notes/lesson_12_biopython.html

<!DOCTYPE html>
<html>
<head><meta charset="utf-8" />

<title>lesson_12_biopython</title>

<script src="https://cdnjs.cloudflare.com/ajax/libs/require.js/2.1.10/require.min.js"></script>
<script src="https://cdnjs.cloudflare.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script>


<style type="text/css">
    /*!
*
* Twitter Bootstrap
*
*/
/*!
 * Bootstrap v3.3.7 (http://getbootstrap.com)
 * Copyright 2011-2016 Twitter, Inc.
 * Licensed under MIT (https://github.com/twbs/bootstrap/blob/master/LICENSE)
 */
/*! normalize.css v3.0.3 | MIT License | github.com/necolas/normalize.css */
html {
  font-family: sans-serif;
  -ms-text-size-adjust: 100%;
  -webkit-text-size-adjust: 100%;
}
body {
  margin: 0;
}
article,
aside,
details,
figcaption,
figure,
footer,
header,
hgroup,
main,
menu,
nav,
section,
summary {
  display: block;
}
audio,
canvas,
progress,
video {
  display: inline-block;
  vertical-align: baseline;
}
audio:not([controls]) {
  display: none;
  height: 0;
}
[hidden],
template {
  display: none;
}
a {
  background-color: transparent;
}
a:active,
a:hover {
  outline: 0;
}
abbr[title] {
  border-bottom: 1px dotted;
}
b,
strong {
  font-weight: bold;
}
dfn {
  font-style: italic;
}
h1 {
  font-size: 2em;
  margin: 0.67em 0;
}
mark {
  background: #ff0;
  color: #000;
}
small {
  font-size: 80%;
}
sub,
sup {
  font-size: 75%;
  line-height: 0;
  position: relative;
  vertical-align: baseline;
}
sup {
  top: -0.5em;
}
sub {
  bottom: -0.25em;
}
img {
  border: 0;
}
svg:not(:root) {
  overflow: hidden;
}
figure {
  margin: 1em 40px;
}
hr {
  box-sizing: content-box;
  height: 0;
}
pre {
  overflow: auto;
}
code,
kbd,
pre,
samp {
  font-family: monospace, monospace;
  font-size: 1em;
}
button,
input,
optgroup,
select,
textarea {
  color: inherit;
  font: inherit;
  margin: 0;
}
button {
  overflow: visible;
}
button,
select {
  text-transform: none;
}
button,
html input[type="button"],
input[type="reset"],
input[type="submit"] {
  -webkit-appearance: button;
  cursor: pointer;
}
button[disabled],
html input[disabled] {
  cursor: default;
}
button::-moz-focus-inner,
input::-moz-focus-inner {
  border: 0;
  padding: 0;
}
input {
  line-height: normal;
}
input[type="checkbox"],
input[type="radio"] {
  box-sizing: border-box;
  padding: 0;
}
input[type="number"]::-webkit-inner-spin-button,
input[type="number"]::-webkit-outer-spin-button {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: textfield;
  box-sizing: content-box;
}
input[type="search"]::-webkit-search-cancel-button,
input[type="search"]::-webkit-search-decoration {
  -webkit-appearance: none;
}
fieldset {
  border: 1px solid #c0c0c0;
  margin: 0 2px;
  padding: 0.35em 0.625em 0.75em;
}
legend {
  border: 0;
  padding: 0;
}
textarea {
  overflow: auto;
}
optgroup {
  font-weight: bold;
}
table {
  border-collapse: collapse;
  border-spacing: 0;
}
td,
th {
  padding: 0;
}
/*! Source: https://github.com/h5bp/html5-boilerplate/blob/master/src/css/main.css */
@media print {
  *,
  *:before,
  *:after {
    background: transparent !important;
    box-shadow: none !important;
    text-shadow: none !important;
  }
  a,
  a:visited {
    text-decoration: underline;
  }
  a[href]:after {
    content: " (" attr(href) ")";
  }
  abbr[title]:after {
    content: " (" attr(title) ")";
  }
  a[href^="#"]:after,
  a[href^="javascript:"]:after {
    content: "";
  }
  pre,
  blockquote {
    border: 1px solid #999;
    page-break-inside: avoid;
  }
  thead {
    display: table-header-group;
  }
  tr,
  img {
    page-break-inside: avoid;
  }
  img {
    max-width: 100% !important;
  }
  p,
  h2,
  h3 {
    orphans: 3;
    widows: 3;
  }
  h2,
  h3 {
    page-break-after: avoid;
  }
  .navbar {
    display: none;
  }
  .btn > .caret,
  .dropup > .btn > .caret {
    border-top-color: #000 !important;
  }
  .label {
    border: 1px solid #000;
  }
  .table {
    border-collapse: collapse !important;
  }
  .table td,
  .table th {
    background-color: #fff !important;
  }
  .table-bordered th,
  .table-bordered td {
    border: 1px solid #ddd !important;
  }
}
@font-face {
  font-family: 'Glyphicons Halflings';
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot');
  src: url('../components/bootstrap/fonts/glyphicons-halflings-regular.eot?#iefix') format('embedded-opentype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff2') format('woff2'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.woff') format('woff'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.ttf') format('truetype'), url('../components/bootstrap/fonts/glyphicons-halflings-regular.svg#glyphicons_halflingsregular') format('svg');
}
.glyphicon {
  position: relative;
  top: 1px;
  display: inline-block;
  font-family: 'Glyphicons Halflings';
  font-style: normal;
  font-weight: normal;
  line-height: 1;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
.glyphicon-asterisk:before {
  content: "\002a";
}
.glyphicon-plus:before {
  content: "\002b";
}
.glyphicon-euro:before,
.glyphicon-eur:before {
  content: "\20ac";
}
.glyphicon-minus:before {
  content: "\2212";
}
.glyphicon-cloud:before {
  content: "\2601";
}
.glyphicon-envelope:before {
  content: "\2709";
}
.glyphicon-pencil:before {
  content: "\270f";
}
.glyphicon-glass:before {
  content: "\e001";
}
.glyphicon-music:before {
  content: "\e002";
}
.glyphicon-search:before {
  content: "\e003";
}
.glyphicon-heart:before {
  content: "\e005";
}
.glyphicon-star:before {
  content: "\e006";
}
.glyphicon-star-empty:before {
  content: "\e007";
}
.glyphicon-user:before {
  content: "\e008";
}
.glyphicon-film:before {
  content: "\e009";
}
.glyphicon-th-large:before {
  content: "\e010";
}
.glyphicon-th:before {
  content: "\e011";
}
.glyphicon-th-list:before {
  content: "\e012";
}
.glyphicon-ok:before {
  content: "\e013";
}
.glyphicon-remove:before {
  content: "\e014";
}
.glyphicon-zoom-in:before {
  content: "\e015";
}
.glyphicon-zoom-out:before {
  content: "\e016";
}
.glyphicon-off:before {
  content: "\e017";
}
.glyphicon-signal:before {
  content: "\e018";
}
.glyphicon-cog:before {
  content: "\e019";
}
.glyphicon-trash:before {
  content: "\e020";
}
.glyphicon-home:before {
  content: "\e021";
}
.glyphicon-file:before {
  content: "\e022";
}
.glyphicon-time:before {
  content: "\e023";
}
.glyphicon-road:before {
  content: "\e024";
}
.glyphicon-download-alt:before {
  content: "\e025";
}
.glyphicon-download:before {
  content: "\e026";
}
.glyphicon-upload:before {
  content: "\e027";
}
.glyphicon-inbox:before {
  content: "\e028";
}
.glyphicon-play-circle:before {
  content: "\e029";
}
.glyphicon-repeat:before {
  content: "\e030";
}
.glyphicon-refresh:before {
  content: "\e031";
}
.glyphicon-list-alt:before {
  content: "\e032";
}
.glyphicon-lock:before {
  content: "\e033";
}
.glyphicon-flag:before {
  content: "\e034";
}
.glyphicon-headphones:before {
  content: "\e035";
}
.glyphicon-volume-off:before {
  content: "\e036";
}
.glyphicon-volume-down:before {
  content: "\e037";
}
.glyphicon-volume-up:before {
  content: "\e038";
}
.glyphicon-qrcode:before {
  content: "\e039";
}
.glyphicon-barcode:before {
  content: "\e040";
}
.glyphicon-tag:before {
  content: "\e041";
}
.glyphicon-tags:before {
  content: "\e042";
}
.glyphicon-book:before {
  content: "\e043";
}
.glyphicon-bookmark:before {
  content: "\e044";
}
.glyphicon-print:before {
  content: "\e045";
}
.glyphicon-camera:before {
  content: "\e046";
}
.glyphicon-font:before {
  content: "\e047";
}
.glyphicon-bold:before {
  content: "\e048";
}
.glyphicon-italic:before {
  content: "\e049";
}
.glyphicon-text-height:before {
  content: "\e050";
}
.glyphicon-text-width:before {
  content: "\e051";
}
.glyphicon-align-left:before {
  content: "\e052";
}
.glyphicon-align-center:before {
  content: "\e053";
}
.glyphicon-align-right:before {
  content: "\e054";
}
.glyphicon-align-justify:before {
  content: "\e055";
}
.glyphicon-list:before {
  content: "\e056";
}
.glyphicon-indent-left:before {
  content: "\e057";
}
.glyphicon-indent-right:before {
  content: "\e058";
}
.glyphicon-facetime-video:before {
  content: "\e059";
}
.glyphicon-picture:before {
  content: "\e060";
}
.glyphicon-map-marker:before {
  content: "\e062";
}
.glyphicon-adjust:before {
  content: "\e063";
}
.glyphicon-tint:before {
  content: "\e064";
}
.glyphicon-edit:before {
  content: "\e065";
}
.glyphicon-share:before {
  content: "\e066";
}
.glyphicon-check:before {
  content: "\e067";
}
.glyphicon-move:before {
  content: "\e068";
}
.glyphicon-step-backward:before {
  content: "\e069";
}
.glyphicon-fast-backward:before {
  content: "\e070";
}
.glyphicon-backward:before {
  content: "\e071";
}
.glyphicon-play:before {
  content: "\e072";
}
.glyphicon-pause:before {
  content: "\e073";
}
.glyphicon-stop:before {
  content: "\e074";
}
.glyphicon-forward:before {
  content: "\e075";
}
.glyphicon-fast-forward:before {
  content: "\e076";
}
.glyphicon-step-forward:before {
  content: "\e077";
}
.glyphicon-eject:before {
  content: "\e078";
}
.glyphicon-chevron-left:before {
  content: "\e079";
}
.glyphicon-chevron-right:before {
  content: "\e080";
}
.glyphicon-plus-sign:before {
  content: "\e081";
}
.glyphicon-minus-sign:before {
  content: "\e082";
}
.glyphicon-remove-sign:before {
  content: "\e083";
}
.glyphicon-ok-sign:before {
  content: "\e084";
}
.glyphicon-question-sign:before {
  content: "\e085";
}
.glyphicon-info-sign:before {
  content: "\e086";
}
.glyphicon-screenshot:before {
  content: "\e087";
}
.glyphicon-remove-circle:before {
  content: "\e088";
}
.glyphicon-ok-circle:before {
  content: "\e089";
}
.glyphicon-ban-circle:before {
  content: "\e090";
}
.glyphicon-arrow-left:before {
  content: "\e091";
}
.glyphicon-arrow-right:before {
  content: "\e092";
}
.glyphicon-arrow-up:before {
  content: "\e093";
}
.glyphicon-arrow-down:before {
  content: "\e094";
}
.glyphicon-share-alt:before {
  content: "\e095";
}
.glyphicon-resize-full:before {
  content: "\e096";
}
.glyphicon-resize-small:before {
  content: "\e097";
}
.glyphicon-exclamation-sign:before {
  content: "\e101";
}
.glyphicon-gift:before {
  content: "\e102";
}
.glyphicon-leaf:before {
  content: "\e103";
}
.glyphicon-fire:before {
  content: "\e104";
}
.glyphicon-eye-open:before {
  content: "\e105";
}
.glyphicon-eye-close:before {
  content: "\e106";
}
.glyphicon-warning-sign:before {
  content: "\e107";
}
.glyphicon-plane:before {
  content: "\e108";
}
.glyphicon-calendar:before {
  content: "\e109";
}
.glyphicon-random:before {
  content: "\e110";
}
.glyphicon-comment:before {
  content: "\e111";
}
.glyphicon-magnet:before {
  content: "\e112";
}
.glyphicon-chevron-up:before {
  content: "\e113";
}
.glyphicon-chevron-down:before {
  content: "\e114";
}
.glyphicon-retweet:before {
  content: "\e115";
}
.glyphicon-shopping-cart:before {
  content: "\e116";
}
.glyphicon-folder-close:before {
  content: "\e117";
}
.glyphicon-folder-open:before {
  content: "\e118";
}
.glyphicon-resize-vertical:before {
  content: "\e119";
}
.glyphicon-resize-horizontal:before {
  content: "\e120";
}
.glyphicon-hdd:before {
  content: "\e121";
}
.glyphicon-bullhorn:before {
  content: "\e122";
}
.glyphicon-bell:before {
  content: "\e123";
}
.glyphicon-certificate:before {
  content: "\e124";
}
.glyphicon-thumbs-up:before {
  content: "\e125";
}
.glyphicon-thumbs-down:before {
  content: "\e126";
}
.glyphicon-hand-right:before {
  content: "\e127";
}
.glyphicon-hand-left:before {
  content: "\e128";
}
.glyphicon-hand-up:before {
  content: "\e129";
}
.glyphicon-hand-down:before {
  content: "\e130";
}
.glyphicon-circle-arrow-right:before {
  content: "\e131";
}
.glyphicon-circle-arrow-left:before {
  content: "\e132";
}
.glyphicon-circle-arrow-up:before {
  content: "\e133";
}
.glyphicon-circle-arrow-down:before {
  content: "\e134";
}
.glyphicon-globe:before {
  content: "\e135";
}
.glyphicon-wrench:before {
  content: "\e136";
}
.glyphicon-tasks:before {
  content: "\e137";
}
.glyphicon-filter:before {
  content: "\e138";
}
.glyphicon-briefcase:before {
  content: "\e139";
}
.glyphicon-fullscreen:before {
  content: "\e140";
}
.glyphicon-dashboard:before {
  content: "\e141";
}
.glyphicon-paperclip:before {
  content: "\e142";
}
.glyphicon-heart-empty:before {
  content: "\e143";
}
.glyphicon-link:before {
