686af9130d", - "02ddb50f-4a97-4fbc-ac08-32cd5f0fb319", - "868efb99-df36-462b-91a2-bb6ca27e842a", - "dd124d84-cb44-42e6-88d8-0d97fcb2c0f1", - "36ded48a-869f-4fa8-971f-56bc28298276", - "b62567c9-27d5-49b9-aa2e-7e9e1513dcb4", - "e72742a4-23ba-4e5d-a29b-ad449abe8101", - "cd6e1096-f8c3-4eda-957d-b09741d60901", - "903ea376-5153-4fb8-8ffa-e2948951409c", - "89c5fc1e-9d18-4a6b-9025-ea0b75d01adb", - "8381d167-c4dd-49a2-b5df-1ae815bbe42e", - "9be80be6-ee45-49d5-8d3d-a6df8f0383f6", - "cf305c60-bb2c-41af-82bf-0631c2a7b0be", - "074290a9-35e1-422f-a3af-e5ed58781b4d", - "0c49b3ca-bb47-41d9-a58c-e5ea79f673c3", - "783c4def-7dc3-40a6-aa9e-a3f92a2dffba", - "5165cc56-ff89-42bf-b000-fec4bd57176e", - "545be634-5893-45e0-93b2-dd4ea93e00db", - "2d2e58c6-7c24-4089-bbe9-d47b7482be46", - "e4ce035a-f9e2-459f-8ecf-ce138ea00b34", - "81214e49-318f-4221-bf2c-4ef00cfa916b", - "7fc97754-1121-468b-b1e4-839bde86b6c8", - "7d70d44c-b5d7-47be-9687-e9a775e86251", - "ddb4f9d4-f2a1-42a5-87fa-e818071a5b33", - "b7607809-e975-4c32-bff7-375cb2d8276f", - "b8a6c863-626d-4fbf-863b-610cffaac37d", - "45077a5c-ee96-47c0-a84f-9d46cf799338", - "49d82b74-6f1a-415c-93ab-958c60f083b6", - "753b51b7-a909-44e7-bb21-cf2cd18328f8", - "c7ab6349-b2bb-4ba3-9c9b-27d270550052", - "7be770fc-4a56-4f82-a4cf-3cf908d54dca", - "3f5f8537-c1af-4d2e-a732-53b6d4275588", - "3820feac-72c4-49c5-a5a0-773f4e5ee3c1", - "f986c2c2-2823-45a0-80cf-5e6f67958afb", - "7d17d6d6-d038-40c6-b965-6de41ce9c931", - "3d208b38-62c8-492d-9434-21bb66ead16e", - "9a982898-77c6-4a56-8e54-9cb83ff0b235", - "1bdd91d7-0a1a-488d-ab9c-78eba7a6daa3", - "24b6366f-03ce-4e4d-b50f-90687f3e2b94", - "ec1d0987-fb49-48b8-aaeb-321c659fb67f", - "e756ce65-ad72-42e6-a8cc-9c1bac781ce5", - "6fbcb1c7-ce98-46db-8054-b451b6bca205", - "c225fa8c-e8c8-46a4-bf23-720e2cf1c9ac", - "aa6fca0d-6a70-4016-a0e4-307878e9ff45", - "ee62cd8d-fb93-4082-980b-213c7a8a0c47", - "bbd60a79-3572-42c0-8e53-b0c566a72f06", - "bf585666-2fb4-4ad5-a9b3-b268a9953ed9", - "52548ff8-5bbd-4b1c-9c52-4e5d82f846e2", - "240a67cc-e827-41bf-8ac8-a66bc2797f13", - "7a9b6534-fa1d-4282-a064-11e60e57a322", - "b0af6371-4379-45f0-8c09-f6610833fc46", - "f5ce7a96-cfc0-42c4-852b-386f9a27111d", - "8bc05db7-bd23-4a10-9761-96be7b8ef9ee", - "3dff4add-7d6f-418c-afba-e46864af51d2", - "ab2b7c67-8f13-4388-acd7-e2abb0091f30", - "d9912d93-3d92-48d2-9f75-826fbba3d94e", - "8b37aba2-be5e-4963-8e6f-51a2df8e143e", - "81c0e4e2-9021-4c4d-9876-1ed5b78ca7a7", - "2d7e88dd-bddd-4289-9556-27d301be0b83", - "0c1c578d-d4cc-40bb-a54d-d1d4d004373f", - "9dc0ead3-f17a-4bb8-88e2-87f779029ff8", - "f618a8bc-5e07-477f-a6d3-1b0af8c81ff0", - "e834d3df-8432-40ba-b67d-c7cd0bd7328d", - "d8908d6d-5daa-454d-9082-726054cfddc1", - "c5a7142e-4702-4e84-b7aa-239df2a71ba8", - "f69e44ef-cf23-4571-8dad-e44222697974", - "ea72f81c-2c58-43e2-acca-294254f470f7", - "89d1d2b5-81d3-487d-9fc1-d8b1d8ac34ab", - "6928ac1b-fd1d-436c-bfc6-4087c65809d7", - "07a7b938-435b-4804-b140-c255957b6532", - "3d532a7b-55e7-4461-afbc-65ef76403384", - "bab40245-28bd-49a2-8be0-ba109fe41c91", - "9d577bd4-3a27-48be-ad7c-8c44cf803cda", - "c4de7605-fec5-4389-bb9e-f2ea0c41cdef", - "21a043b6-6dde-41b9-b20e-74b961da8b88", - "11280200-1803-4110-aa84-2808776c2d50", - "86df5269-576b-4d18-a0ce-6e2b2a36d51b", - "e524ff4e-95fa-4561-bfd3-276cba79e664", - "3d5737da-b1ab-48cb-a26f-d420e53edccd", - "44cf15ec-3d4e-4698-bb14-107c34891191", - "6242cdf3-fd6d-4479-a08a-1747818fd978", - "bc60bbd4-8b09-425c-b507-9da24a84f412", - "1f054ccf-f8dd-4127-a6f8-c577d7dd93dc", - "9954cb4b-b0a4-4479-b31d-0bee1e75d9c7", - "5f67c32c-a154-4620-8603-0b64979b04a4", - "7d5bffb2-8bf9-4366-a8b2-762ebb4d6c5d", - "dcee6df0-9e87-4935-8873-f8d30d449d76", - "7d6bdde6-523f-46cb-bed5-d6cfa8fea80c", - "e6d00b0c-3641-4ec4-a553-8fd742193dba", - "e5034863-0528-4f55-be95-c8501c29f9fe", - "cc61b14a-59d9-477b-8cb1-43c4ee4cf434", - "33d332c9-aefe-4db5-8830-b8daddaed0d2", - "bb3b6fc7-0902-432d-bad1-6b3f61951314", - "2b734e88-3a33-4c73-92bb-82e0b8f8c13b" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "imaging_protocol", - "protocol_id": "96ecb94d-e848-4d7b-8df9-f19af6ab17b8" - } - ] - }, - { - "process": "07acb7d0-3f1c-47f7-9ef9-851c4f1caaec", - "inputs": [ - "edd1d525-a6ae-4658-a6bf-6c31d7ab6948" - ], - "input_type": "biomaterial", - "outputs": [ - "87f58f88-ef8b-4323-bd19-cde1a2497b59" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "imaging_preparation_protocol", - "protocol_id": "a6d431b0-4373-4eaf-a3af-8c3fe461ab38" - } - ] - }, - { - "process": "fee8a188-5783-44cd-a1c1-ed9d5d7c32a9", - "inputs": [ - "6cb9fc09-7755-4a35-b6b1-0d6fe696b2d4" - ], - "input_type": "biomaterial", - "outputs": [ - "edd1d525-a6ae-4658-a6bf-6c31d7ab6948" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "caf94c25-8327-4379-b88e-2a6642cd7513" - } - ] - } - ] - } -} diff --git a/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde.2019-03-17T220646.332108Z.json b/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde.2019-03-17T220646.332108Z.json new file mode 100644 index 000000000..6b5bd4ff6 --- /dev/null +++ b/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde.2019-03-17T220646.332108Z.json @@ -0,0 +1,790 @@ +{ + "manifest": [ + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "e4a41880", + "indexed": true, + "name": "cell_suspension_0.json", + "s3_etag": "771087082e3841e2d955d3a4738b6bf6", + "sha1": "88fbdf8c6792ef638696f520fbf7073ee77f8a70", + "sha256": "bba2d6251b3b95adf3aae07f6de78f6706186d8cf77e6b846004ba561607b952", + "size": 1695, + "uuid": "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1", + "version": "2019-03-17T220103.482000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ec0f9294", + "indexed": true, + "name": "specimen_from_organism_0.json", + "s3_etag": "ba64e0187f8e1acbb831501ca2d9c55d", + "sha1": "84c4b0e71fad61df1e0cab4e8578e8f26c572b3e", + "sha256": "e97c736042bb2352b33dd42286706391b1ea80de23fcb591364bbafec5491510", + "size": 1447, + "uuid": "f3531ee2-d408-4075-b63e-0d0e2b01116c", + "version": "2019-03-17T220103.535000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", + "crc32c": "ce292309", + "indexed": true, + "name": "donor_organism_0.json", + "s3_etag": "384f53dbf137044fc4846e2a4a0fc673", + "sha1": "fde9a6fbfb6d351d7ff8c2adbc26f8e14784dcc9", + "sha256": "ce49a3e318ffac754fd475c72a492e0061037be6131e620f7ac4a367932a66da", + "size": 2456, + "uuid": "20db3238-9ce6-4820-8495-6753e4147d51", + "version": "2019-03-17T220103.211000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "cd22b0a4", + "indexed": true, + "name": "sequence_file_0.json", + "s3_etag": "54153f330aa1b9fe000cb92ccf13909f", + "sha1": "a1b752760ef553d58a4d5cc6590ae905493ec9c9", + "sha256": "27e3670238f3e64d296b5a21f44a9e708eadc9d34434768fc2536bead22e9d5b", + "size": 616, + "uuid": "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", + "version": "2019-03-17T220304.130000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "654ecf2b", + "indexed": true, + "name": "sequence_file_1.json", + "s3_etag": "53fdd0c163b64f32eb33c2d2f5e490a2", + "sha1": "e44596e5542317da3a6db9559cd8370bf8959bc4", + "sha256": "8457e0954e940e4915d0d07584b798d990823cb4ef606455f8abd17bf8310da5", + "size": 616, + "uuid": "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", + "version": "2019-03-17T220306.010000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/file\"", + "crc32c": "5c8d6472", + "indexed": true, + "name": "sequence_file_2.json", + "s3_etag": "b893d7fdf85cd6134a8eaf8947617743", + "sha1": "8cc158bbdf896bba39e94b264485c13aeefd06fa", + "sha256": "2baf9973d9760dafbe4d24e99886ba4131c31a98ef3f1f41392b104dce0db13e", + "size": 616, + "uuid": "5201d410-d789-4df6-b3fd-9edac998e5f3", + "version": "2019-03-17T220303.738000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/project\"", + "crc32c": "d5b43d3f", + "indexed": true, + "name": "project_0.json", + "s3_etag": "affb98ff4e5d2076c1b5d2c1fc2a1123", + "sha1": "ff8c83a24199185bc677f9aa5f5a7a9131a0162b", + "sha256": "4ac31750071a3f15a075178cdfb472aae4aa3c065289f401636aa7599255ce1e", + "size": 2455, + "uuid": "5014cd10-bbed-4e85-bc45-6fe3a8a0079b", + "version": "2019-03-17T220103.175000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "c4e3d5a5", + "indexed": true, + "name": "library_preparation_protocol_0.json", + "s3_etag": "3ef0fa45f8d083ea5b42e2b635205e79", + "sha1": "fc269fd520a49bf6d66b3b18d6638fbf55df1346", + "sha256": "81279b1c39714fa20eea17e18633108d39c648d91efd57efce632fe7c3a66ca1", + "size": 1440, + "uuid": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73", + "version": "2019-03-17T220103.138000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "76e3c622", + "indexed": true, + "name": "sequencing_protocol_0.json", + "s3_etag": "bcf4dcb6e3e3fcec70a3f89a60fc0090", + "sha1": "7856e3b6253a26a87e06b929884844ddbe69e737", + "sha256": "44379340e53ac31cb854837be33d070d6aa7de4fd012692cf83b5a8d5894b7fa", + "size": 1268, + "uuid": "4bc436f7-e429-4355-8d6e-853d8e639b37", + "version": "2019-03-17T220102.999000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "cbf4692f", + "indexed": true, + "name": "dissociation_protocol_0.json", + "s3_etag": "7e3594b3b69b41801e075805bbbdc8d1", + "sha1": "7835112e34c9cc1751723dd6fd52778f7d7ab9a4", + "sha256": "f08c780ee2d13a193634717c0b5c22f3e4a6b5457e7864681b5778fc4bf565e2", + "size": 922, + "uuid": "1e9abdf3-54da-4c73-9e57-1297ceb39399", + "version": "2019-03-17T220103.046000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "3833fa5f", + "indexed": true, + "name": "enrichment_protocol_0.json", + "s3_etag": "c7f29b7b9f36f2b122e80c6722a24b17", + "sha1": "8a09a92e0c280ed904bf6a7a5360b5e4f3994f62", + "sha256": "3733fb5a7e4c9a07eee111ce90cc8eed742004e1e059c58348663541230522cf", + "size": 1002, + "uuid": "df679627-ccb6-426d-a709-c259db607d84", + "version": "2019-03-17T220103.051000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/protocol\"", + "crc32c": "2aa8eec5", + "indexed": true, + "name": "collection_protocol_0.json", + "s3_etag": "e9f572d88d7ee22c0f3b92e228fb0129", + "sha1": "fc931acb005de2b533b03fc4cc8a44bdb702530f", + "sha256": "bcfba8a40f1dd713d575981f8d4eb9f30ce766f42c1dcadff830c776221a8eab", + "size": 1205, + "uuid": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de", + "version": "2019-03-17T220103.060000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "4fa2e0d6", + "indexed": true, + "name": "process_0.json", + "s3_etag": "7a351255d56c389e1e591bcadb0b3c64", + "sha1": "e3648ac0c76bc0999c2a45c6234008a8f5724616", + "sha256": "aa638f85b6c3e4ee2fe8acf38d377c0c4a854a0b1aa8fb6370bb822cf915f1d7", + "size": 384, + "uuid": "8a0879df-13e0-4dce-9776-20fb259796e9", + "version": "2019-03-17T220103.421000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "06ed887a", + "indexed": true, + "name": "process_1.json", + "s3_etag": "31100497d87e6b38004ec40da7db51ee", + "sha1": "366e43a7ddf7cca422ae0125fc07da1a6344b6ce", + "sha256": "8241f763f889193a253b134a9ef56950ee9a2dfe191b40c039465111a2bf1a4c", + "size": 389, + "uuid": "b2e86d49-6874-4522-a68c-43166e858bdd", + "version": "2019-03-17T220103.392000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/process\"", + "crc32c": "bb866e25", + "indexed": true, + "name": "process_2.json", + "s3_etag": "04b015a2e2204519c66c8a5dbcb63d1c", + "sha1": "205b1fe5aa068df2269a8b977dc27d3f191a0d0a", + "sha256": "e67a3ecd72b75d60c46db965836f0b4dc01e94485e1447928833f5304d2ee7f0", + "size": 389, + "uuid": "b147df84-443b-4dd2-8327-7ea42adcd151", + "version": "2019-03-17T220103.254000Z" + }, + { + "content-type": "application/json; dcp-type=\"metadata/links\"", + "crc32c": "5356a6ba", + "indexed": true, + "name": "links.json", + "s3_etag": "9b3b812e32f35e5406449b2b4221da39", + "sha1": "0881415da33135bb54802129c3fec9b462035ab4", + "sha256": "82606b3dc782eeacdcc0d5a670d4e6bf5fc453998c63fc40a2f0318ac5dfc1ef", + "size": 2335, + "uuid": "feb61912-5a3c-4e12-a4ba-28a0207835fd", + "version": "2019-03-17T220643.786686Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "da1a6040", + "indexed": false, + "name": "pbmc4k_1000_S1_L001_R1_001.fastq.gz", + "s3_etag": "eeaf6532a43b731e1ed9068bf32add47", + "sha1": "1e9baaa563f2559a6eb42f586730d1fc2aba6abc", + "sha256": "5e3f4a1a8cad609ab42b3c66c069fc29c2cfc3875f600e121aed3bde36b66fd1", + "size": 10287500, + "uuid": "46ab4893-bb4a-43fa-bc86-22f0d89fddf6", + "version": "2019-03-17T220644.137081Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "0eee0a0a", + "indexed": false, + "name": "pbmc4k_1000_S1_L001_R2_001.fastq.gz", + "s3_etag": "891e3067ff772d599a5c424f5a93bfd5", + "sha1": "b866551f9f1b449039b4eeeda6c6b05bf3eee72b", + "sha256": "4718d026a1a2fdd13e6c9cb3bb92eb096f24478571cb6045cd3ce54f2623c2e1", + "size": 30926462, + "uuid": "2a2b38af-9776-41c8-b643-2e094ac1c58b", + "version": "2019-03-17T220644.507486Z" + }, + { + "content-type": "application/gzip; dcp-type=data", + "crc32c": "51ffe105", + "indexed": false, + "name": "pbmc4k_1000_S1_L001_I1_001.fastq.gz", + "s3_etag": "3d252f83492bf030ddfd05a5a1411cdc", + "sha1": "02e40d38df063e54310edefe956fc9ed336c70fb", + "sha256": "7f11f8f3a5a8e879d3c7d612f4d37233ebfdd3e226406c013bc375403bae2137", + "size": 3454130, + "uuid": "04a1ab2c-e522-4d73-a881-effa1d9492d1", + "version": "2019-03-17T220644.766900Z" + } + ], + "metadata": { + "cell_suspension_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/9.0.0/cell_suspension", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "cell_ID_1", + "biomaterial_name": "This is a dummy cell", + "biomaterial_description": "This is a dummy donor cell", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DRB1 0401 protective allele", + "biosd_biomaterial": "SAMN00000000", + "insdc_biomaterial": "SRS0000000" + }, + "cell_morphology": { + "cell_morphology": "adherent cells, form single layer