  content: "\e144";
}
.glyphicon-phone:before {
  content: "\e145";
}
.glyphicon-pushpin:before {
  content: "\e146";
}
.glyphicon-usd:before {
  content: "\e148";
}
.glyphicon-gbp:before {
  content: "\e149";
}
.glyphicon-sort:before {
  content: "\e150";
}
.glyphicon-sort-by-alphabet:before {
  content: "\e151";
}
.glyphicon-sort-by-alphabet-alt:before {
  content: "\e152";
}
.glyphicon-sort-by-order:before {
  content: "\e153";
}
.glyphicon-sort-by-order-alt:before {
  content: "\e154";
}
.glyphicon-sort-by-attributes:before {
  content: "\e155";
}
.glyphicon-sort-by-attributes-alt:before {
  content: "\e156";
}
.glyphicon-unchecked:before {
  content: "\e157";
}
.glyphicon-expand:before {
  content: "\e158";
}
.glyphicon-collapse-down:before {
  content: "\e159";
}
.glyphicon-collapse-up:before {
  content: "\e160";
}
.glyphicon-log-in:before {
  content: "\e161";
}
.glyphicon-flash:before {
  content: "\e162";
}
.glyphicon-log-out:before {
  content: "\e163";
}
.glyphicon-new-window:before {
  content: "\e164";
}
.glyphicon-record:before {
  content: "\e165";
}
.glyphicon-save:before {
  content: "\e166";
}
.glyphicon-open:before {
  content: "\e167";
}
.glyphicon-saved:before {
  content: "\e168";
}
.glyphicon-import:before {
  content: "\e169";
}
.glyphicon-export:before {
  content: "\e170";
}
.glyphicon-send:before {
  content: "\e171";
}
.glyphicon-floppy-disk:before {
  content: "\e172";
}
.glyphicon-floppy-saved:before {
  content: "\e173";
}
.glyphicon-floppy-remove:before {
  content: "\e174";
}
.glyphicon-floppy-save:before {
  content: "\e175";
}
.glyphicon-floppy-open:before {
  content: "\e176";
}
.glyphicon-credit-card:before {
  content: "\e177";
}
.glyphicon-transfer:before {
  content: "\e178";
}
.glyphicon-cutlery:before {
  content: "\e179";
}
.glyphicon-header:before {
  content: "\e180";
}
.glyphicon-compressed:before {
  content: "\e181";
}
.glyphicon-earphone:before {
  content: "\e182";
}
.glyphicon-phone-alt:before {
  content: "\e183";
}
.glyphicon-tower:before {
  content: "\e184";
}
.glyphicon-stats:before {
  content: "\e185";
}
.glyphicon-sd-video:before {
  content: "\e186";
}
.glyphicon-hd-video:before {
  content: "\e187";
}
.glyphicon-subtitles:before {
  content: "\e188";
}
.glyphicon-sound-stereo:before {
  content: "\e189";
}
.glyphicon-sound-dolby:before {
  content: "\e190";
}
.glyphicon-sound-5-1:before {
  content: "\e191";
}
.glyphicon-sound-6-1:before {
  content: "\e192";
}
.glyphicon-sound-7-1:before {
  content: "\e193";
}
.glyphicon-copyright-mark:before {
  content: "\e194";
}
.glyphicon-registration-mark:before {
  content: "\e195";
}
.glyphicon-cloud-download:before {
  content: "\e197";
}
.glyphicon-cloud-upload:before {
  content: "\e198";
}
.glyphicon-tree-conifer:before {
  content: "\e199";
}
.glyphicon-tree-deciduous:before {
  content: "\e200";
}
.glyphicon-cd:before {
  content: "\e201";
}
.glyphicon-save-file:before {
  content: "\e202";
}
.glyphicon-open-file:before {
  content: "\e203";
}
.glyphicon-level-up:before {
  content: "\e204";
}
.glyphicon-copy:before {
  content: "\e205";
}
.glyphicon-paste:before {
  content: "\e206";
}
.glyphicon-alert:before {
  content: "\e209";
}
.glyphicon-equalizer:before {
  content: "\e210";
}
.glyphicon-king:before {
  content: "\e211";
}
.glyphicon-queen:before {
  content: "\e212";
}
.glyphicon-pawn:before {
  content: "\e213";
}
.glyphicon-bishop:before {
  content: "\e214";
}
.glyphicon-knight:before {
  content: "\e215";
}
.glyphicon-baby-formula:before {
  content: "\e216";
}
.glyphicon-tent:before {
  content: "\26fa";
}
.glyphicon-blackboard:before {
  content: "\e218";
}
.glyphicon-bed:before {
  content: "\e219";
}
.glyphicon-apple:before {
  content: "\f8ff";
}
.glyphicon-erase:before {
  content: "\e221";
}
.glyphicon-hourglass:before {
  content: "\231b";
}
.glyphicon-lamp:before {
  content: "\e223";
}
.glyphicon-duplicate:before {
  content: "\e224";
}
.glyphicon-piggy-bank:before {
  content: "\e225";
}
.glyphicon-scissors:before {
  content: "\e226";
}
.glyphicon-bitcoin:before {
  content: "\e227";
}
.glyphicon-btc:before {
  content: "\e227";
}
.glyphicon-xbt:before {
  content: "\e227";
}
.glyphicon-yen:before {
  content: "\00a5";
}
.glyphicon-jpy:before {
  content: "\00a5";
}
.glyphicon-ruble:before {
  content: "\20bd";
}
.glyphicon-rub:before {
  content: "\20bd";
}
.glyphicon-scale:before {
  content: "\e230";
}
.glyphicon-ice-lolly:before {
  content: "\e231";
}
.glyphicon-ice-lolly-tasted:before {
  content: "\e232";
}
.glyphicon-education:before {
  content: "\e233";
}
.glyphicon-option-horizontal:before {
  content: "\e234";
}
.glyphicon-option-vertical:before {
  content: "\e235";
}
.glyphicon-menu-hamburger:before {
  content: "\e236";
}
.glyphicon-modal-window:before {
  content: "\e237";
}
.glyphicon-oil:before {
  content: "\e238";
}
.glyphicon-grain:before {
  content: "\e239";
}
.glyphicon-sunglasses:before {
  content: "\e240";
}
.glyphicon-text-size:before {
  content: "\e241";
}
.glyphicon-text-color:before {
  content: "\e242";
}
.glyphicon-text-background:before {
  content: "\e243";
}
.glyphicon-object-align-top:before {
  content: "\e244";
}
.glyphicon-object-align-bottom:before {
  content: "\e245";
}
.glyphicon-object-align-horizontal:before {
  content: "\e246";
}
.glyphicon-object-align-left:before {
  content: "\e247";
}
.glyphicon-object-align-vertical:before {
  content: "\e248";
}
.glyphicon-object-align-right:before {
  content: "\e249";
}
.glyphicon-triangle-right:before {
  content: "\e250";
}
.glyphicon-triangle-left:before {
  content: "\e251";
}
.glyphicon-triangle-bottom:before {
  content: "\e252";
}
.glyphicon-triangle-top:before {
  content: "\e253";
}
.glyphicon-console:before {
  content: "\e254";
}
.glyphicon-superscript:before {
  content: "\e255";
}
.glyphicon-subscript:before {
  content: "\e256";
}
.glyphicon-menu-left:before {
  content: "\e257";
}
.glyphicon-menu-right:before {
  content: "\e258";
}
.glyphicon-menu-down:before {
  content: "\e259";
}
.glyphicon-menu-up:before {
  content: "\e260";
}
* {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
*:before,
*:after {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
html {
  font-size: 10px;
  -webkit-tap-highlight-color: rgba(0, 0, 0, 0);
}
body {
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-size: 13px;
  line-height: 1.42857143;
  color: #000;
  background-color: #fff;
}
input,
button,
select,
textarea {
  font-family: inherit;
  font-size: inherit;
  line-height: inherit;
}
a {
  color: #337ab7;
  text-decoration: none;
}
a:hover,
a:focus {
  color: #23527c;
  text-decoration: underline;
}
a:focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
figure {
  margin: 0;
}
img {
  vertical-align: middle;
}
.img-responsive,
.thumbnail > img,
.thumbnail a > img,
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  display: block;
  max-width: 100%;
  height: auto;
}
.img-rounded {
  border-radius: 3px;
}
.img-thumbnail {
  padding: 4px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: all 0.2s ease-in-out;
  -o-transition: all 0.2s ease-in-out;
  transition: all 0.2s ease-in-out;
  display: inline-block;
  max-width: 100%;
  height: auto;
}
.img-circle {
  border-radius: 50%;
}
hr {
  margin-top: 18px;
  margin-bottom: 18px;
  border: 0;
  border-top: 1px solid #eeeeee;
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  margin: -1px;
  padding: 0;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
[role="button"] {
  cursor: pointer;
}
h1,
h2,
h3,
h4,
h5,
h6,
.h1,
.h2,
.h3,
.h4,
.h5,
.h6 {
  font-family: inherit;
  font-weight: 500;
  line-height: 1.1;
  color: inherit;
}
h1 small,
h2 small,
h3 small,
h4 small,
h5 small,
h6 small,
.h1 small,
.h2 small,
.h3 small,
.h4 small,
.h5 small,
.h6 small,
h1 .small,
h2 .small,
h3 .small,
h4 .small,
h5 .small,
h6 .small,
.h1 .small,
.h2 .small,
.h3 .small,
.h4 .small,
.h5 .small,
.h6 .small {
  font-weight: normal;
  line-height: 1;
  color: #777777;
}
h1,
.h1,
h2,
.h2,
h3,
.h3 {
  margin-top: 18px;
  margin-bottom: 9px;
}
h1 small,
.h1 small,
h2 small,
.h2 small,
h3 small,
.h3 small,
h1 .small,
.h1 .small,
h2 .small,
.h2 .small,
h3 .small,
.h3 .small {
  font-size: 65%;
}
h4,
.h4,
h5,
.h5,
h6,
.h6 {
  margin-top: 9px;
  margin-bottom: 9px;
}
h4 small,
.h4 small,
h5 small,
.h5 small,
h6 small,
.h6 small,
h4 .small,
.h4 .small,
h5 .small,
.h5 .small,
h6 .small,
.h6 .small {
  font-size: 75%;
}
h1,
.h1 {
  font-size: 33px;
}
h2,
.h2 {
  font-size: 27px;
}
h3,
.h3 {
  font-size: 23px;
}
h4,
.h4 {
  font-size: 17px;
}
h5,
.h5 {
  font-size: 13px;
}
h6,
.h6 {
  font-size: 12px;
}
p {
  margin: 0 0 9px;
}
.lead {
  margin-bottom: 18px;
  font-size: 14px;
  font-weight: 300;
  line-height: 1.4;
}
@media (min-width: 768px) {
  .lead {
    font-size: 19.5px;
  }
}
small,
.small {
  font-size: 92%;
}
mark,
.mark {
  background-color: #fcf8e3;
  padding: .2em;
}
.text-left {
  text-align: left;
}
.text-right {
  text-align: right;
}
.text-center {
  text-align: center;
}
.text-justify {
  text-align: justify;
}
.text-nowrap {
  white-space: nowrap;
}
.text-lowercase {
  text-transform: lowercase;
}
.text-uppercase {
  text-transform: uppercase;
}
.text-capitalize {
  text-transform: capitalize;
}
.text-muted {
  color: #777777;
}
.text-primary {
  color: #337ab7;
}
a.text-primary:hover,
a.text-primary:focus {
  color: #286090;
}
.text-success {
  color: #3c763d;
}
a.text-success:hover,
a.text-success:focus {
  color: #2b542c;
}
.text-info {
  color: #31708f;
}
a.text-info:hover,
a.text-info:focus {
  color: #245269;
}
.text-warning {
  color: #8a6d3b;
}
a.text-warning:hover,
a.text-warning:focus {
  color: #66512c;
}
.text-danger {
  color: #a94442;
}
a.text-danger:hover,
a.text-danger:focus {
  color: #843534;
}
.bg-primary {
  color: #fff;
  background-color: #337ab7;
}
a.bg-primary:hover,
a.bg-primary:focus {
  background-color: #286090;
}
.bg-success {
  background-color: #dff0d8;
}
a.bg-success:hover,
a.bg-success:focus {
  background-color: #c1e2b3;
}
.bg-info {
  background-color: #d9edf7;
}
a.bg-info:hover,
a.bg-info:focus {
  background-color: #afd9ee;
}
.bg-warning {
  background-color: #fcf8e3;
}
a.bg-warning:hover,
a.bg-warning:focus {
  background-color: #f7ecb5;
}
.bg-danger {
  background-color: #f2dede;
}
a.bg-danger:hover,
a.bg-danger:focus {
  background-color: #e4b9b9;
}
.page-header {
  padding-bottom: 8px;
  margin: 36px 0 18px;
  border-bottom: 1px solid #eeeeee;
}
ul,
ol {
  margin-top: 0;
  margin-bottom: 9px;
}
ul ul,
ol ul,
ul ol,
ol ol {
  margin-bottom: 0;
}
.list-unstyled {
  padding-left: 0;
  list-style: none;
}
.list-inline {
  padding-left: 0;
  list-style: none;
  margin-left: -5px;
}
.list-inline > li {
  display: inline-block;
  padding-left: 5px;
  padding-right: 5px;
}
dl {
  margin-top: 0;
  margin-bottom: 18px;
}
dt,
dd {
  line-height: 1.42857143;
}
dt {
  font-weight: bold;
}
dd {
  margin-left: 0;
}
@media (min-width: 541px) {
  .dl-horizontal dt {
    float: left;
    width: 160px;
    clear: left;
    text-align: right;
    overflow: hidden;
    text-overflow: ellipsis;
    white-space: nowrap;
  }
  .dl-horizontal dd {
    margin-left: 180px;
  }
}
abbr[title],
abbr[data-original-title] {
  cursor: help;
  border-bottom: 1px dotted #777777;
}
.initialism {
  font-size: 90%;
  text-transform: uppercase;
}
blockquote {
  padding: 9px 18px;
  margin: 0 0 18px;
  font-size: inherit;
  border-left: 5px solid #eeeeee;
}
blockquote p:last-child,
blockquote ul:last-child,
blockquote ol:last-child {
  margin-bottom: 0;
}
blockquote footer,
blockquote small,
blockquote .small {
  display: block;
  font-size: 80%;
  line-height: 1.42857143;
  color: #777777;
}
blockquote footer:before,
blockquote small:before,
blockquote .small:before {
  content: '\2014 \00A0';
}
.blockquote-reverse,
blockquote.pull-right {
  padding-right: 15px;
  padding-left: 0;
  border-right: 5px solid #eeeeee;
  border-left: 0;
  text-align: right;
}
.blockquote-reverse footer:before,
blockquote.pull-right footer:before,
.blockquote-reverse small:before,
blockquote.pull-right small:before,
.blockquote-reverse .small:before,
blockquote.pull-right .small:before {
  content: '';
}
.blockquote-reverse footer:after,
blockquote.pull-right footer:after,
.blockquote-reverse small:after,
blockquote.pull-right small:after,