colonies", + "cell_size": "20-30", + "cell_size_unit": { + "text": "nm", + "ontology": "UO:0000018", + "ontology_label": "nanometer" + }, + "percent_cell_viability": 85.3, + "cell_viability_method": "Fluorescein diacetate hydrolysis assay", + "cell_viability_result": "pass", + "percent_necrosis": 10.0 + }, + "growth_conditions": { + "passage_number": 22, + "growth_medium": "lysogeny broth (LB) medium", + "mycoplasma_testing_results": "pass", + "drug_treatment": "100 ug/mL ampicillin", + "feeder_layer_type": "feeder-dependent, mouse embryonic fibroblast cells" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "estimated_cell_count": 10000, + "provenance": { + "document_id": "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1", + "submission_date": "2019-03-17T22:00:57.699Z", + "update_date": "2019-03-17T22:01:03.482Z" + } + }, + "specimen_from_organism_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/7.0.3/specimen_from_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "specimen_ID_1", + "biomaterial_name": "This is a dummy specimen", + "biomaterial_description": "This is a dummy donor specimen", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DRB1 0401 protective allele", + "biosd_biomaterial": "SAMN00000000", + "insdc_biomaterial": "SRS0000000" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organ": { + "text": "brain", + "ontology": "UBERON:0000955", + "ontology_label": "brain" + }, + "organ_part": { + "text": "amygdala", + "ontology": "UBERON:0001876", + "ontology_label": "amygdala" + }, + "diseases": [ + { + "text": "H syndrome", + "ontology": "MONDO:0011273", + "ontology_label": "H syndrome" + } + ], + "state_of_specimen": { + "autolysis_score": "none", + "gross_description": "normal color and size" + }, + "provenance": { + "document_id": "f3531ee2-d408-4075-b63e-0d0e2b01116c", + "submission_date": "2019-03-17T22:00:57.694Z", + "update_date": "2019-03-17T22:01:03.535Z" + } + }, + "donor_organism_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/14.0.3/donor_organism", + "schema_type": "biomaterial", + "biomaterial_core": { + "biomaterial_id": "donor_ID_1", + "biomaterial_name": "This is a dummy donor", + "biomaterial_description": "This is a dummy donor description", + "ncbi_taxon_id": [ + 9606 + ], + "genotype": "DRB1 0401 protective allele", + "biosd_biomaterial": "SAMN00000000", + "insdc_biomaterial": "SRS0000000" + }, + "human_specific": { + "body_mass_index": 36.4, + "ethnicity": [ + { + "text": "European", + "ontology": "HANCESTRO:0005", + "ontology_label": "European" + } + ] + }, + "death": { + "cause_of_death": "motor vehicle accident", + "cold_perfused": false, + "days_on_ventilator": 4.0, + "hardy_scale": 0, + "time_of_death": "1999-01-21T00:00:00Z", + "organ_donation_death_type": "Donation after circulatory death (DCD)" + }, + "medical_history": { + "alcohol_history": "1 units/day", + "medication": "Naproxen 500mg/day,", + "nutritional_state": "normal", + "smoking_history": "Smoker, 5/day for 10 years, stopped 1995" + }, + "genus_species": [ + { + "text": "Homo sapiens", + "ontology": "NCBITaxon:9606", + "ontology_label": "Homo sapiens" + } + ], + "organism_age": "20", + "organism_age_unit": { + "text": "year", + "ontology": "UO:0000036", + "ontology_label": "year" + }, + "development_stage": { + "text": "human adult stage", + "ontology": "HsapDv:0000087" + }, + "diseases": [ + { + "text": "H syndrome", + "ontology": "MONDO:0011273", + "ontology_label": "H syndrome" + } + ], + "gestational_age": "5-7", + "height": "160", + "height_unit": { + "text": "cm", + "ontology": "UO:0000015", + "ontology_label": "centimeter" + }, + "is_living": "no", + "weight": "60", + "weight_unit": { + "text": "kg", + "ontology": "UO:0000009", + "ontology_label": "kilogram" + }, + "sex": "male", + "provenance": { + "document_id": "20db3238-9ce6-4820-8495-6753e4147d51", + "submission_date": "2019-03-17T22:00:57.690Z", + "update_date": "2019-03-17T22:01:03.211Z" + } + }, + "sequence_file_0.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "pbmc4k_1000_S1_L001_R1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "eeaf6532a43b731e1ed9068bf32add47" + }, + "read_index": "read1", + "lane_index": 1, + "read_length": 26, + "insdc_run": [ + "SRR0000000" + ], + "provenance": { + "document_id": "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", + "submission_date": "2019-03-17T22:00:57.704Z", + "update_date": "2019-03-17T22:03:04.130Z" + } + }, + "sequence_file_1.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "pbmc4k_1000_S1_L001_R2_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "891e3067ff772d599a5c424f5a93bfd5" + }, + "read_index": "read2", + "lane_index": 1, + "read_length": 98, + "insdc_run": [ + "SRR0000000" + ], + "provenance": { + "document_id": "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", + "submission_date": "2019-03-17T22:00:57.714Z", + "update_date": "2019-03-17T22:03:06.010Z" + } + }, + "sequence_file_2.json": { + "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", + "schema_type": "file", + "file_core": { + "file_name": "pbmc4k_1000_S1_L001_I1_001.fastq.gz", + "file_format": "fastq.gz", + "checksum": "3d252f83492bf030ddfd05a5a1411cdc" + }, + "read_index": "index1", + "lane_index": 1, + "read_length": 8, + "insdc_run": [ + "SRR0000000" + ], + "provenance": { + "document_id": "5201d410-d789-4df6-b3fd-9edac998e5f3", + "submission_date": "2019-03-17T22:00:57.719Z", + "update_date": "2019-03-17T22:03:03.738Z" + } + }, + "project_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/project/11.0.0/project", + "schema_type": "project", + "project_core": { + "project_short_name": "staging/10x/2019-03-17T22:00:54Z", + "project_title": "10x 1 Run Integration Test", + "project_description": "Contains a small file set from the dataset: 4k PBMCs from a Healthy Donor, a Single Cell Gene Expression Dataset by Cell Ranger 2.1.0. Peripheral blood mononuclear cells (PBMCs) were taken from a healthy donor (same donor as pbmc8k). PBMCs are primary cells with relatively small amounts of RNA (~1pg RNA/cell). Data/Analysis can be found here https://support.10xgenomics.com/single-cell-gene-expression/datasets/2.1.0/pbmc4k and all data is licensed under the creative commons attribution license (https://creativecommons.org/licenses/by/4.0/). This test also contains extensive metadata for browser testing. Metadata is fabricated." + }, + "publications": [ + { + "authors": [ + "Doe JD, Doe JJ" + ], + "publication_title": "A title of a publication goes here.", + "doi": "10.1016/j.cell.2016.07.054", + "pmid": 27565351, + "publication_url": "https://europepmc.org" + } + ], + "insdc_project_accessions": [ + "SRP000000", + "SRP000001" + ], + "geo_series_accessions": [ + "GSE00000" + ], + "array_express_accessions": [ + "E-AAAA-00" + ], + "insdc_study_accessions": [ + "PRJNA000000" + ], + "funders": [ + { + "grant_title": "A title of a grant proposal.", + "grant_id": "BB/P0000001/1", + "organization": "Biotechnology and Biological Sciences Research Council (BBSRC)" + } + ], + "contributors": [ + { + "contact_name": "John,D,Doe.", + "email": "dummy@email.com", + "phone": "(+1) 234-555-6789", + "institution": "EMBL-EBI", + "laboratory": "Department of Biology", + "address": "0000 Main Street, Nowheretown, MA, 12091", + "country": "USA", + "corresponding_contributor": false, + "project_role": "principal investigator", + "orcid_id": "0000-1111-2222-3333" + } + ], + "provenance": { + "document_id": "5014cd10-bbed-4e85-bc45-6fe3a8a0079b", + "submission_date": "2019-03-17T22:00:57.685Z", + "update_date": "2019-03-17T22:01:03.175Z" + } + }, + "library_preparation_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.4.6/library_preparation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "lib_prep_1", + "protocol_name": "A dummy library prep protocol", + "protocol_description": "A dummy library prep description", + "publication_doi": "10.1101/193219", + "protocols_io_doi": "10.17504/protocols.io.mgjc3un", + "document": "my_cool_protocol.pdf" + }, + "input_nucleic_acid_molecule": { + "text": "polyA RNA", + "ontology": "OBI:0000869", + "ontology_label": "polyA RNA" + }, + "nucleic_acid_source": "single cell", + "library_construction_approach": { + "text": "10x v2", + "ontology": "EFO:0009310", + "ontology_label": "10X v2 sequencing" + }, + "end_bias": "3 prime tag", + "primer": "poly-dT", + "strand": "unstranded", + "umi_barcode": { + "barcode_read": "Read 1", + "barcode_offset": 0, + "barcode_length": 16 + }, + "library_preamplification_method": { + "text": "Rapid Amplification of cDNA Ends", + "ontology": "EFO:0004182", + "ontology_label": "Rapid Amplification of cDNA Ends" + }, + "provenance": { + "document_id": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73", + "submission_date": "2019-03-17T22:00:57.735Z", + "update_date": "2019-03-17T22:01:03.138Z" + } + }, + "sequencing_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.11/sequencing_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "sequencing_protocol_1", + "protocol_name": "A dummy sequencing protocol", + "protocol_description": "A dummy sequencing protocol description", + "publication_doi": "10.1101/193219", + "protocols_io_doi": "10.17504/protocols.io.mgjc3un", + "document": "my_cool_protocol.pdf" + }, + "instrument_manufacturer_model": { + "text": "Illumina HiSeq 2500", + "ontology": "EFO:0008565" + }, + "local_machine_name": "Machine1", + "paired_end": false, + "sequencing_approach": { + "text": "full length single cell RNA sequencing", + "ontology": "EFO:0008441", + "ontology_label": "full length single cell RNA sequencing" + }, + "10x": { + "fastq_method": "Cellranger mkfastq", + "fastq_method_version": "Cellranger 2.1.1", + "pooled_channels": 4.0, + "drop_uniformity": false + }, + "provenance": { + "document_id": "4bc436f7-e429-4355-8d6e-853d8e639b37", + "submission_date": "2019-03-17T22:00:57.739Z", + "update_date": "2019-03-17T22:01:02.999Z" + } + }, + "dissociation_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.8/dissociation_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "dissociation_protocol_1", + "protocol_name": "A dummy dissociation protocol", + "protocol_description": "A dummmy description of a dissociation protocol", + "publication_doi": "10.1101/193219", + "protocols_io_doi": "10.17504/protocols.io.mgjc3un", + "document": "my_cool_protocol.pdf" + }, + "dissociation_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "provenance": { + "document_id": "1e9abdf3-54da-4c73-9e57-1297ceb39399", + "submission_date": "2019-03-17T22:00:57.728Z", + "update_date": "2019-03-17T22:01:03.046Z" + } + }, + "enrichment_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.9/enrichment_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "enrichment_protocol_1", + "protocol_name": "an example enrichment protocol", + "protocol_description": "an example enrichemnt protocol description", + "publication_doi": "10.1101/193219", + "protocols_io_doi": "10.17504/protocols.io.mgjc3un", + "document": "my_cool_protocol.pdf" + }, + "enrichment_method": { + "text": "fluorescence-activated cell sorting", + "ontology": "EFO:0009108", + "ontology_label": "fluorescence-activated cell sorting" + }, + "markers": "CD4+ CD8-", + "min_size_selected": 70.0, + "max_size_selected": 90.0, + "provenance": { + "document_id": "df679627-ccb6-426d-a709-c259db607d84", + "submission_date": "2019-03-17T22:00:57.731Z", + "update_date": "2019-03-17T22:01:03.051Z" + } + }, + "collection_protocol_0.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.11/collection_protocol", + "schema_type": "protocol", + "protocol_core": { + "protocol_id": "collection_protocol_1", + "protocol_name": "A dummy collection protocol", + "protocol_description": "A dummy collection protocol description", + "publication_doi": "10.1101/193219", + "protocols_io_doi": "10.17504/protocols.io.mgjc3un", + "document": "my_cool_protocol.pdf" + }, + "collection_method": { + "text": "organ extraction", + "ontology": "EFO:0009124", + "ontology_label": "organ extraction" + }, + "protocol_reagents": [ + { + "retail_name": "SureCell WTA 3' Library Prep Kit", + "catalog_number": "20014279", + "manufacturer": "Illumina", + "lot_number": "10001A", + "expiry_date": "2018-01-31", + "kit_titer": "Titer: Specification is 3.0x10^7" + } + ], + "provenance": { + "document_id": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de", + "submission_date": "2019-03-17T22:00:57.724Z", + "update_date": "2019-03-17T22:01:03.060Z" + } + }, + "process_0.json": { + "process_core": { + "process_id": "bundle1" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", + "provenance": { + "document_id": "8a0879df-13e0-4dce-9776-20fb259796e9", + "submission_date": "2019-03-17T22:00:57.752Z", + "update_date": "2019-03-17T22:01:03.421Z" + } + }, + "process_1.json": { + "process_core": { + "process_id": "process_id_2" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", + "provenance": { + "document_id": "b2e86d49-6874-4522-a68c-43166e858bdd", + "submission_date": "2019-03-17T22:00:57.748Z", + "update_date": "2019-03-17T22:01:03.392Z" + } + }, + "process_2.json": { + "process_core": { + "process_id": "process_id_1" + }, + "schema_type": "process", + "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", + "provenance": { + "document_id": "b147df84-443b-4dd2-8327-7ea42adcd151", + "submission_date": "2019-03-17T22:00:57.743Z", + "update_date": "2019-03-17T22:01:03.254Z" + } + }, + "links.json": { + "describedBy": "https://schema.staging.data.humancellatlas.org/system/1.1.5/links", + "schema_type": "link_bundle", + "schema_version": "1.1.5", + "links": [ + { + "process": "8a0879df-13e0-4dce-9776-20fb259796e9", + "inputs": [ + "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1" + ], + "input_type": "biomaterial", + "outputs": [ + "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", + "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", + "5201d410-d789-4df6-b3fd-9edac998e5f3" + ], + "output_type": "file", + "protocols": [ + { + "protocol_type": "library_preparation_protocol", + "protocol_id": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73" + }, + { + "protocol_type": "sequencing_protocol", + "protocol_id": "4bc436f7-e429-4355-8d6e-853d8e639b37" + } + ] + }, + { + "process": "b2e86d49-6874-4522-a68c-43166e858bdd", + "inputs": [ + "f3531ee2-d408-4075-b63e-0d0e2b01116c" + ], + "input_type": "biomaterial", + "outputs": [ + "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "dissociation_protocol", + "protocol_id": "1e9abdf3-54da-4c73-9e57-1297ceb39399" + }, + { + "protocol_type": "enrichment_protocol", + "protocol_id": "df679627-ccb6-426d-a709-c259db607d84" + } + ] + }, + { + "process": "b147df84-443b-4dd2-8327-7ea42adcd151", + "inputs": [ + "20db3238-9ce6-4820-8495-6753e4147d51" + ], + "input_type": "biomaterial", + "outputs": [ + "f3531ee2-d408-4075-b63e-0d0e2b01116c" + ], + "output_type": "biomaterial", + "protocols": [ + { + "protocol_type": "collection_protocol", + "protocol_id": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de" + } + ] + } + ] + } + } +} diff --git a/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/manifest.json b/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/manifest.json deleted file mode 100644 index 21fe45282..000000000 --- a/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/manifest.json +++ /dev/null @@ -1,230 +0,0 @@ -[ - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "e4a41880", - "indexed": true, - "name": "cell_suspension_0.json", - "s3_etag": "771087082e3841e2d955d3a4738b6bf6", - "sha1": "88fbdf8c6792ef638696f520fbf7073ee77f8a70", - "sha256": "bba2d6251b3b95adf3aae07f6de78f6706186d8cf77e6b846004ba561607b952", - "size": 1695, - "uuid": "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1", - "version": "2019-03-17T220103.482000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ec0f9294", - "indexed": true, - "name": "specimen_from_organism_0.json", - "s3_etag": "ba64e0187f8e1acbb831501ca2d9c55d", - "sha1": "84c4b0e71fad61df1e0cab4e8578e8f26c572b3e", - "sha256": "e97c736042bb2352b33dd42286706391b1ea80de23fcb591364bbafec5491510", - "size": 1447, - "uuid": "f3531ee2-d408-4075-b63e-0d0e2b01116c", - "version": "2019-03-17T220103.535000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/biomaterial\"", - "crc32c": "ce292309", - "indexed": true, - "name": "donor_organism_0.json", - "s3_etag": "384f53dbf137044fc4846e2a4a0fc673", - "sha1": "fde9a6fbfb6d351d7ff8c2adbc26f8e14784dcc9", - "sha256": "ce49a3e318ffac754fd475c72a492e0061037be6131e620f7ac4a367932a66da", - "size": 2456, - "uuid": "20db3238-9ce6-4820-8495-6753e4147d51", - "version": "2019-03-17T220103.211000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "cd22b0a4", - "indexed": true, - "name": "sequence_file_0.json", - "s3_etag": "54153f330aa1b9fe000cb92ccf13909f", - "sha1": "a1b752760ef553d58a4d5cc6590ae905493ec9c9", - "sha256": "27e3670238f3e64d296b5a21f44a9e708eadc9d34434768fc2536bead22e9d5b", - "size": 616, - "uuid": "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", - "version": "2019-03-17T220304.130000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "654ecf2b", - "indexed": true, - "name": "sequence_file_1.json", - "s3_etag": "53fdd0c163b64f32eb33c2d2f5e490a2", - "sha1": "e44596e5542317da3a6db9559cd8370bf8959bc4", - "sha256": "8457e0954e940e4915d0d07584b798d990823cb4ef606455f8abd17bf8310da5", - "size": 616, - "uuid": "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", - "version": "2019-03-17T220306.010000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/file\"", - "crc32c": "5c8d6472", - "indexed": true, - "name": "sequence_file_2.json", - "s3_etag": "b893d7fdf85cd6134a8eaf8947617743", - "sha1": "8cc158bbdf896bba39e94b264485c13aeefd06fa", - "sha256": "2baf9973d9760dafbe4d24e99886ba4131c31a98ef3f1f41392b104dce0db13e", - "size": 616, - "uuid": "5201d410-d789-4df6-b3fd-9edac998e5f3", - "version": "2019-03-17T220303.738000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/project\"", - "crc32c": "d5b43d3f", - "indexed": true, - "name": "project_0.json", - "s3_etag": "affb98ff4e5d2076c1b5d2c1fc2a1123", - "sha1": "ff8c83a24199185bc677f9aa5f5a7a9131a0162b", - "sha256": "4ac31750071a3f15a075178cdfb472aae4aa3c065289f401636aa7599255ce1e", - "size": 2455, - "uuid": "5014cd10-bbed-4e85-bc45-6fe3a8a0079b", - "version": "2019-03-17T220103.175000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "c4e3d5a5", - "indexed": true, - "name": "library_preparation_protocol_0.json", - "s3_etag": "3ef0fa45f8d083ea5b42e2b635205e79", - "sha1": "fc269fd520a49bf6d66b3b18d6638fbf55df1346", - "sha256": "81279b1c39714fa20eea17e18633108d39c648d91efd57efce632fe7c3a66ca1", - "size": 1440, - "uuid": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73", - "version": "2019-03-17T220103.138000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "76e3c622", - "indexed": true, - "name": "sequencing_protocol_0.json", - "s3_etag": "bcf4dcb6e3e3fcec70a3f89a60fc0090", - "sha1": "7856e3b6253a26a87e06b929884844ddbe69e737", - "sha256": "44379340e53ac31cb854837be33d070d6aa7de4fd012692cf83b5a8d5894b7fa", - "size": 1268, - "uuid": "4bc436f7-e429-4355-8d6e-853d8e639b37", - "version": "2019-03-17T220102.999000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "cbf4692f", - "indexed": true, - "name": "dissociation_protocol_0.json", - "s3_etag": "7e3594b3b69b41801e075805bbbdc8d1", - "sha1": "7835112e34c9cc1751723dd6fd52778f7d7ab9a4", - "sha256": "f08c780ee2d13a193634717c0b5c22f3e4a6b5457e7864681b5778fc4bf565e2", - "size": 922, - "uuid": "1e9abdf3-54da-4c73-9e57-1297ceb39399", - "version": "2019-03-17T220103.046000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "3833fa5f", - "indexed": true, - "name": "enrichment_protocol_0.json", - "s3_etag": "c7f29b7b9f36f2b122e80c6722a24b17", - "sha1": "8a09a92e0c280ed904bf6a7a5360b5e4f3994f62", - "sha256": "3733fb5a7e4c9a07eee111ce90cc8eed742004e1e059c58348663541230522cf", - "size": 1002, - "uuid": "df679627-ccb6-426d-a709-c259db607d84", - "version": "2019-03-17T220103.051000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/protocol\"", - "crc32c": "2aa8eec5", - "indexed": true, - "name": "collection_protocol_0.json", - "s3_etag": "e9f572d88d7ee22c0f3b92e228fb0129", - "sha1": "fc931acb005de2b533b03fc4cc8a44bdb702530f", - "sha256": "bcfba8a40f1dd713d575981f8d4eb9f30ce766f42c1dcadff830c776221a8eab", - "size": 1205, - "uuid": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de", - "version": "2019-03-17T220103.060000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "4fa2e0d6", - "indexed": true, - "name": "process_0.json", - "s3_etag": "7a351255d56c389e1e591bcadb0b3c64", - "sha1": "e3648ac0c76bc0999c2a45c6234008a8f5724616", - "sha256": "aa638f85b6c3e4ee2fe8acf38d377c0c4a854a0b1aa8fb6370bb822cf915f1d7", - "size": 