.blockquote-reverse .small:after,
blockquote.pull-right .small:after {
  content: '\00A0 \2014';
}
address {
  margin-bottom: 18px;
  font-style: normal;
  line-height: 1.42857143;
}
code,
kbd,
pre,
samp {
  font-family: monospace;
}
code {
  padding: 2px 4px;
  font-size: 90%;
  color: #c7254e;
  background-color: #f9f2f4;
  border-radius: 2px;
}
kbd {
  padding: 2px 4px;
  font-size: 90%;
  color: #888;
  background-color: transparent;
  border-radius: 1px;
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.25);
}
kbd kbd {
  padding: 0;
  font-size: 100%;
  font-weight: bold;
  box-shadow: none;
}
pre {
  display: block;
  padding: 8.5px;
  margin: 0 0 9px;
  font-size: 12px;
  line-height: 1.42857143;
  word-break: break-all;
  word-wrap: break-word;
  color: #333333;
  background-color: #f5f5f5;
  border: 1px solid #ccc;
  border-radius: 2px;
}
pre code {
  padding: 0;
  font-size: inherit;
  color: inherit;
  white-space: pre-wrap;
  background-color: transparent;
  border-radius: 0;
}
.pre-scrollable {
  max-height: 340px;
  overflow-y: scroll;
}
.container {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
@media (min-width: 768px) {
  .container {
    width: 768px;
  }
}
@media (min-width: 992px) {
  .container {
    width: 940px;
  }
}
@media (min-width: 1200px) {
  .container {
    width: 1140px;
  }
}
.container-fluid {
  margin-right: auto;
  margin-left: auto;
  padding-left: 0px;
  padding-right: 0px;
}
.row {
  margin-left: 0px;
  margin-right: 0px;
}
.col-xs-1, .col-sm-1, .col-md-1, .col-lg-1, .col-xs-2, .col-sm-2, .col-md-2, .col-lg-2, .col-xs-3, .col-sm-3, .col-md-3, .col-lg-3, .col-xs-4, .col-sm-4, .col-md-4, .col-lg-4, .col-xs-5, .col-sm-5, .col-md-5, .col-lg-5, .col-xs-6, .col-sm-6, .col-md-6, .col-lg-6, .col-xs-7, .col-sm-7, .col-md-7, .col-lg-7, .col-xs-8, .col-sm-8, .col-md-8, .col-lg-8, .col-xs-9, .col-sm-9, .col-md-9, .col-lg-9, .col-xs-10, .col-sm-10, .col-md-10, .col-lg-10, .col-xs-11, .col-sm-11, .col-md-11, .col-lg-11, .col-xs-12, .col-sm-12, .col-md-12, .col-lg-12 {
  position: relative;
  min-height: 1px;
  padding-left: 0px;
  padding-right: 0px;
}
.col-xs-1, .col-xs-2, .col-xs-3, .col-xs-4, .col-xs-5, .col-xs-6, .col-xs-7, .col-xs-8, .col-xs-9, .col-xs-10, .col-xs-11, .col-xs-12 {
  float: left;
}
.col-xs-12 {
  width: 100%;
}
.col-xs-11 {
  width: 91.66666667%;
}
.col-xs-10 {
  width: 83.33333333%;
}
.col-xs-9 {
  width: 75%;
}
.col-xs-8 {
  width: 66.66666667%;
}
.col-xs-7 {
  width: 58.33333333%;
}
.col-xs-6 {
  width: 50%;
}
.col-xs-5 {
  width: 41.66666667%;
}
.col-xs-4 {
  width: 33.33333333%;
}
.col-xs-3 {
  width: 25%;
}
.col-xs-2 {
  width: 16.66666667%;
}
.col-xs-1 {
  width: 8.33333333%;
}
.col-xs-pull-12 {
  right: 100%;
}
.col-xs-pull-11 {
  right: 91.66666667%;
}
.col-xs-pull-10 {
  right: 83.33333333%;
}
.col-xs-pull-9 {
  right: 75%;
}
.col-xs-pull-8 {
  right: 66.66666667%;
}
.col-xs-pull-7 {
  right: 58.33333333%;
}
.col-xs-pull-6 {
  right: 50%;
}
.col-xs-pull-5 {
  right: 41.66666667%;
}
.col-xs-pull-4 {
  right: 33.33333333%;
}
.col-xs-pull-3 {
  right: 25%;
}
.col-xs-pull-2 {
  right: 16.66666667%;
}
.col-xs-pull-1 {
  right: 8.33333333%;
}
.col-xs-pull-0 {
  right: auto;
}
.col-xs-push-12 {
  left: 100%;
}
.col-xs-push-11 {
  left: 91.66666667%;
}
.col-xs-push-10 {
  left: 83.33333333%;
}
.col-xs-push-9 {
  left: 75%;
}
.col-xs-push-8 {
  left: 66.66666667%;
}
.col-xs-push-7 {
  left: 58.33333333%;
}
.col-xs-push-6 {
  left: 50%;
}
.col-xs-push-5 {
  left: 41.66666667%;
}
.col-xs-push-4 {
  left: 33.33333333%;
}
.col-xs-push-3 {
  left: 25%;
}
.col-xs-push-2 {
  left: 16.66666667%;
}
.col-xs-push-1 {
  left: 8.33333333%;
}
.col-xs-push-0 {
  left: auto;
}
.col-xs-offset-12 {
  margin-left: 100%;
}
.col-xs-offset-11 {
  margin-left: 91.66666667%;
}
.col-xs-offset-10 {
  margin-left: 83.33333333%;
}
.col-xs-offset-9 {
  margin-left: 75%;
}
.col-xs-offset-8 {
  margin-left: 66.66666667%;
}
.col-xs-offset-7 {
  margin-left: 58.33333333%;
}
.col-xs-offset-6 {
  margin-left: 50%;
}
.col-xs-offset-5 {
  margin-left: 41.66666667%;
}
.col-xs-offset-4 {
  margin-left: 33.33333333%;
}
.col-xs-offset-3 {
  margin-left: 25%;
}
.col-xs-offset-2 {
  margin-left: 16.66666667%;
}
.col-xs-offset-1 {
  margin-left: 8.33333333%;
}
.col-xs-offset-0 {
  margin-left: 0%;
}
@media (min-width: 768px) {
  .col-sm-1, .col-sm-2, .col-sm-3, .col-sm-4, .col-sm-5, .col-sm-6, .col-sm-7, .col-sm-8, .col-sm-9, .col-sm-10, .col-sm-11, .col-sm-12 {
    float: left;
  }
  .col-sm-12 {
    width: 100%;
  }
  .col-sm-11 {
    width: 91.66666667%;
  }
  .col-sm-10 {
    width: 83.33333333%;
  }
  .col-sm-9 {
    width: 75%;
  }
  .col-sm-8 {
    width: 66.66666667%;
  }
  .col-sm-7 {
    width: 58.33333333%;
  }
  .col-sm-6 {
    width: 50%;
  }
  .col-sm-5 {
    width: 41.66666667%;
  }
  .col-sm-4 {
    width: 33.33333333%;
  }
  .col-sm-3 {
    width: 25%;
  }
  .col-sm-2 {
    width: 16.66666667%;
  }
  .col-sm-1 {
    width: 8.33333333%;
  }
  .col-sm-pull-12 {
    right: 100%;
  }
  .col-sm-pull-11 {
    right: 91.66666667%;
  }
  .col-sm-pull-10 {
    right: 83.33333333%;
  }
  .col-sm-pull-9 {
    right: 75%;
  }
  .col-sm-pull-8 {
    right: 66.66666667%;
  }
  .col-sm-pull-7 {
    right: 58.33333333%;
  }
  .col-sm-pull-6 {
    right: 50%;
  }
  .col-sm-pull-5 {
    right: 41.66666667%;
  }
  .col-sm-pull-4 {
    right: 33.33333333%;
  }
  .col-sm-pull-3 {
    right: 25%;
  }
  .col-sm-pull-2 {
    right: 16.66666667%;
  }
  .col-sm-pull-1 {
    right: 8.33333333%;
  }
  .col-sm-pull-0 {
    right: auto;
  }
  .col-sm-push-12 {
    left: 100%;
  }
  .col-sm-push-11 {
    left: 91.66666667%;
  }
  .col-sm-push-10 {
    left: 83.33333333%;
  }
  .col-sm-push-9 {
    left: 75%;
  }
  .col-sm-push-8 {
    left: 66.66666667%;
  }
  .col-sm-push-7 {
    left: 58.33333333%;
  }
  .col-sm-push-6 {
    left: 50%;
  }
  .col-sm-push-5 {
    left: 41.66666667%;
  }
  .col-sm-push-4 {
    left: 33.33333333%;
  }
  .col-sm-push-3 {
    left: 25%;
  }
  .col-sm-push-2 {
    left: 16.66666667%;
  }
  .col-sm-push-1 {
    left: 8.33333333%;
  }
  .col-sm-push-0 {
    left: auto;
  }
  .col-sm-offset-12 {
    margin-left: 100%;
  }
  .col-sm-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-sm-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-sm-offset-9 {
    margin-left: 75%;
  }
  .col-sm-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-sm-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-sm-offset-6 {
    margin-left: 50%;
  }
  .col-sm-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-sm-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-sm-offset-3 {
    margin-left: 25%;
  }
  .col-sm-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-sm-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-sm-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 992px) {
  .col-md-1, .col-md-2, .col-md-3, .col-md-4, .col-md-5, .col-md-6, .col-md-7, .col-md-8, .col-md-9, .col-md-10, .col-md-11, .col-md-12 {
    float: left;
  }
  .col-md-12 {
    width: 100%;
  }
  .col-md-11 {
    width: 91.66666667%;
  }
  .col-md-10 {
    width: 83.33333333%;
  }
  .col-md-9 {
    width: 75%;
  }
  .col-md-8 {
    width: 66.66666667%;
  }
  .col-md-7 {
    width: 58.33333333%;
  }
  .col-md-6 {
    width: 50%;
  }
  .col-md-5 {
    width: 41.66666667%;
  }
  .col-md-4 {
    width: 33.33333333%;
  }
  .col-md-3 {
    width: 25%;
  }
  .col-md-2 {
    width: 16.66666667%;
  }
  .col-md-1 {
    width: 8.33333333%;
  }
  .col-md-pull-12 {
    right: 100%;
  }
  .col-md-pull-11 {
    right: 91.66666667%;
  }
  .col-md-pull-10 {
    right: 83.33333333%;
  }
  .col-md-pull-9 {
    right: 75%;
  }
  .col-md-pull-8 {
    right: 66.66666667%;
  }
  .col-md-pull-7 {
    right: 58.33333333%;
  }
  .col-md-pull-6 {
    right: 50%;
  }
  .col-md-pull-5 {
    right: 41.66666667%;
  }
  .col-md-pull-4 {
    right: 33.33333333%;
  }
  .col-md-pull-3 {
    right: 25%;
  }
  .col-md-pull-2 {
    right: 16.66666667%;
  }
  .col-md-pull-1 {
    right: 8.33333333%;
  }
  .col-md-pull-0 {
    right: auto;
  }
  .col-md-push-12 {
    left: 100%;
  }
  .col-md-push-11 {
    left: 91.66666667%;
  }
  .col-md-push-10 {
    left: 83.33333333%;
  }
  .col-md-push-9 {
    left: 75%;
  }
  .col-md-push-8 {
    left: 66.66666667%;
  }
  .col-md-push-7 {
    left: 58.33333333%;
  }
  .col-md-push-6 {
    left: 50%;
  }
  .col-md-push-5 {
    left: 41.66666667%;
  }
  .col-md-push-4 {
    left: 33.33333333%;
  }
  .col-md-push-3 {
    left: 25%;
  }
  .col-md-push-2 {
    left: 16.66666667%;
  }
  .col-md-push-1 {
    left: 8.33333333%;
  }
  .col-md-push-0 {
    left: auto;
  }
  .col-md-offset-12 {
    margin-left: 100%;
  }
  .col-md-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-md-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-md-offset-9 {
    margin-left: 75%;
  }
  .col-md-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-md-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-md-offset-6 {
    margin-left: 50%;
  }
  .col-md-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-md-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-md-offset-3 {
    margin-left: 25%;
  }
  .col-md-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-md-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-md-offset-0 {
    margin-left: 0%;
  }
}
@media (min-width: 1200px) {
  .col-lg-1, .col-lg-2, .col-lg-3, .col-lg-4, .col-lg-5, .col-lg-6, .col-lg-7, .col-lg-8, .col-lg-9, .col-lg-10, .col-lg-11, .col-lg-12 {
    float: left;
  }
  .col-lg-12 {
    width: 100%;
  }
  .col-lg-11 {
    width: 91.66666667%;
  }
  .col-lg-10 {
    width: 83.33333333%;
  }
  .col-lg-9 {
    width: 75%;
  }
  .col-lg-8 {
    width: 66.66666667%;
  }
  .col-lg-7 {
    width: 58.33333333%;
  }
  .col-lg-6 {
    width: 50%;
  }
  .col-lg-5 {
    width: 41.66666667%;
  }
  .col-lg-4 {
    width: 33.33333333%;
  }
  .col-lg-3 {
    width: 25%;
  }
  .col-lg-2 {
    width: 16.66666667%;
  }
  .col-lg-1 {
    width: 8.33333333%;
  }
  .col-lg-pull-12 {
    right: 100%;
  }
  .col-lg-pull-11 {
    right: 91.66666667%;
  }
  .col-lg-pull-10 {
    right: 83.33333333%;
  }
  .col-lg-pull-9 {
    right: 75%;
  }
  .col-lg-pull-8 {
    right: 66.66666667%;
  }
  .col-lg-pull-7 {
    right: 58.33333333%;
  }
  .col-lg-pull-6 {
    right: 50%;
  }
  .col-lg-pull-5 {
    right: 41.66666667%;
  }
  .col-lg-pull-4 {
    right: 33.33333333%;
  }
  .col-lg-pull-3 {
    right: 25%;
  }
  .col-lg-pull-2 {
    right: 16.66666667%;
  }
  .col-lg-pull-1 {
    right: 8.33333333%;
  }
  .col-lg-pull-0 {
    right: auto;
  }
  .col-lg-push-12 {
    left: 100%;
  }
  .col-lg-push-11 {
    left: 91.66666667%;
  }
  .col-lg-push-10 {
    left: 83.33333333%;
  }
  .col-lg-push-9 {
    left: 75%;
  }
  .col-lg-push-8 {
    left: 66.66666667%;
  }
  .col-lg-push-7 {
    left: 58.33333333%;
  }
  .col-lg-push-6 {
    left: 50%;
  }
  .col-lg-push-5 {
    left: 41.66666667%;
  }
  .col-lg-push-4 {
    left: 33.33333333%;
  }
  .col-lg-push-3 {
    left: 25%;
  }
  .col-lg-push-2 {
    left: 16.66666667%;
  }
  .col-lg-push-1 {
    left: 8.33333333%;
  }
  .col-lg-push-0 {
    left: auto;
  }
  .col-lg-offset-12 {
    margin-left: 100%;
  }
  .col-lg-offset-11 {
    margin-left: 91.66666667%;
  }
  .col-lg-offset-10 {
    margin-left: 83.33333333%;
  }
  .col-lg-offset-9 {
    margin-left: 75%;
  }
  .col-lg-offset-8 {
    margin-left: 66.66666667%;
  }
  .col-lg-offset-7 {
    margin-left: 58.33333333%;
  }
  .col-lg-offset-6 {
    margin-left: 50%;
  }
  .col-lg-offset-5 {
    margin-left: 41.66666667%;
  }
  .col-lg-offset-4 {
    margin-left: 33.33333333%;
  }
  .col-lg-offset-3 {
    margin-left: 25%;
  }
  .col-lg-offset-2 {
    margin-left: 16.66666667%;
  }
  .col-lg-offset-1 {
    margin-left: 8.33333333%;
  }
  .col-lg-offset-0 {
    margin-left: 0%;
  }
}
table {
  background-color: transparent;
}
caption {
  padding-top: 8px;
  padding-bottom: 8px;
  color: #777777;
  text-align: left;
}
th {
  text-align: left;
}
.table {
  width: 100%;
  max-width: 100%;
  margin-bottom: 18px;
}
.table > thead > tr > th,
.table > tbody > tr > th,
.table > tfoot > tr > th,
.table > thead > tr > td,
.table > tbody > tr > td,
.table > tfoot > tr > td {
  padding: 8px;
  line-height: 1.42857143;
  vertical-align: top;
  border-top: 1px solid #ddd;
}