384, - "uuid": "8a0879df-13e0-4dce-9776-20fb259796e9", - "version": "2019-03-17T220103.421000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "06ed887a", - "indexed": true, - "name": "process_1.json", - "s3_etag": "31100497d87e6b38004ec40da7db51ee", - "sha1": "366e43a7ddf7cca422ae0125fc07da1a6344b6ce", - "sha256": "8241f763f889193a253b134a9ef56950ee9a2dfe191b40c039465111a2bf1a4c", - "size": 389, - "uuid": "b2e86d49-6874-4522-a68c-43166e858bdd", - "version": "2019-03-17T220103.392000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/process\"", - "crc32c": "bb866e25", - "indexed": true, - "name": "process_2.json", - "s3_etag": "04b015a2e2204519c66c8a5dbcb63d1c", - "sha1": "205b1fe5aa068df2269a8b977dc27d3f191a0d0a", - "sha256": "e67a3ecd72b75d60c46db965836f0b4dc01e94485e1447928833f5304d2ee7f0", - "size": 389, - "uuid": "b147df84-443b-4dd2-8327-7ea42adcd151", - "version": "2019-03-17T220103.254000Z" - }, - { - "content-type": "application/json; dcp-type=\"metadata/links\"", - "crc32c": "5356a6ba", - "indexed": true, - "name": "links.json", - "s3_etag": "9b3b812e32f35e5406449b2b4221da39", - "sha1": "0881415da33135bb54802129c3fec9b462035ab4", - "sha256": "82606b3dc782eeacdcc0d5a670d4e6bf5fc453998c63fc40a2f0318ac5dfc1ef", - "size": 2335, - "uuid": "feb61912-5a3c-4e12-a4ba-28a0207835fd", - "version": "2019-03-17T220643.786686Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "da1a6040", - "indexed": false, - "name": "pbmc4k_1000_S1_L001_R1_001.fastq.gz", - "s3_etag": "eeaf6532a43b731e1ed9068bf32add47", - "sha1": "1e9baaa563f2559a6eb42f586730d1fc2aba6abc", - "sha256": "5e3f4a1a8cad609ab42b3c66c069fc29c2cfc3875f600e121aed3bde36b66fd1", - "size": 10287500, - "uuid": "46ab4893-bb4a-43fa-bc86-22f0d89fddf6", - "version": "2019-03-17T220644.137081Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "0eee0a0a", - "indexed": false, - "name": "pbmc4k_1000_S1_L001_R2_001.fastq.gz", - "s3_etag": "891e3067ff772d599a5c424f5a93bfd5", - "sha1": "b866551f9f1b449039b4eeeda6c6b05bf3eee72b", - "sha256": "4718d026a1a2fdd13e6c9cb3bb92eb096f24478571cb6045cd3ce54f2623c2e1", - "size": 30926462, - "uuid": "2a2b38af-9776-41c8-b643-2e094ac1c58b", - "version": "2019-03-17T220644.507486Z" - }, - { - "content-type": "application/gzip; dcp-type=data", - "crc32c": "51ffe105", - "indexed": false, - "name": "pbmc4k_1000_S1_L001_I1_001.fastq.gz", - "s3_etag": "3d252f83492bf030ddfd05a5a1411cdc", - "sha1": "02e40d38df063e54310edefe956fc9ed336c70fb", - "sha256": "7f11f8f3a5a8e879d3c7d612f4d37233ebfdd3e226406c013bc375403bae2137", - "size": 3454130, - "uuid": "04a1ab2c-e522-4d73-a881-effa1d9492d1", - "version": "2019-03-17T220644.766900Z" - } -] diff --git a/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/metadata.json b/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/metadata.json deleted file mode 100644 index 7b2d26f70..000000000 --- a/test/hca_metadata_api/cans/staging/eca05046-3dad-4e45-b86c-8720f33a5dde/2019-03-17T220646.332108Z/metadata.json +++ /dev/null @@ -1,558 +0,0 @@ -{ - "cell_suspension_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/9.0.0/cell_suspension", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "cell_ID_1", - "biomaterial_name": "This is a dummy cell", - "biomaterial_description": "This is a dummy donor cell", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DRB1 0401 protective allele", - "biosd_biomaterial": "SAMN00000000", - "insdc_biomaterial": "SRS0000000" - }, - "cell_morphology": { - "cell_morphology": "adherent cells, form single layer colonies", - "cell_size": "20-30", - "cell_size_unit": { - "text": "nm", - "ontology": "UO:0000018", - "ontology_label": "nanometer" - }, - "percent_cell_viability": 85.3, - "cell_viability_method": "Fluorescein diacetate hydrolysis assay", - "cell_viability_result": "pass", - "percent_necrosis": 10.0 - }, - "growth_conditions": { - "passage_number": 22, - "growth_medium": "lysogeny broth (LB) medium", - "mycoplasma_testing_results": "pass", - "drug_treatment": "100 ug/mL ampicillin", - "feeder_layer_type": "feeder-dependent, mouse embryonic fibroblast cells" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "estimated_cell_count": 10000, - "provenance": { - "document_id": "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1", - "submission_date": "2019-03-17T22:00:57.699Z", - "update_date": "2019-03-17T22:01:03.482Z" - } - }, - "specimen_from_organism_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/7.0.3/specimen_from_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "specimen_ID_1", - "biomaterial_name": "This is a dummy specimen", - "biomaterial_description": "This is a dummy donor specimen", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DRB1 0401 protective allele", - "biosd_biomaterial": "SAMN00000000", - "insdc_biomaterial": "SRS0000000" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organ": { - "text": "brain", - "ontology": "UBERON:0000955", - "ontology_label": "brain" - }, - "organ_part": { - "text": "amygdala", - "ontology": "UBERON:0001876", - "ontology_label": "amygdala" - }, - "diseases": [ - { - "text": "H syndrome", - "ontology": "MONDO:0011273", - "ontology_label": "H syndrome" - } - ], - "state_of_specimen": { - "autolysis_score": "none", - "gross_description": "normal color and size" - }, - "provenance": { - "document_id": "f3531ee2-d408-4075-b63e-0d0e2b01116c", - "submission_date": "2019-03-17T22:00:57.694Z", - "update_date": "2019-03-17T22:01:03.535Z" - } - }, - "donor_organism_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/biomaterial/14.0.3/donor_organism", - "schema_type": "biomaterial", - "biomaterial_core": { - "biomaterial_id": "donor_ID_1", - "biomaterial_name": "This is a dummy donor", - "biomaterial_description": "This is a dummy donor description", - "ncbi_taxon_id": [ - 9606 - ], - "genotype": "DRB1 0401 protective allele", - "biosd_biomaterial": "SAMN00000000", - "insdc_biomaterial": "SRS0000000" - }, - "human_specific": { - "body_mass_index": 36.4, - "ethnicity": [ - { - "text": "European", - "ontology": "HANCESTRO:0005", - "ontology_label": "European" - } - ] - }, - "death": { - "cause_of_death": "motor vehicle accident", - "cold_perfused": false, - "days_on_ventilator": 4.0, - "hardy_scale": 0, - "time_of_death": "1999-01-21T00:00:00Z", - "organ_donation_death_type": "Donation after circulatory death (DCD)" - }, - "medical_history": { - "alcohol_history": "1 units/day", - "medication": "Naproxen 500mg/day,", - "nutritional_state": "normal", - "smoking_history": "Smoker, 5/day for 10 years, stopped 1995" - }, - "genus_species": [ - { - "text": "Homo sapiens", - "ontology": "NCBITaxon:9606", - "ontology_label": "Homo sapiens" - } - ], - "organism_age": "20", - "organism_age_unit": { - "text": "year", - "ontology": "UO:0000036", - "ontology_label": "year" - }, - "development_stage": { - "text": "human adult stage", - "ontology": "HsapDv:0000087" - }, - "diseases": [ - { - "text": "H syndrome", - "ontology": "MONDO:0011273", - "ontology_label": "H syndrome" - } - ], - "gestational_age": "5-7", - "height": "160", - "height_unit": { - "text": "cm", - "ontology": "UO:0000015", - "ontology_label": "centimeter" - }, - "is_living": "no", - "weight": "60", - "weight_unit": { - "text": "kg", - "ontology": "UO:0000009", - "ontology_label": "kilogram" - }, - "sex": "male", - "provenance": { - "document_id": "20db3238-9ce6-4820-8495-6753e4147d51", - "submission_date": "2019-03-17T22:00:57.690Z", - "update_date": "2019-03-17T22:01:03.211Z" - } - }, - "sequence_file_0.