.table > thead > tr > th {
  vertical-align: bottom;
  border-bottom: 2px solid #ddd;
}
.table > caption + thead > tr:first-child > th,
.table > colgroup + thead > tr:first-child > th,
.table > thead:first-child > tr:first-child > th,
.table > caption + thead > tr:first-child > td,
.table > colgroup + thead > tr:first-child > td,
.table > thead:first-child > tr:first-child > td {
  border-top: 0;
}
.table > tbody + tbody {
  border-top: 2px solid #ddd;
}
.table .table {
  background-color: #fff;
}
.table-condensed > thead > tr > th,
.table-condensed > tbody > tr > th,
.table-condensed > tfoot > tr > th,
.table-condensed > thead > tr > td,
.table-condensed > tbody > tr > td,
.table-condensed > tfoot > tr > td {
  padding: 5px;
}
.table-bordered {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > tbody > tr > th,
.table-bordered > tfoot > tr > th,
.table-bordered > thead > tr > td,
.table-bordered > tbody > tr > td,
.table-bordered > tfoot > tr > td {
  border: 1px solid #ddd;
}
.table-bordered > thead > tr > th,
.table-bordered > thead > tr > td {
  border-bottom-width: 2px;
}
.table-striped > tbody > tr:nth-of-type(odd) {
  background-color: #f9f9f9;
}
.table-hover > tbody > tr:hover {
  background-color: #f5f5f5;
}
table col[class*="col-"] {
  position: static;
  float: none;
  display: table-column;
}
table td[class*="col-"],
table th[class*="col-"] {
  position: static;
  float: none;
  display: table-cell;
}
.table > thead > tr > td.active,
.table > tbody > tr > td.active,
.table > tfoot > tr > td.active,
.table > thead > tr > th.active,
.table > tbody > tr > th.active,
.table > tfoot > tr > th.active,
.table > thead > tr.active > td,
.table > tbody > tr.active > td,
.table > tfoot > tr.active > td,
.table > thead > tr.active > th,
.table > tbody > tr.active > th,
.table > tfoot > tr.active > th {
  background-color: #f5f5f5;
}
.table-hover > tbody > tr > td.active:hover,
.table-hover > tbody > tr > th.active:hover,
.table-hover > tbody > tr.active:hover > td,
.table-hover > tbody > tr:hover > .active,
.table-hover > tbody > tr.active:hover > th {
  background-color: #e8e8e8;
}
.table > thead > tr > td.success,
.table > tbody > tr > td.success,
.table > tfoot > tr > td.success,
.table > thead > tr > th.success,
.table > tbody > tr > th.success,
.table > tfoot > tr > th.success,
.table > thead > tr.success > td,
.table > tbody > tr.success > td,
.table > tfoot > tr.success > td,
.table > thead > tr.success > th,
.table > tbody > tr.success > th,
.table > tfoot > tr.success > th {
  background-color: #dff0d8;
}
.table-hover > tbody > tr > td.success:hover,
.table-hover > tbody > tr > th.success:hover,
.table-hover > tbody > tr.success:hover > td,
.table-hover > tbody > tr:hover > .success,
.table-hover > tbody > tr.success:hover > th {
  background-color: #d0e9c6;
}
.table > thead > tr > td.info,
.table > tbody > tr > td.info,
.table > tfoot > tr > td.info,
.table > thead > tr > th.info,
.table > tbody > tr > th.info,
.table > tfoot > tr > th.info,
.table > thead > tr.info > td,
.table > tbody > tr.info > td,
.table > tfoot > tr.info > td,
.table > thead > tr.info > th,
.table > tbody > tr.info > th,
.table > tfoot > tr.info > th {
  background-color: #d9edf7;
}
.table-hover > tbody > tr > td.info:hover,
.table-hover > tbody > tr > th.info:hover,
.table-hover > tbody > tr.info:hover > td,
.table-hover > tbody > tr:hover > .info,
.table-hover > tbody > tr.info:hover > th {
  background-color: #c4e3f3;
}
.table > thead > tr > td.warning,
.table > tbody > tr > td.warning,
.table > tfoot > tr > td.warning,
.table > thead > tr > th.warning,
.table > tbody > tr > th.warning,
.table > tfoot > tr > th.warning,
.table > thead > tr.warning > td,
.table > tbody > tr.warning > td,
.table > tfoot > tr.warning > td,
.table > thead > tr.warning > th,
.table > tbody > tr.warning > th,
.table > tfoot > tr.warning > th {
  background-color: #fcf8e3;
}
.table-hover > tbody > tr > td.warning:hover,
.table-hover > tbody > tr > th.warning:hover,
.table-hover > tbody > tr.warning:hover > td,
.table-hover > tbody > tr:hover > .warning,
.table-hover > tbody > tr.warning:hover > th {
  background-color: #faf2cc;
}
.table > thead > tr > td.danger,
.table > tbody > tr > td.danger,
.table > tfoot > tr > td.danger,
.table > thead > tr > th.danger,
.table > tbody > tr > th.danger,
.table > tfoot > tr > th.danger,
.table > thead > tr.danger > td,
.table > tbody > tr.danger > td,
.table > tfoot > tr.danger > td,
.table > thead > tr.danger > th,
.table > tbody > tr.danger > th,
.table > tfoot > tr.danger > th {
  background-color: #f2dede;
}
.table-hover > tbody > tr > td.danger:hover,
.table-hover > tbody > tr > th.danger:hover,
.table-hover > tbody > tr.danger:hover > td,
.table-hover > tbody > tr:hover > .danger,
.table-hover > tbody > tr.danger:hover > th {
  background-color: #ebcccc;
}
.table-responsive {
  overflow-x: auto;
  min-height: 0.01%;
}
@media screen and (max-width: 767px) {
  .table-responsive {
    width: 100%;
    margin-bottom: 13.5px;
    overflow-y: hidden;
    -ms-overflow-style: -ms-autohiding-scrollbar;
    border: 1px solid #ddd;
  }
  .table-responsive > .table {
    margin-bottom: 0;
  }
  .table-responsive > .table > thead > tr > th,
  .table-responsive > .table > tbody > tr > th,
  .table-responsive > .table > tfoot > tr > th,
  .table-responsive > .table > thead > tr > td,
  .table-responsive > .table > tbody > tr > td,
  .table-responsive > .table > tfoot > tr > td {
    white-space: nowrap;
  }
  .table-responsive > .table-bordered {
    border: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:first-child,
  .table-responsive > .table-bordered > tbody > tr > th:first-child,
  .table-responsive > .table-bordered > tfoot > tr > th:first-child,
  .table-responsive > .table-bordered > thead > tr > td:first-child,
  .table-responsive > .table-bordered > tbody > tr > td:first-child,
  .table-responsive > .table-bordered > tfoot > tr > td:first-child {
    border-left: 0;
  }
  .table-responsive > .table-bordered > thead > tr > th:last-child,
  .table-responsive > .table-bordered > tbody > tr > th:last-child,
  .table-responsive > .table-bordered > tfoot > tr > th:last-child,
  .table-responsive > .table-bordered > thead > tr > td:last-child,
  .table-responsive > .table-bordered > tbody > tr > td:last-child,
  .table-responsive > .table-bordered > tfoot > tr > td:last-child {
    border-right: 0;
  }
  .table-responsive > .table-bordered > tbody > tr:last-child > th,
  .table-responsive > .table-bordered > tfoot > tr:last-child > th,
  .table-responsive > .table-bordered > tbody > tr:last-child > td,
  .table-responsive > .table-bordered > tfoot > tr:last-child > td {
    border-bottom: 0;
  }
}
fieldset {
  padding: 0;
  margin: 0;
  border: 0;
  min-width: 0;
}
legend {
  display: block;
  width: 100%;
  padding: 0;
  margin-bottom: 18px;
  font-size: 19.5px;
  line-height: inherit;
  color: #333333;
  border: 0;
  border-bottom: 1px solid #e5e5e5;
}
label {
  display: inline-block;
  max-width: 100%;
  margin-bottom: 5px;
  font-weight: bold;
}
input[type="search"] {
  -webkit-box-sizing: border-box;
  -moz-box-sizing: border-box;
  box-sizing: border-box;
}
input[type="radio"],
input[type="checkbox"] {
  margin: 4px 0 0;
  margin-top: 1px \9;
  line-height: normal;
}
input[type="file"] {
  display: block;
}
input[type="range"] {
  display: block;
  width: 100%;
}
select[multiple],
select[size] {
  height: auto;
}
input[type="file"]:focus,
input[type="radio"]:focus,
input[type="checkbox"]:focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
output {
  display: block;
  padding-top: 7px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
}
.form-control {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
}
.form-control:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.form-control::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.form-control:-ms-input-placeholder {
  color: #999;
}
.form-control::-webkit-input-placeholder {
  color: #999;
}
.form-control::-ms-expand {
  border: 0;
  background-color: transparent;
}
.form-control[disabled],
.form-control[readonly],
fieldset[disabled] .form-control {
  background-color: #eeeeee;
  opacity: 1;
}
.form-control[disabled],
fieldset[disabled] .form-control {
  cursor: not-allowed;
}
textarea.form-control {
  height: auto;
}
input[type="search"] {
  -webkit-appearance: none;
}
@media screen and (-webkit-min-device-pixel-ratio: 0) {
  input[type="date"].form-control,
  input[type="time"].form-control,
  input[type="datetime-local"].form-control,
  input[type="month"].form-control {
    line-height: 32px;
  }
  input[type="date"].input-sm,
  input[type="time"].input-sm,
  input[type="datetime-local"].input-sm,
  input[type="month"].input-sm,
  .input-group-sm input[type="date"],
  .input-group-sm input[type="time"],
  .input-group-sm input[type="datetime-local"],
  .input-group-sm input[type="month"] {
    line-height: 30px;
  }
  input[type="date"].input-lg,
  input[type="time"].input-lg,
  input[type="datetime-local"].input-lg,
  input[type="month"].input-lg,
  .input-group-lg input[type="date"],
  .input-group-lg input[type="time"],
  .input-group-lg input[type="datetime-local"],
  .input-group-lg input[type="month"] {
    line-height: 45px;
  }
}
.form-group {
  margin-bottom: 15px;
}
.radio,
.checkbox {
  position: relative;
  display: block;
  margin-top: 10px;
  margin-bottom: 10px;
}
.radio label,
.checkbox label {
  min-height: 18px;
  padding-left: 20px;
  margin-bottom: 0;
  font-weight: normal;
  cursor: pointer;
}
.radio input[type="radio"],
.radio-inline input[type="radio"],
.checkbox input[type="checkbox"],
.checkbox-inline input[type="checkbox"] {
  position: absolute;
  margin-left: -20px;
  margin-top: 4px \9;
}
.radio + .radio,
.checkbox + .checkbox {
  margin-top: -5px;
}
.radio-inline,
.checkbox-inline {
  position: relative;
  display: inline-block;
  padding-left: 20px;
  margin-bottom: 0;
  vertical-align: middle;
  font-weight: normal;
  cursor: pointer;
}
.radio-inline + .radio-inline,
.checkbox-inline + .checkbox-inline {
  margin-top: 0;
  margin-left: 10px;
}
input[type="radio"][disabled],
input[type="checkbox"][disabled],
input[type="radio"].disabled,
input[type="checkbox"].disabled,
fieldset[disabled] input[type="radio"],
fieldset[disabled] input[type="checkbox"] {
  cursor: not-allowed;
}
.radio-inline.disabled,
.checkbox-inline.disabled,
fieldset[disabled] .radio-inline,
fieldset[disabled] .checkbox-inline {
  cursor: not-allowed;
}
.radio.disabled label,
.checkbox.disabled label,
fieldset[disabled] .radio label,
fieldset[disabled] .checkbox label {
  cursor: not-allowed;
}
.form-control-static {
  padding-top: 7px;
  padding-bottom: 7px;
  margin-bottom: 0;
  min-height: 31px;
}
.form-control-static.input-lg,
.form-control-static.input-sm {
  padding-left: 0;
  padding-right: 0;
}
.input-sm {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-sm {
  height: 30px;
  line-height: 30px;
}
textarea.input-sm,
select[multiple].input-sm {
  height: auto;
}
.form-group-sm .form-control {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.form-group-sm select.form-control {
  height: 30px;
  line-height: 30px;
}
.form-group-sm textarea.form-control,
.form-group-sm select[multiple].form-control {
  height: auto;
}
.form-group-sm .form-control-static {
  height: 30px;
  min-height: 30px;
  padding: 6px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.input-lg {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-lg {
  height: 45px;
  line-height: 45px;
}
textarea.input-lg,
select[multiple].input-lg {
  height: auto;
}
.form-group-lg .form-control {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.form-group-lg select.form-control {
  height: 45px;
  line-height: 45px;
}
.form-group-lg textarea.form-control,
.form-group-lg select[multiple].form-control {
  height: auto;
}
.form-group-lg .form-control-static {
  height: 45px;
  min-height: 35px;
  padding: 11px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.has-feedback {
  position: relative;
}
.has-feedback .form-control {
  padding-right: 40px;
}
.form-control-feedback {
  position: absolute;
  top: 0;
  right: 0;
  z-index: 2;
  display: block;
  width: 32px;
  height: 32px;
  line-height: 32px;
  text-align: center;
  pointer-events: none;
}
.input-lg + .form-control-feedback,
.input-group-lg + .form-control-feedback,
.form-group-lg .form-control + .form-control-feedback {
  width: 45px;
  height: 45px;
  line-height: 45px;
}
.input-sm + .form-control-feedback,
.input-group-sm + .form-control-feedback,
.form-group-sm .form-control + .form-control-feedback {
  width: 30px;
  height: 30px;
  line-height: 30px;
}
.has-success .help-block,
.has-success .control-label,
.has-success .radio,
.has-success .checkbox,
.has-success .radio-inline,
.has-success .checkbox-inline,
.has-success.radio label,
.has-success.checkbox label,
.has-success.radio-inline label,
.has-success.checkbox-inline label {
  color: #3c763d;
}
.has-success .form-control {
  border-color: #3c763d;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-success .form-control:focus {
  border-color: #2b542c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #67b168;
}
.has-success .input-group-addon {
  color: #3c763d;
  border-color: #3c763d;
  background-color: #dff0d8;
}
.has-success .form-control-feedback {
  color: #3c763d;
}
.has-warning .help-block,
.has-warning .control-label,
.has-warning .radio,
.has-warning .checkbox,
.has-warning .radio-inline,
.has-warning .checkbox-inline,
.has-warning.radio label,
.has-warning.checkbox label,
.has-warning.radio-inline label,
.has-warning.checkbox-inline label {
  color: #8a6d3b;
}
.has-warning .form-control {
  border-color: #8a6d3b;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-warning .form-control:focus {
  border-color: #66512c;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #c0a16b;
}
.has-warning .input-group-addon {
  color: #8a6d3b;
  border-color: #8a6d3b;
  background-color: #fcf8e3;
}
.has-warning .form-control-feedback {
  color: #8a6d3b;
}
.has-error .help-block,
.has-error .control-label,
.has-error .radio,
.has-error .checkbox,
.has-error .radio-inline,
.has-error .checkbox-inline,
.has-error.radio label,
.has-error.checkbox label,
.has-error.radio-inline label,
.has-error.checkbox-inline label {
  color: #a94442;
}
.has-error .form-control {
  border-color: #a94442;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
}
.has-error .form-control:focus {
  border-color: #843534;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075), 0 0 6px #ce8483;
}
.has-error .input-group-addon {
  color: #a94442;
  border-color: #a94442;
  background-color: #f2dede;
}
.has-error .form-control-feedback {
  color: #a94442;
}
.has-feedback label ~ .form-control-feedback {
  top: 23px;
}
.has-feedback label.sr-only ~ .form-control-feedback {
  top: 0;
}
.help-block {
  display: block;
  margin-top: 5px;
  margin-bottom: 10px;
  color: #404040;
}
@media (min-width: 768px) {
  .form-inline .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .form-inline .form-control-static {
    display: inline-block;
  }
  .form-inline .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .form-inline .input-group .input-group-addon,
  .form-inline .input-group .input-group-btn,
  .form-inline .input-group .form-control {
    width: auto;
  }
  .form-inline .input-group > .form-control {
    width: 100%;
  }
  .form-inline .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio,
  .form-inline .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .form-inline .radio label,
  .form-inline .checkbox label {
    padding-left: 0;
  }
  .form-inline .radio input[type="radio"],
  .form-inline .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .form-inline .has-feedback .form-control-feedback {
    top: 0;
  }
}
.form-horizontal .radio,
.form-horizontal .checkbox,
.form-horizontal .radio-inline,
.form-horizontal .checkbox-inline {
  margin-top: 0;
  margin-bottom: 0;
  padding-top: 7px;
}
.form-horizontal .radio,
.form-horizontal .checkbox {
  min-height: 25px;
}
.form-horizontal .form-group {
  margin-left: 0px;
  margin-right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .control-label {
    text-align: right;
    margin-bottom: 0;
    padding-top: 7px;
  }
}
.form-horizontal .has-feedback .form-control-feedback {
  right: 0px;
}
@media (min-width: 768px) {
  .form-horizontal .form-group-lg .control-label {
    padding-top: 11px;
    font-size: 17px;
  }
}
@media (min-width: 768px) {
  .form-horizontal .form-group-sm .control-label {
    padding-top: 6px;
    font-size: 12px;
  }
}
.btn {
  display: inline-block;
  margin-bottom: 0;
  font-weight: normal;
  text-align: center;
  vertical-align: middle;
  touch-action: manipulation;
  cursor: pointer;
  background-image: none;
  border: 1px solid transparent;
  white-space: nowrap;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  border-radius: 2px;
  -webkit-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
}
.btn:focus,
.btn:active:focus,
.btn.active:focus,
.btn.focus,
.btn:active.focus,
.btn.active.focus {
  outline: 5px auto -webkit-focus-ring-color;
  outline-offset: -2px;
}
.btn:hover,
.btn:focus,
.btn.focus {
  color: #333;
  text-decoration: none;
}
.btn:active,
.btn.active {
  outline: 0;
  background-image: none;
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn.disabled,
.btn[disabled],
fieldset[disabled] .btn {
  cursor: not-allowed;
  opacity: 0.65;
  filter: alpha(opacity=65);
  -webkit-box-shadow: none;
  box-shadow: none;
}
a.btn.disabled,
fieldset[disabled] a.btn {
  pointer-events: none;
}
.btn-default {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.btn-default:focus,
.btn-default.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.btn-default:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.btn-default:active:hover,
.btn-default.active:hover,
.open > .dropdown-toggle.btn-default:hover,
.btn-default:active:focus,
.btn-default.active:focus,
.open > .dropdown-toggle.btn-default:focus,
.btn-default:active.focus,
.btn-default.active.focus,
.open > .dropdown-toggle.btn-default.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.btn-default:active,
.btn-default.active,
.open > .dropdown-toggle.btn-default {
  background-image: none;
}
.btn-default.disabled:hover,
.btn-default[disabled]:hover,
fieldset[disabled] .btn-default:hover,
.btn-default.disabled:focus,
.btn-default[disabled]:focus,
fieldset[disabled] .btn-default:focus,
.btn-default.disabled.focus,
.btn-default[disabled].focus,
fieldset[disabled] .btn-default.focus {
  background-color: #fff;
  border-color: #ccc;
}
.btn-default .badge {
  color: #fff;
  background-color: #333;
}
.btn-primary {
  color: #fff;
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary:focus,
.btn-primary.focus {
  color: #fff;
  background-color: #286090;
  border-color: #122b40;
}
.btn-primary:hover {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  color: #fff;
  background-color: #286090;
  border-color: #204d74;
}
.btn-primary:active:hover,
.btn-primary.active:hover,
.open > .dropdown-toggle.btn-primary:hover,
.btn-primary:active:focus,
.btn-primary.active:focus,
.open > .dropdown-toggle.btn-primary:focus,
.btn-primary:active.focus,
.btn-primary.active.focus,
.open > .dropdown-toggle.btn-primary.focus {
  color: #fff;
  background-color: #204d74;
  border-color: #122b40;
}
.btn-primary:active,
.btn-primary.active,
.open > .dropdown-toggle.btn-primary {
  background-image: none;
}
.btn-primary.disabled:hover,
.btn-primary[disabled]:hover,
fieldset[disabled] .btn-primary:hover,
.btn-primary.disabled:focus,
.btn-primary[disabled]:focus,
fieldset[disabled] .btn-primary:focus,
.btn-primary.disabled.focus,
.btn-primary[disabled].focus,
fieldset[disabled] .btn-primary.focus {
  background-color: #337ab7;
  border-color: #2e6da4;
}
.btn-primary .badge {
  color: #337ab7;
  background-color: #fff;
}
.btn-success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success:focus,
.btn-success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.btn-success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.btn-success:active:hover,
.btn-success.active:hover,
.open > .dropdown-toggle.btn-success:hover,
.btn-success:active:focus,
.btn-success.active:focus,
.open > .dropdown-toggle.btn-success:focus,
.btn-success:active.focus,
.btn-success.active.focus,
.open > .dropdown-toggle.btn-success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.btn-success:active,
.btn-success.active,
.open > .dropdown-toggle.btn-success {
  background-image: none;
}
.btn-success.disabled:hover,
.btn-success[disabled]:hover,
fieldset[disabled] .btn-success:hover,
.btn-success.disabled:focus,
.btn-success[disabled]:focus,
fieldset[disabled] .btn-success:focus,
.btn-success.disabled.focus,
.btn-success[disabled].focus,
fieldset[disabled] .btn-success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.btn-success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.btn-info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info:focus,
.btn-info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.btn-info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.btn-info:active:hover,
.btn-info.active:hover,
.open > .dropdown-toggle.btn-info:hover,
.btn-info:active:focus,
.btn-info.active:focus,
.open > .dropdown-toggle.btn-info:focus,
.btn-info:active.focus,
.btn-info.active.focus,
.open > .dropdown-toggle.btn-info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.btn-info:active,
.btn-info.active,
.open > .dropdown-toggle.btn-info {
  background-image: none;
}
.btn-info.disabled:hover,
.btn-info[disabled]:hover,
fieldset[disabled] .btn-info:hover,
.btn-info.disabled:focus,
.btn-info[disabled]:focus,
fieldset[disabled] .btn-info:focus,
.btn-info.disabled.focus,
.btn-info[disabled].focus,
fieldset[disabled] .btn-info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.btn-info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.btn-warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning:focus,
.btn-warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.btn-warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.btn-warning:active:hover,
.btn-warning.active:hover,
.open > .dropdown-toggle.btn-warning:hover,
.btn-warning:active:focus,
.btn-warning.active:focus,
.open > .dropdown-toggle.btn-warning:focus,
.btn-warning:active.focus,
.btn-warning.active.focus,
.open > .dropdown-toggle.btn-warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.btn-warning:active,
.btn-warning.active,
.open > .dropdown-toggle.btn-warning {
  background-image: none;
}
.btn-warning.disabled:hover,
.btn-warning[disabled]:hover,
fieldset[disabled] .btn-warning:hover,
.btn-warning.disabled:focus,
.btn-warning[disabled]:focus,
fieldset[disabled] .btn-warning:focus,
.btn-warning.disabled.focus,
.btn-warning[disabled].focus,
fieldset[disabled] .btn-warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.btn-warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.btn-danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger:focus,
.btn-danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.btn-danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.btn-danger:active:hover,
.btn-danger.active:hover,
.open > .dropdown-toggle.btn-danger:hover,
.btn-danger:active:focus,
.btn-danger.active:focus,
.open > .dropdown-toggle.btn-danger:focus,
.btn-danger:active.focus,
.btn-danger.active.focus,
.open > .dropdown-toggle.btn-danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.btn-danger:active,
.btn-danger.active,
.open > .dropdown-toggle.btn-danger {
  background-image: none;
}
.btn-danger.disabled:hover,
.btn-danger[disabled]:hover,
fieldset[disabled] .btn-danger:hover,
.btn-danger.disabled:focus,
.btn-danger[disabled]:focus,
fieldset[disabled] .btn-danger:focus,
.btn-danger.disabled.focus,
.btn-danger[disabled].focus,
fieldset[disabled] .btn-danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.btn-danger .badge {
  color: #d9534f;
  background-color: #fff;
}
.btn-link {
  color: #337ab7;
  font-weight: normal;
  border-radius: 0;
}
.btn-link,
.btn-link:active,
.btn-link.active,
.btn-link[disabled],
fieldset[disabled] .btn-link {
  background-color: transparent;
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn-link,
.btn-link:hover,
.btn-link:focus,
.btn-link:active {
  border-color: transparent;
}
.btn-link:hover,
.btn-link:focus {
  color: #23527c;
  text-decoration: underline;
  background-color: transparent;
}
.btn-link[disabled]:hover,
fieldset[disabled] .btn-link:hover,
.btn-link[disabled]:focus,
fieldset[disabled] .btn-link:focus {