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "pbmc4k_1000_S1_L001_R1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "eeaf6532a43b731e1ed9068bf32add47" - }, - "read_index": "read1", - "lane_index": 1, - "read_length": 26, - "insdc_run": [ - "SRR0000000" - ], - "provenance": { - "document_id": "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", - "submission_date": "2019-03-17T22:00:57.704Z", - "update_date": "2019-03-17T22:03:04.130Z" - } - }, - "sequence_file_1.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "pbmc4k_1000_S1_L001_R2_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "891e3067ff772d599a5c424f5a93bfd5" - }, - "read_index": "read2", - "lane_index": 1, - "read_length": 98, - "insdc_run": [ - "SRR0000000" - ], - "provenance": { - "document_id": "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", - "submission_date": "2019-03-17T22:00:57.714Z", - "update_date": "2019-03-17T22:03:06.010Z" - } - }, - "sequence_file_2.json": { - "describedBy": "http://schema.staging.data.humancellatlas.org/type/file/7.0.2/sequence_file", - "schema_type": "file", - "file_core": { - "file_name": "pbmc4k_1000_S1_L001_I1_001.fastq.gz", - "file_format": "fastq.gz", - "checksum": "3d252f83492bf030ddfd05a5a1411cdc" - }, - "read_index": "index1", - "lane_index": 1, - "read_length": 8, - "insdc_run": [ - "SRR0000000" - ], - "provenance": { - "document_id": "5201d410-d789-4df6-b3fd-9edac998e5f3", - "submission_date": "2019-03-17T22:00:57.719Z", - "update_date": "2019-03-17T22:03:03.738Z" - } - }, - "project_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/project/11.0.0/project", - "schema_type": "project", - "project_core": { - "project_short_name": "staging/10x/2019-03-17T22:00:54Z", - "project_title": "10x 1 Run Integration Test", - "project_description": "Contains a small file set from the dataset: 4k PBMCs from a Healthy Donor, a Single Cell Gene Expression Dataset by Cell Ranger 2.1.0. Peripheral blood mononuclear cells (PBMCs) were taken from a healthy donor (same donor as pbmc8k). PBMCs are primary cells with relatively small amounts of RNA (~1pg RNA/cell). Data/Analysis can be found here https://support.10xgenomics.com/single-cell-gene-expression/datasets/2.1.0/pbmc4k and all data is licensed under the creative commons attribution license (https://creativecommons.org/licenses/by/4.0/). This test also contains extensive metadata for browser testing. Metadata is fabricated." - }, - "publications": [ - { - "authors": [ - "Doe JD, Doe JJ" - ], - "publication_title": "A title of a publication goes here.", - "doi": "10.1016/j.cell.2016.07.054", - "pmid": 27565351, - "publication_url": "https://europepmc.org" - } - ], - "insdc_project_accessions": [ - "SRP000000", - "SRP000001" - ], - "geo_series_accessions": [ - "GSE00000" - ], - "array_express_accessions": [ - "E-AAAA-00" - ], - "insdc_study_accessions": [ - "PRJNA000000" - ], - "funders": [ - { - "grant_title": "A title of a grant proposal.", - "grant_id": "BB/P0000001/1", - "organization": "Biotechnology and Biological Sciences Research Council (BBSRC)" - } - ], - "contributors": [ - { - "contact_name": "John,D,Doe.", - "email": "dummy@email.com", - "phone": "(+1) 234-555-6789", - "institution": "EMBL-EBI", - "laboratory": "Department of Biology", - "address": "0000 Main Street, Nowheretown, MA, 12091", - "country": "USA", - "corresponding_contributor": false, - "project_role": "principal investigator", - "orcid_id": "0000-1111-2222-3333" - } - ], - "provenance": { - "document_id": "5014cd10-bbed-4e85-bc45-6fe3a8a0079b", - "submission_date": "2019-03-17T22:00:57.685Z", - "update_date": "2019-03-17T22:01:03.175Z" - } - }, - "library_preparation_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/sequencing/4.4.6/library_preparation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "lib_prep_1", - "protocol_name": "A dummy library prep protocol", - "protocol_description": "A dummy library prep description", - "publication_doi": "10.1101/193219", - "protocols_io_doi": "10.17504/protocols.io.mgjc3un", - "document": "my_cool_protocol.pdf" - }, - "input_nucleic_acid_molecule": { - "text": "polyA RNA", - "ontology": "OBI:0000869", - "ontology_label": "polyA RNA" - }, - "nucleic_acid_source": "single cell", - "library_construction_approach": { - "text": "10x v2", - "ontology": "EFO:0009310", - "ontology_label": "10X v2 sequencing" - }, - "end_bias": "3 prime tag", - "primer": "poly-dT", - "strand": "unstranded", - "umi_barcode": { - "barcode_read": "Read 1", - "barcode_offset": 0, - "barcode_length": 16 - }, - "library_preamplification_method": { - "text": "Rapid Amplification of cDNA Ends", - "ontology": "EFO:0004182", - "ontology_label": "Rapid Amplification of cDNA Ends" - }, - "provenance": { - "document_id": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73", - "submission_date": "2019-03-17T22:00:57.735Z", - "update_date": "2019-03-17T22:01:03.138Z" - } - }, - "sequencing_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/sequencing/9.0.11/sequencing_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "sequencing_protocol_1", - "protocol_name": "A dummy sequencing protocol", - "protocol_description": "A dummy sequencing protocol description", - "publication_doi": "10.1101/193219", - "protocols_io_doi": "10.17504/protocols.io.mgjc3un", - "document": "my_cool_protocol.pdf" - }, - "instrument_manufacturer_model": { - "text": "Illumina HiSeq 2500", - "ontology": "EFO:0008565" - }, - "local_machine_name": "Machine1", - "paired_end": false, - "sequencing_approach": { - "text": "full length single cell RNA sequencing", - "ontology": "EFO:0008441", - "ontology_label": "full length single cell RNA sequencing" - }, - "10x": { - "fastq_method": "Cellranger mkfastq", - "fastq_method_version": "Cellranger 2.1.1", - "pooled_channels": 4.0, - "drop_uniformity": false - }, - "provenance": { - "document_id": "4bc436f7-e429-4355-8d6e-853d8e639b37", - "submission_date": "2019-03-17T22:00:57.739Z", - "update_date": "2019-03-17T22:01:02.999Z" - } - }, - "dissociation_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/5.0.8/dissociation_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "dissociation_protocol_1", - "protocol_name": "A