  color: #777777;
  text-decoration: none;
}
.btn-lg,
.btn-group-lg > .btn {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
.btn-sm,
.btn-group-sm > .btn {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-xs,
.btn-group-xs > .btn {
  padding: 1px 5px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
.btn-block {
  display: block;
  width: 100%;
}
.btn-block + .btn-block {
  margin-top: 5px;
}
input[type="submit"].btn-block,
input[type="reset"].btn-block,
input[type="button"].btn-block {
  width: 100%;
}
.fade {
  opacity: 0;
  -webkit-transition: opacity 0.15s linear;
  -o-transition: opacity 0.15s linear;
  transition: opacity 0.15s linear;
}
.fade.in {
  opacity: 1;
}
.collapse {
  display: none;
}
.collapse.in {
  display: block;
}
tr.collapse.in {
  display: table-row;
}
tbody.collapse.in {
  display: table-row-group;
}
.collapsing {
  position: relative;
  height: 0;
  overflow: hidden;
  -webkit-transition-property: height, visibility;
  transition-property: height, visibility;
  -webkit-transition-duration: 0.35s;
  transition-duration: 0.35s;
  -webkit-transition-timing-function: ease;
  transition-timing-function: ease;
}
.caret {
  display: inline-block;
  width: 0;
  height: 0;
  margin-left: 2px;
  vertical-align: middle;
  border-top: 4px dashed;
  border-top: 4px solid \9;
  border-right: 4px solid transparent;
  border-left: 4px solid transparent;
}
.dropup,
.dropdown {
  position: relative;
}
.dropdown-toggle:focus {
  outline: 0;
}
.dropdown-menu {
  position: absolute;
  top: 100%;
  left: 0;
  z-index: 1000;
  display: none;
  float: left;
  min-width: 160px;
  padding: 5px 0;
  margin: 2px 0 0;
  list-style: none;
  font-size: 13px;
  text-align: left;
  background-color: #fff;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.15);
  border-radius: 2px;
  -webkit-box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  box-shadow: 0 6px 12px rgba(0, 0, 0, 0.175);
  background-clip: padding-box;
}
.dropdown-menu.pull-right {
  right: 0;
  left: auto;
}
.dropdown-menu .divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.dropdown-menu > li > a {
  display: block;
  padding: 3px 20px;
  clear: both;
  font-weight: normal;
  line-height: 1.42857143;
  color: #333333;
  white-space: nowrap;
}
.dropdown-menu > li > a:hover,
.dropdown-menu > li > a:focus {
  text-decoration: none;
  color: #262626;
  background-color: #f5f5f5;
}
.dropdown-menu > .active > a,
.dropdown-menu > .active > a:hover,
.dropdown-menu > .active > a:focus {
  color: #fff;
  text-decoration: none;
  outline: 0;
  background-color: #337ab7;
}
.dropdown-menu > .disabled > a,
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  color: #777777;
}
.dropdown-menu > .disabled > a:hover,
.dropdown-menu > .disabled > a:focus {
  text-decoration: none;
  background-color: transparent;
  background-image: none;
  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);
  cursor: not-allowed;
}
.open > .dropdown-menu {
  display: block;
}
.open > a {
  outline: 0;
}
.dropdown-menu-right {
  left: auto;
  right: 0;
}
.dropdown-menu-left {
  left: 0;
  right: auto;
}
.dropdown-header {
  display: block;
  padding: 3px 20px;
  font-size: 12px;
  line-height: 1.42857143;
  color: #777777;
  white-space: nowrap;
}
.dropdown-backdrop {
  position: fixed;
  left: 0;
  right: 0;
  bottom: 0;
  top: 0;
  z-index: 990;
}
.pull-right > .dropdown-menu {
  right: 0;
  left: auto;
}
.dropup .caret,
.navbar-fixed-bottom .dropdown .caret {
  border-top: 0;
  border-bottom: 4px dashed;
  border-bottom: 4px solid \9;
  content: "";
}
.dropup .dropdown-menu,
.navbar-fixed-bottom .dropdown .dropdown-menu {
  top: auto;
  bottom: 100%;
  margin-bottom: 2px;
}
@media (min-width: 541px) {
  .navbar-right .dropdown-menu {
    left: auto;
    right: 0;
  }
  .navbar-right .dropdown-menu-left {
    left: 0;
    right: auto;
  }
}
.btn-group,
.btn-group-vertical {
  position: relative;
  display: inline-block;
  vertical-align: middle;
}
.btn-group > .btn,
.btn-group-vertical > .btn {
  position: relative;
  float: left;
}
.btn-group > .btn:hover,
.btn-group-vertical > .btn:hover,
.btn-group > .btn:focus,
.btn-group-vertical > .btn:focus,
.btn-group > .btn:active,
.btn-group-vertical > .btn:active,
.btn-group > .btn.active,
.btn-group-vertical > .btn.active {
  z-index: 2;
}
.btn-group .btn + .btn,
.btn-group .btn + .btn-group,
.btn-group .btn-group + .btn,
.btn-group .btn-group + .btn-group {
  margin-left: -1px;
}
.btn-toolbar {
  margin-left: -5px;
}
.btn-toolbar .btn,
.btn-toolbar .btn-group,
.btn-toolbar .input-group {
  float: left;
}
.btn-toolbar > .btn,
.btn-toolbar > .btn-group,
.btn-toolbar > .input-group {
  margin-left: 5px;
}
.btn-group > .btn:not(:first-child):not(:last-child):not(.dropdown-toggle) {
  border-radius: 0;
}
.btn-group > .btn:first-child {
  margin-left: 0;
}
.btn-group > .btn:first-child:not(:last-child):not(.dropdown-toggle) {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn:last-child:not(:first-child),
.btn-group > .dropdown-toggle:not(:first-child) {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group > .btn-group {
  float: left;
}
.btn-group > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.btn-group > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.btn-group .dropdown-toggle:active,
.btn-group.open .dropdown-toggle {
  outline: 0;
}
.btn-group > .btn + .dropdown-toggle {
  padding-left: 8px;
  padding-right: 8px;
}
.btn-group > .btn-lg + .dropdown-toggle {
  padding-left: 12px;
  padding-right: 12px;
}
.btn-group.open .dropdown-toggle {
  -webkit-box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
  box-shadow: inset 0 3px 5px rgba(0, 0, 0, 0.125);
}
.btn-group.open .dropdown-toggle.btn-link {
  -webkit-box-shadow: none;
  box-shadow: none;
}
.btn .caret {
  margin-left: 0;
}
.btn-lg .caret {
  border-width: 5px 5px 0;
  border-bottom-width: 0;
}
.dropup .btn-lg .caret {
  border-width: 0 5px 5px;
}
.btn-group-vertical > .btn,
.btn-group-vertical > .btn-group,
.btn-group-vertical > .btn-group > .btn {
  display: block;
  float: none;
  width: 100%;
  max-width: 100%;
}
.btn-group-vertical > .btn-group > .btn {
  float: none;
}
.btn-group-vertical > .btn + .btn,
.btn-group-vertical > .btn + .btn-group,
.btn-group-vertical > .btn-group + .btn,
.btn-group-vertical > .btn-group + .btn-group {
  margin-top: -1px;
  margin-left: 0;
}
.btn-group-vertical > .btn:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.btn-group-vertical > .btn:first-child:not(:last-child) {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn:last-child:not(:first-child) {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
.btn-group-vertical > .btn-group:not(:first-child):not(:last-child) > .btn {
  border-radius: 0;
}
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .btn:last-child,
.btn-group-vertical > .btn-group:first-child:not(:last-child) > .dropdown-toggle {
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.btn-group-vertical > .btn-group:last-child:not(:first-child) > .btn:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.btn-group-justified {
  display: table;
  width: 100%;
  table-layout: fixed;
  border-collapse: separate;
}
.btn-group-justified > .btn,
.btn-group-justified > .btn-group {
  float: none;
  display: table-cell;
  width: 1%;
}
.btn-group-justified > .btn-group .btn {
  width: 100%;
}
.btn-group-justified > .btn-group .dropdown-menu {
  left: auto;
}
[data-toggle="buttons"] > .btn input[type="radio"],
[data-toggle="buttons"] > .btn-group > .btn input[type="radio"],
[data-toggle="buttons"] > .btn input[type="checkbox"],
[data-toggle="buttons"] > .btn-group > .btn input[type="checkbox"] {
  position: absolute;
  clip: rect(0, 0, 0, 0);
  pointer-events: none;
}
.input-group {
  position: relative;
  display: table;
  border-collapse: separate;
}
.input-group[class*="col-"] {
  float: none;
  padding-left: 0;
  padding-right: 0;
}
.input-group .form-control {
  position: relative;
  z-index: 2;
  float: left;
  width: 100%;
  margin-bottom: 0;
}
.input-group .form-control:focus {
  z-index: 3;
}
.input-group-lg > .form-control,
.input-group-lg > .input-group-addon,
.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
  border-radius: 3px;
}
select.input-group-lg > .form-control,
select.input-group-lg > .input-group-addon,
select.input-group-lg > .input-group-btn > .btn {
  height: 45px;
  line-height: 45px;
}
textarea.input-group-lg > .form-control,
textarea.input-group-lg > .input-group-addon,
textarea.input-group-lg > .input-group-btn > .btn,
select[multiple].input-group-lg > .form-control,
select[multiple].input-group-lg > .input-group-addon,
select[multiple].input-group-lg > .input-group-btn > .btn {
  height: auto;
}
.input-group-sm > .form-control,
.input-group-sm > .input-group-addon,
.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
}
select.input-group-sm > .form-control,
select.input-group-sm > .input-group-addon,
select.input-group-sm > .input-group-btn > .btn {
  height: 30px;
  line-height: 30px;
}
textarea.input-group-sm > .form-control,
textarea.input-group-sm > .input-group-addon,
textarea.input-group-sm > .input-group-btn > .btn,
select[multiple].input-group-sm > .form-control,
select[multiple].input-group-sm > .input-group-addon,
select[multiple].input-group-sm > .input-group-btn > .btn {
  height: auto;
}
.input-group-addon,
.input-group-btn,
.input-group .form-control {
  display: table-cell;
}
.input-group-addon:not(:first-child):not(:last-child),
.input-group-btn:not(:first-child):not(:last-child),
.input-group .form-control:not(:first-child):not(:last-child) {
  border-radius: 0;
}
.input-group-addon,
.input-group-btn {
  width: 1%;
  white-space: nowrap;
  vertical-align: middle;
}
.input-group-addon {
  padding: 6px 12px;
  font-size: 13px;
  font-weight: normal;
  line-height: 1;
  color: #555555;
  text-align: center;
  background-color: #eeeeee;
  border: 1px solid #ccc;
  border-radius: 2px;
}
.input-group-addon.input-sm {
  padding: 5px 10px;
  font-size: 12px;
  border-radius: 1px;
}
.input-group-addon.input-lg {
  padding: 10px 16px;
  font-size: 17px;
  border-radius: 3px;
}
.input-group-addon input[type="radio"],
.input-group-addon input[type="checkbox"] {
  margin-top: 0;
}
.input-group .form-control:first-child,
.input-group-addon:first-child,
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group > .btn,
.input-group-btn:first-child > .dropdown-toggle,
.input-group-btn:last-child > .btn:not(:last-child):not(.dropdown-toggle),
.input-group-btn:last-child > .btn-group:not(:last-child) > .btn {
  border-bottom-right-radius: 0;
  border-top-right-radius: 0;
}
.input-group-addon:first-child {
  border-right: 0;
}
.input-group .form-control:last-child,
.input-group-addon:last-child,
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group > .btn,
.input-group-btn:last-child > .dropdown-toggle,
.input-group-btn:first-child > .btn:not(:first-child),
.input-group-btn:first-child > .btn-group:not(:first-child) > .btn {
  border-bottom-left-radius: 0;
  border-top-left-radius: 0;
}
.input-group-addon:last-child {
  border-left: 0;
}
.input-group-btn {
  position: relative;
  font-size: 0;
  white-space: nowrap;
}
.input-group-btn > .btn {
  position: relative;
}
.input-group-btn > .btn + .btn {
  margin-left: -1px;
}
.input-group-btn > .btn:hover,
.input-group-btn > .btn:focus,
.input-group-btn > .btn:active {
  z-index: 2;
}
.input-group-btn:first-child > .btn,
.input-group-btn:first-child > .btn-group {
  margin-right: -1px;
}
.input-group-btn:last-child > .btn,
.input-group-btn:last-child > .btn-group {
  z-index: 2;
  margin-left: -1px;
}
.nav {
  margin-bottom: 0;
  padding-left: 0;
  list-style: none;
}
.nav > li {
  position: relative;
  display: block;
}
.nav > li > a {
  position: relative;
  display: block;
  padding: 10px 15px;
}
.nav > li > a:hover,
.nav > li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.nav > li.disabled > a {
  color: #777777;
}
.nav > li.disabled > a:hover,
.nav > li.disabled > a:focus {
  color: #777777;
  text-decoration: none;
  background-color: transparent;
  cursor: not-allowed;
}
.nav .open > a,
.nav .open > a:hover,
.nav .open > a:focus {
  background-color: #eeeeee;
  border-color: #337ab7;
}
.nav .nav-divider {
  height: 1px;
  margin: 8px 0;
  overflow: hidden;
  background-color: #e5e5e5;
}
.nav > li > a > img {
  max-width: none;
}
.nav-tabs {
  border-bottom: 1px solid #ddd;
}
.nav-tabs > li {
  float: left;
  margin-bottom: -1px;
}
.nav-tabs > li > a {
  margin-right: 2px;
  line-height: 1.42857143;
  border: 1px solid transparent;
  border-radius: 2px 2px 0 0;
}
.nav-tabs > li > a:hover {
  border-color: #eeeeee #eeeeee #ddd;
}
.nav-tabs > li.active > a,
.nav-tabs > li.active > a:hover,
.nav-tabs > li.active > a:focus {
  color: #555555;
  background-color: #fff;
  border: 1px solid #ddd;
  border-bottom-color: transparent;
  cursor: default;
}
.nav-tabs.nav-justified {
  width: 100%;
  border-bottom: 0;
}
.nav-tabs.nav-justified > li {
  float: none;
}
.nav-tabs.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-tabs.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-tabs.nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs.nav-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs.nav-justified > .active > a,
.nav-tabs.nav-justified > .active > a:hover,
.nav-tabs.nav-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs.nav-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs.nav-justified > .active > a,
  .nav-tabs.nav-justified > .active > a:hover,
  .nav-tabs.nav-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.nav-pills > li {
  float: left;
}
.nav-pills > li > a {
  border-radius: 2px;
}
.nav-pills > li + li {
  margin-left: 2px;
}
.nav-pills > li.active > a,
.nav-pills > li.active > a:hover,
.nav-pills > li.active > a:focus {
  color: #fff;
  background-color: #337ab7;
}
.nav-stacked > li {
  float: none;
}
.nav-stacked > li + li {
  margin-top: 2px;
  margin-left: 0;
}
.nav-justified {
  width: 100%;
}
.nav-justified > li {
  float: none;
}
.nav-justified > li > a {
  text-align: center;
  margin-bottom: 5px;
}
.nav-justified > .dropdown .dropdown-menu {
  top: auto;
  left: auto;
}
@media (min-width: 768px) {
  .nav-justified > li {
    display: table-cell;
    width: 1%;
  }
  .nav-justified > li > a {
    margin-bottom: 0;
  }
}
.nav-tabs-justified {
  border-bottom: 0;
}
.nav-tabs-justified > li > a {
  margin-right: 0;
  border-radius: 2px;
}
.nav-tabs-justified > .active > a,
.nav-tabs-justified > .active > a:hover,
.nav-tabs-justified > .active > a:focus {
  border: 1px solid #ddd;
}
@media (min-width: 768px) {
  .nav-tabs-justified > li > a {
    border-bottom: 1px solid #ddd;
    border-radius: 2px 2px 0 0;
  }
  .nav-tabs-justified > .active > a,
  .nav-tabs-justified > .active > a:hover,
  .nav-tabs-justified > .active > a:focus {
    border-bottom-color: #fff;
  }
}
.tab-content > .tab-pane {
  display: none;
}
.tab-content > .active {
  display: block;
}
.nav-tabs .dropdown-menu {
  margin-top: -1px;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar {
  position: relative;
  min-height: 30px;
  margin-bottom: 18px;
  border: 1px solid transparent;
}
@media (min-width: 541px) {
  .navbar {
    border-radius: 2px;
  }
}
@media (min-width: 541px) {
  .navbar-header {
    float: left;
  }
}
.navbar-collapse {
  overflow-x: visible;
  padding-right: 0px;
  padding-left: 0px;
  border-top: 1px solid transparent;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1);
  -webkit-overflow-scrolling: touch;
}
.navbar-collapse.in {
  overflow-y: auto;
}
@media (min-width: 541px) {
  .navbar-collapse {
    width: auto;
    border-top: 0;
    box-shadow: none;
  }
  .navbar-collapse.collapse {
    display: block !important;
    height: auto !important;
    padding-bottom: 0;
    overflow: visible !important;
  }
  .navbar-collapse.in {
    overflow-y: visible;
  }
  .navbar-fixed-top .navbar-collapse,
  .navbar-static-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    padding-left: 0;
    padding-right: 0;
  }
}
.navbar-fixed-top .navbar-collapse,
.navbar-fixed-bottom .navbar-collapse {
  max-height: 340px;
}
@media (max-device-width: 540px) and (orientation: landscape) {
  .navbar-fixed-top .navbar-collapse,
  .navbar-fixed-bottom .navbar-collapse {
    max-height: 200px;
  }
}
.container > .navbar-header,
.container-fluid > .navbar-header,
.container > .navbar-collapse,
.container-fluid > .navbar-collapse {
  margin-right: 0px;
  margin-left: 0px;
}
@media (min-width: 541px) {
  .container > .navbar-header,
  .container-fluid > .navbar-header,
  .container > .navbar-collapse,
  .container-fluid > .navbar-collapse {
    margin-right: 0;
    margin-left: 0;
  }
}
.navbar-static-top {
  z-index: 1000;
  border-width: 0 0 1px;
}
@media (min-width: 541px) {
  .navbar-static-top {
    border-radius: 0;
  }
}
.navbar-fixed-top,
.navbar-fixed-bottom {
  position: fixed;
  right: 0;
  left: 0;
  z-index: 1030;
}
@media (min-width: 541px) {
  .navbar-fixed-top,
  .navbar-fixed-bottom {
    border-radius: 0;
  }
}
.navbar-fixed-top {
  top: 0;
  border-width: 0 0 1px;
}
.navbar-fixed-bottom {
  bottom: 0;
  margin-bottom: 0;
  border-width: 1px 0 0;
}
.navbar-brand {
  float: left;
  padding: 6px 0px;
  font-size: 17px;
  line-height: 18px;
  height: 30px;
}
.navbar-brand:hover,
.navbar-brand:focus {
  text-decoration: none;
}
.navbar-brand > img {
  display: block;
}
@media (min-width: 541px) {
  .navbar > .container .navbar-brand,
  .navbar > .container-fluid .navbar-brand {
    margin-left: 0px;
  }
}
.navbar-toggle {
  position: relative;
  float: right;
  margin-right: 0px;
  padding: 9px 10px;
  margin-top: -2px;
  margin-bottom: -2px;
  background-color: transparent;
  background-image: none;
  border: 1px solid transparent;
  border-radius: 2px;
}
.navbar-toggle:focus {
  outline: 0;
}
.navbar-toggle .icon-bar {
  display: block;
  width: 22px;
  height: 2px;
  border-radius: 1px;
}
.navbar-toggle .icon-bar + .icon-bar {
  margin-top: 4px;
}
@media (min-width: 541px) {
  .navbar-toggle {
    display: none;
  }
}
.navbar-nav {
  margin: 3px 0px;
}
.navbar-nav > li > a {
  padding-top: 10px;
  padding-bottom: 10px;
  line-height: 18px;
}
@media (max-width: 540px) {
  .navbar-nav .open .dropdown-menu {
    position: static;
    float: none;
    width: auto;
    margin-top: 0;
    background-color: transparent;
    border: 0;
    box-shadow: none;
  }
  .navbar-nav .open .dropdown-menu > li > a,
  .navbar-nav .open .dropdown-menu .dropdown-header {
    padding: 5px 15px 5px 25px;
  }
  .navbar-nav .open .dropdown-menu > li > a {
    line-height: 18px;
  }
  .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-nav .open .dropdown-menu > li > a:focus {
    background-image: none;
  }
}
@media (min-width: 541px) {
  .navbar-nav {
    float: left;
    margin: 0;
  }
  .navbar-nav > li {
    float: left;
  }
  .navbar-nav > li > a {
    padding-top: 6px;
    padding-bottom: 6px;
  }
}
.navbar-form {
  margin-left: 0px;
  margin-right: 0px;
  padding: 10px 0px;
  border-top: 1px solid transparent;
  border-bottom: 1px solid transparent;
  -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.1), 0 1px 0 rgba(255, 255, 255, 0.1);
  margin-top: -1px;
  margin-bottom: -1px;
}
@media (min-width: 768px) {
  .navbar-form .form-group {
    display: inline-block;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .form-control {
    display: inline-block;
    width: auto;
    vertical-align: middle;
  }
  .navbar-form .form-control-static {
    display: inline-block;
  }
  .navbar-form .input-group {
    display: inline-table;
    vertical-align: middle;
  }
  .navbar-form .input-group .input-group-addon,
  .navbar-form .input-group .input-group-btn,
  .navbar-form .input-group .form-control {
    width: auto;
  }
  .navbar-form .input-group > .form-control {
    width: 100%;
  }
  .navbar-form .control-label {
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio,
  .navbar-form .checkbox {
    display: inline-block;
    margin-top: 0;
    margin-bottom: 0;
    vertical-align: middle;
  }
  .navbar-form .radio label,
  .navbar-form .checkbox label {
    padding-left: 0;
  }
  .navbar-form .radio input[type="radio"],
  .navbar-form .checkbox input[type="checkbox"] {
    position: relative;
    margin-left: 0;
  }
  .navbar-form .has-feedback .form-control-feedback {
    top: 0;
  }
}
@media (max-width: 540px) {
  .navbar-form .form-group {
    margin-bottom: 5px;
  }
  .navbar-form .form-group:last-child {
    margin-bottom: 0;
  }
}
@media (min-width: 541px) {
  .navbar-form {
    width: auto;
    border: 0;
    margin-left: 0;
    margin-right: 0;
    padding-top: 0;
    padding-bottom: 0;
    -webkit-box-shadow: none;
    box-shadow: none;
  }
}
.navbar-nav > li > .dropdown-menu {
  margin-top: 0;
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.navbar-fixed-bottom .navbar-nav > li > .dropdown-menu {
  margin-bottom: 0;
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
  border-bottom-right-radius: 0;
  border-bottom-left-radius: 0;
}
.navbar-btn {
  margin-top: -1px;
  margin-bottom: -1px;
}
.navbar-btn.btn-sm {
  margin-top: 0px;
  margin-bottom: 0px;
}
.navbar-btn.btn-xs {
  margin-top: 4px;
  margin-bottom: 4px;
}
.navbar-text {
  margin-top: 6px;
  margin-bottom: 6px;
}
@media (min-width: 541px) {
  .navbar-text {
    float: left;
    margin-left: 0px;
    margin-right: 0px;
  }
}
@media (min-width: 541px) {
  .navbar-left {
    float: left !important;
    float: left;
  }
  .navbar-right {
    float: right !important;
    float: right;
    margin-right: 0px;
  }
  .navbar-right ~ .navbar-right {
    margin-right: 0;
  }
}
.navbar-default {
  background-color: #f8f8f8;
  border-color: #e7e7e7;
}
.navbar-default .navbar-brand {
  color: #777;
}
.navbar-default .navbar-brand:hover,
.navbar-default .navbar-brand:focus {
  color: #5e5e5e;
  background-color: transparent;
}
.navbar-default .navbar-text {
  color: #777;
}
.navbar-default .navbar-nav > li > a {
  color: #777;
}
.navbar-default .navbar-nav > li > a:hover,
.navbar-default .navbar-nav > li > a:focus {
  color: #333;
  background-color: transparent;
}
.navbar-default .navbar-nav > .active > a,
.navbar-default .navbar-nav > .active > a:hover,
.navbar-default .navbar-nav > .active > a:focus {
  color: #555;
  background-color: #e7e7e7;
}
.navbar-default .navbar-nav > .disabled > a,
.navbar-default .navbar-nav > .disabled > a:hover,
.navbar-default .navbar-nav > .disabled > a:focus {
  color: #ccc;
  background-color: transparent;
}
.navbar-default .navbar-toggle {
  border-color: #ddd;
}
.navbar-default .navbar-toggle:hover,
.navbar-default .navbar-toggle:focus {
  background-color: #ddd;
}
.navbar-default .navbar-toggle .icon-bar {
  background-color: #888;
}
.navbar-default .navbar-collapse,
.navbar-default .navbar-form {
  border-color: #e7e7e7;
}
.navbar-default .navbar-nav > .open > a,
.navbar-default .navbar-nav > .open > a:hover,
.navbar-default .navbar-nav > .open > a:focus {
  background-color: #e7e7e7;
  color: #555;
}
@media (max-width: 540px) {
  .navbar-default .navbar-nav .open .dropdown-menu > li > a {
    color: #777;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #333;
    background-color: transparent;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #555;
    background-color: #e7e7e7;
  }
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-default .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #ccc;
    background-color: transparent;
  }
}
.navbar-default .navbar-link {
  color: #777;
}
.navbar-default .navbar-link:hover {
  color: #333;
}
.navbar-default .btn-link {
  color: #777;
}
.navbar-default .btn-link:hover,
.navbar-default .btn-link:focus {
  color: #333;
}
.navbar-default .btn-link[disabled]:hover,
fieldset[disabled] .navbar-default .btn-link:hover,
.navbar-default .btn-link[disabled]:focus,
fieldset[disabled] .navbar-default .btn-link:focus {
  color: #ccc;
}
.navbar-inverse {
  background-color: #222;
  border-color: #080808;
}
.navbar-inverse .navbar-brand {
  color: #9d9d9d;
}
.navbar-inverse .navbar-brand:hover,
.navbar-inverse .navbar-brand:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-text {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a {
  color: #9d9d9d;
}
.navbar-inverse .navbar-nav > li > a:hover,
.navbar-inverse .navbar-nav > li > a:focus {
  color: #fff;
  background-color: transparent;
}
.navbar-inverse .navbar-nav > .active > a,
.navbar-inverse .navbar-nav > .active > a:hover,
.navbar-inverse .navbar-nav > .active > a:focus {
  color: #fff;
  background-color: #080808;
}