dummy dissociation protocol", - "protocol_description": "A dummmy description of a dissociation protocol", - "publication_doi": "10.1101/193219", - "protocols_io_doi": "10.17504/protocols.io.mgjc3un", - "document": "my_cool_protocol.pdf" - }, - "dissociation_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "provenance": { - "document_id": "1e9abdf3-54da-4c73-9e57-1297ceb39399", - "submission_date": "2019-03-17T22:00:57.728Z", - "update_date": "2019-03-17T22:01:03.046Z" - } - }, - "enrichment_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/2.2.9/enrichment_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "enrichment_protocol_1", - "protocol_name": "an example enrichment protocol", - "protocol_description": "an example enrichemnt protocol description", - "publication_doi": "10.1101/193219", - "protocols_io_doi": "10.17504/protocols.io.mgjc3un", - "document": "my_cool_protocol.pdf" - }, - "enrichment_method": { - "text": "fluorescence-activated cell sorting", - "ontology": "EFO:0009108", - "ontology_label": "fluorescence-activated cell sorting" - }, - "markers": "CD4+ CD8-", - "min_size_selected": 70.0, - "max_size_selected": 90.0, - "provenance": { - "document_id": "df679627-ccb6-426d-a709-c259db607d84", - "submission_date": "2019-03-17T22:00:57.731Z", - "update_date": "2019-03-17T22:01:03.051Z" - } - }, - "collection_protocol_0.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/type/protocol/biomaterial_collection/8.2.11/collection_protocol", - "schema_type": "protocol", - "protocol_core": { - "protocol_id": "collection_protocol_1", - "protocol_name": "A dummy collection protocol", - "protocol_description": "A dummy collection protocol description", - "publication_doi": "10.1101/193219", - "protocols_io_doi": "10.17504/protocols.io.mgjc3un", - "document": "my_cool_protocol.pdf" - }, - "collection_method": { - "text": "organ extraction", - "ontology": "EFO:0009124", - "ontology_label": "organ extraction" - }, - "protocol_reagents": [ - { - "retail_name": "SureCell WTA 3' Library Prep Kit", - "catalog_number": "20014279", - "manufacturer": "Illumina", - "lot_number": "10001A", - "expiry_date": "2018-01-31", - "kit_titer": "Titer: Specification is 3.0x10^7" - } - ], - "provenance": { - "document_id": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de", - "submission_date": "2019-03-17T22:00:57.724Z", - "update_date": "2019-03-17T22:01:03.060Z" - } - }, - "process_0.json": { - "process_core": { - "process_id": "bundle1" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", - "provenance": { - "document_id": "8a0879df-13e0-4dce-9776-20fb259796e9", - "submission_date": "2019-03-17T22:00:57.752Z", - "update_date": "2019-03-17T22:01:03.421Z" - } - }, - "process_1.json": { - "process_core": { - "process_id": "process_id_2" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", - "provenance": { - "document_id": "b2e86d49-6874-4522-a68c-43166e858bdd", - "submission_date": "2019-03-17T22:00:57.748Z", - "update_date": "2019-03-17T22:01:03.392Z" - } - }, - "process_2.json": { - "process_core": { - "process_id": "process_id_1" - }, - "schema_type": "process", - "describedBy": "https://schema.staging.data.humancellatlas.org/type/process/6.0.7/process", - "provenance": { - "document_id": "b147df84-443b-4dd2-8327-7ea42adcd151", - "submission_date": "2019-03-17T22:00:57.743Z", - "update_date": "2019-03-17T22:01:03.254Z" - } - }, - "links.json": { - "describedBy": "https://schema.staging.data.humancellatlas.org/system/1.1.5/links", - "schema_type": "link_bundle", - "schema_version": "1.1.5", - "links": [ - { - "process": "8a0879df-13e0-4dce-9776-20fb259796e9", - "inputs": [ - "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1" - ], - "input_type": "biomaterial", - "outputs": [ - "6380c3bc-8bc3-459b-aea3-05dd6c0842ef", - "ceb4dfaa-ecaf-4757-ae54-9d83707f66cc", - "5201d410-d789-4df6-b3fd-9edac998e5f3" - ], - "output_type": "file", - "protocols": [ - { - "protocol_type": "library_preparation_protocol", - "protocol_id": "aa7e9a08-2a0c-4575-a9a9-13cab4e96e73" - }, - { - "protocol_type": "sequencing_protocol", - "protocol_id": "4bc436f7-e429-4355-8d6e-853d8e639b37" - } - ] - }, - { - "process": "b2e86d49-6874-4522-a68c-43166e858bdd", - "inputs": [ - "f3531ee2-d408-4075-b63e-0d0e2b01116c" - ], - "input_type": "biomaterial", - "outputs": [ - "74a06f8b-dff1-44d2-b1a6-99e3d14b69d1" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "dissociation_protocol", - "protocol_id": "1e9abdf3-54da-4c73-9e57-1297ceb39399" - }, - { - "protocol_type": "enrichment_protocol", - "protocol_id": "df679627-ccb6-426d-a709-c259db607d84" - } - ] - }, - { - "process": "b147df84-443b-4dd2-8327-7ea42adcd151", - "inputs": [ - "20db3238-9ce6-4820-8495-6753e4147d51" - ], - "input_type": "biomaterial", - "outputs": [ - "f3531ee2-d408-4075-b63e-0d0e2b01116c" - ], - "output_type": "biomaterial", - "protocols": [ - { - "protocol_type": "collection_protocol", - "protocol_id": "c3dabd8c-6f32-4c0b-a13b-11bb71cc95de" - } - ] - } - ] - } -} diff --git a/test/hca_metadata_api/test.py b/test/hca_metadata_api/test.py index 6a2af0981..c5d29d872 100644 --- a/test/hca_metadata_api/test.py +++ b/test/hca_metadata_api/test.py @@ -153,32 +153,28 @@ def _test_example_bundle(self, directory, **kwargs): **kwargs) def _canned_bundle_path(self, directory, uuid, version): - return os.path.join(os.path.dirname(__file__), 'cans', directory, uuid, version) + return os.path.join(os.path.dirname(__file__), 'cans', directory, f'{uuid}.{version}.json') def _can_bundle(self, directory, uuid, version, manifest, metadata_files): # pragma: no cover """ Save a bundle's manifest & metadata files to a local directory """ - dir_path = self._canned_bundle_path(directory, uuid, version) - os.makedirs(dir_path, exist_ok=True) - with atomic_write(os.path.join(dir_path, 'manifest.json'), overwrite=True) as f: - json.dump(manifest, f) - with atomic_write(os.path.join(dir_path, 'metadata.json'), overwrite=True) as f: - json.dump(metadata_files, f) + path = self._canned_bundle_path(directory, uuid, version) + os.makedirs(directory, exist_ok=True) + with atomic_write(path, overwrite=True) as f: + json.dump({ + 'manifest': manifest, + 'metadata': metadata_files + }, f) def _canned_bundle(self, directory, uuid, version): """ Load a previously canned bundle """ dir_path = self._canned_bundle_path(directory, uuid, version) - if os.path.isdir(dir_path): - with open(os.path.join(dir_path, 'manifest.json')) as f: - manifest = json.load(f) - with open(os.path.join(dir_path, 'metadata.json')) as f: - metadata_files = json.load(f) - return manifest, metadata_files - else: - return None, None + with open(dir_path) as f: + bundle = json.load(f) + return bundle['manifest'], bundle['metadata'] def test_v5_bundle(self): """