.navbar-inverse .navbar-nav > .disabled > a,
.navbar-inverse .navbar-nav > .disabled > a:hover,
.navbar-inverse .navbar-nav > .disabled > a:focus {
  color: #444;
  background-color: transparent;
}
.navbar-inverse .navbar-toggle {
  border-color: #333;
}
.navbar-inverse .navbar-toggle:hover,
.navbar-inverse .navbar-toggle:focus {
  background-color: #333;
}
.navbar-inverse .navbar-toggle .icon-bar {
  background-color: #fff;
}
.navbar-inverse .navbar-collapse,
.navbar-inverse .navbar-form {
  border-color: #101010;
}
.navbar-inverse .navbar-nav > .open > a,
.navbar-inverse .navbar-nav > .open > a:hover,
.navbar-inverse .navbar-nav > .open > a:focus {
  background-color: #080808;
  color: #fff;
}
@media (max-width: 540px) {
  .navbar-inverse .navbar-nav .open .dropdown-menu > .dropdown-header {
    border-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu .divider {
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a {
    color: #9d9d9d;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > li > a:focus {
    color: #fff;
    background-color: transparent;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .active > a:focus {
    color: #fff;
    background-color: #080808;
  }
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:hover,
  .navbar-inverse .navbar-nav .open .dropdown-menu > .disabled > a:focus {
    color: #444;
    background-color: transparent;
  }
}
.navbar-inverse .navbar-link {
  color: #9d9d9d;
}
.navbar-inverse .navbar-link:hover {
  color: #fff;
}
.navbar-inverse .btn-link {
  color: #9d9d9d;
}
.navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link:focus {
  color: #fff;
}
.navbar-inverse .btn-link[disabled]:hover,
fieldset[disabled] .navbar-inverse .btn-link:hover,
.navbar-inverse .btn-link[disabled]:focus,
fieldset[disabled] .navbar-inverse .btn-link:focus {
  color: #444;
}
.breadcrumb {
  padding: 8px 15px;
  margin-bottom: 18px;
  list-style: none;
  background-color: #f5f5f5;
  border-radius: 2px;
}
.breadcrumb > li {
  display: inline-block;
}
.breadcrumb > li + li:before {
  content: "/\00a0";
  padding: 0 5px;
  color: #5e5e5e;
}
.breadcrumb > .active {
  color: #777777;
}
.pagination {
  display: inline-block;
  padding-left: 0;
  margin: 18px 0;
  border-radius: 2px;
}
.pagination > li {
  display: inline;
}
.pagination > li > a,
.pagination > li > span {
  position: relative;
  float: left;
  padding: 6px 12px;
  line-height: 1.42857143;
  text-decoration: none;
  color: #337ab7;
  background-color: #fff;
  border: 1px solid #ddd;
  margin-left: -1px;
}
.pagination > li:first-child > a,
.pagination > li:first-child > span {
  margin-left: 0;
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.pagination > li:last-child > a,
.pagination > li:last-child > span {
  border-bottom-right-radius: 2px;
  border-top-right-radius: 2px;
}
.pagination > li > a:hover,
.pagination > li > span:hover,
.pagination > li > a:focus,
.pagination > li > span:focus {
  z-index: 2;
  color: #23527c;
  background-color: #eeeeee;
  border-color: #ddd;
}
.pagination > .active > a,
.pagination > .active > span,
.pagination > .active > a:hover,
.pagination > .active > span:hover,
.pagination > .active > a:focus,
.pagination > .active > span:focus {
  z-index: 3;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
  cursor: default;
}
.pagination > .disabled > span,
.pagination > .disabled > span:hover,
.pagination > .disabled > span:focus,
.pagination > .disabled > a,
.pagination > .disabled > a:hover,
.pagination > .disabled > a:focus {
  color: #777777;
  background-color: #fff;
  border-color: #ddd;
  cursor: not-allowed;
}
.pagination-lg > li > a,
.pagination-lg > li > span {
  padding: 10px 16px;
  font-size: 17px;
  line-height: 1.3333333;
}
.pagination-lg > li:first-child > a,
.pagination-lg > li:first-child > span {
  border-bottom-left-radius: 3px;
  border-top-left-radius: 3px;
}
.pagination-lg > li:last-child > a,
.pagination-lg > li:last-child > span {
  border-bottom-right-radius: 3px;
  border-top-right-radius: 3px;
}
.pagination-sm > li > a,
.pagination-sm > li > span {
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
}
.pagination-sm > li:first-child > a,
.pagination-sm > li:first-child > span {
  border-bottom-left-radius: 1px;
  border-top-left-radius: 1px;
}
.pagination-sm > li:last-child > a,
.pagination-sm > li:last-child > span {
  border-bottom-right-radius: 1px;
  border-top-right-radius: 1px;
}
.pager {
  padding-left: 0;
  margin: 18px 0;
  list-style: none;
  text-align: center;
}
.pager li {
  display: inline;
}
.pager li > a,
.pager li > span {
  display: inline-block;
  padding: 5px 14px;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 15px;
}
.pager li > a:hover,
.pager li > a:focus {
  text-decoration: none;
  background-color: #eeeeee;
}
.pager .next > a,
.pager .next > span {
  float: right;
}
.pager .previous > a,
.pager .previous > span {
  float: left;
}
.pager .disabled > a,
.pager .disabled > a:hover,
.pager .disabled > a:focus,
.pager .disabled > span {
  color: #777777;
  background-color: #fff;
  cursor: not-allowed;
}
.label {
  display: inline;
  padding: .2em .6em .3em;
  font-size: 75%;
  font-weight: bold;
  line-height: 1;
  color: #fff;
  text-align: center;
  white-space: nowrap;
  vertical-align: baseline;
  border-radius: .25em;
}
a.label:hover,
a.label:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.label:empty {
  display: none;
}
.btn .label {
  position: relative;
  top: -1px;
}
.label-default {
  background-color: #777777;
}
.label-default[href]:hover,
.label-default[href]:focus {
  background-color: #5e5e5e;
}
.label-primary {
  background-color: #337ab7;
}
.label-primary[href]:hover,
.label-primary[href]:focus {
  background-color: #286090;
}
.label-success {
  background-color: #5cb85c;
}
.label-success[href]:hover,
.label-success[href]:focus {
  background-color: #449d44;
}
.label-info {
  background-color: #5bc0de;
}
.label-info[href]:hover,
.label-info[href]:focus {
  background-color: #31b0d5;
}
.label-warning {
  background-color: #f0ad4e;
}
.label-warning[href]:hover,
.label-warning[href]:focus {
  background-color: #ec971f;
}
.label-danger {
  background-color: #d9534f;
}
.label-danger[href]:hover,
.label-danger[href]:focus {
  background-color: #c9302c;
}
.badge {
  display: inline-block;
  min-width: 10px;
  padding: 3px 7px;
  font-size: 12px;
  font-weight: bold;
  color: #fff;
  line-height: 1;
  vertical-align: middle;
  white-space: nowrap;
  text-align: center;
  background-color: #777777;
  border-radius: 10px;
}
.badge:empty {
  display: none;
}
.btn .badge {
  position: relative;
  top: -1px;
}
.btn-xs .badge,
.btn-group-xs > .btn .badge {
  top: 0;
  padding: 1px 5px;
}
a.badge:hover,
a.badge:focus {
  color: #fff;
  text-decoration: none;
  cursor: pointer;
}
.list-group-item.active > .badge,
.nav-pills > .active > a > .badge {
  color: #337ab7;
  background-color: #fff;
}
.list-group-item > .badge {
  float: right;
}
.list-group-item > .badge + .badge {
  margin-right: 5px;
}
.nav-pills > li > a > .badge {
  margin-left: 3px;
}
.jumbotron {
  padding-top: 30px;
  padding-bottom: 30px;
  margin-bottom: 30px;
  color: inherit;
  background-color: #eeeeee;
}
.jumbotron h1,
.jumbotron .h1 {
  color: inherit;
}
.jumbotron p {
  margin-bottom: 15px;
  font-size: 20px;
  font-weight: 200;
}
.jumbotron > hr {
  border-top-color: #d5d5d5;
}
.container .jumbotron,
.container-fluid .jumbotron {
  border-radius: 3px;
  padding-left: 0px;
  padding-right: 0px;
}
.jumbotron .container {
  max-width: 100%;
}
@media screen and (min-width: 768px) {
  .jumbotron {
    padding-top: 48px;
    padding-bottom: 48px;
  }
  .container .jumbotron,
  .container-fluid .jumbotron {
    padding-left: 60px;
    padding-right: 60px;
  }
  .jumbotron h1,
  .jumbotron .h1 {
    font-size: 59px;
  }
}
.thumbnail {
  display: block;
  padding: 4px;
  margin-bottom: 18px;
  line-height: 1.42857143;
  background-color: #fff;
  border: 1px solid #ddd;
  border-radius: 2px;
  -webkit-transition: border 0.2s ease-in-out;
  -o-transition: border 0.2s ease-in-out;
  transition: border 0.2s ease-in-out;
}
.thumbnail > img,
.thumbnail a > img {
  margin-left: auto;
  margin-right: auto;
}
a.thumbnail:hover,
a.thumbnail:focus,
a.thumbnail.active {
  border-color: #337ab7;
}
.thumbnail .caption {
  padding: 9px;
  color: #000;
}
.alert {
  padding: 15px;
  margin-bottom: 18px;
  border: 1px solid transparent;
  border-radius: 2px;
}
.alert h4 {
  margin-top: 0;
  color: inherit;
}
.alert .alert-link {
  font-weight: bold;
}
.alert > p,
.alert > ul {
  margin-bottom: 0;
}
.alert > p + p {
  margin-top: 5px;
}
.alert-dismissable,
.alert-dismissible {
  padding-right: 35px;
}
.alert-dismissable .close,
.alert-dismissible .close {
  position: relative;
  top: -2px;
  right: -21px;
  color: inherit;
}
.alert-success {
  background-color: #dff0d8;
  border-color: #d6e9c6;
  color: #3c763d;
}
.alert-success hr {
  border-top-color: #c9e2b3;
}
.alert-success .alert-link {
  color: #2b542c;
}
.alert-info {
  background-color: #d9edf7;
  border-color: #bce8f1;
  color: #31708f;
}
.alert-info hr {
  border-top-color: #a6e1ec;
}
.alert-info .alert-link {
  color: #245269;
}
.alert-warning {
  background-color: #fcf8e3;
  border-color: #faebcc;
  color: #8a6d3b;
}
.alert-warning hr {
  border-top-color: #f7e1b5;
}
.alert-warning .alert-link {
  color: #66512c;
}
.alert-danger {
  background-color: #f2dede;
  border-color: #ebccd1;
  color: #a94442;
}
.alert-danger hr {
  border-top-color: #e4b9c0;
}
.alert-danger .alert-link {
  color: #843534;
}
@-webkit-keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
@keyframes progress-bar-stripes {
  from {
    background-position: 40px 0;
  }
  to {
    background-position: 0 0;
  }
}
.progress {
  overflow: hidden;
  height: 18px;
  margin-bottom: 18px;
  background-color: #f5f5f5;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);
}
.progress-bar {
  float: left;
  width: 0%;
  height: 100%;
  font-size: 12px;
  line-height: 18px;
  color: #fff;
  text-align: center;
  background-color: #337ab7;
  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);
  -webkit-transition: width 0.6s ease;
  -o-transition: width 0.6s ease;
  transition: width 0.6s ease;
}
.progress-striped .progress-bar,
.progress-bar-striped {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-size: 40px 40px;
}
.progress.active .progress-bar,
.progress-bar.active {
  -webkit-animation: progress-bar-stripes 2s linear infinite;
  -o-animation: progress-bar-stripes 2s linear infinite;
  animation: progress-bar-stripes 2s linear infinite;
}
.progress-bar-success {
  background-color: #5cb85c;
}
.progress-striped .progress-bar-success {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-info {
  background-color: #5bc0de;
}
.progress-striped .progress-bar-info {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-warning {
  background-color: #f0ad4e;
}
.progress-striped .progress-bar-warning {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.progress-bar-danger {
  background-color: #d9534f;
}
.progress-striped .progress-bar-danger {
  background-image: -webkit-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: -o-linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
  background-image: linear-gradient(45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);
}
.media {
  margin-top: 15px;
}
.media:first-child {
  margin-top: 0;
}
.media,
.media-body {
  zoom: 1;
  overflow: hidden;
}
.media-body {
  width: 10000px;
}
.media-object {
  display: block;
}
.media-object.img-thumbnail {
  max-width: none;
}
.media-right,
.media > .pull-right {
  padding-left: 10px;
}
.media-left,
.media > .pull-left {
  padding-right: 10px;
}
.media-left,
.media-right,
.media-body {
  display: table-cell;
  vertical-align: top;
}
.media-middle {
  vertical-align: middle;
}
.media-bottom {
  vertical-align: bottom;
}
.media-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.media-list {
  padding-left: 0;
  list-style: none;
}
.list-group {
  margin-bottom: 20px;
  padding-left: 0;
}
.list-group-item {
  position: relative;
  display: block;
  padding: 10px 15px;
  margin-bottom: -1px;
  background-color: #fff;
  border: 1px solid #ddd;
}
.list-group-item:first-child {
  border-top-right-radius: 2px;
  border-top-left-radius: 2px;
}
.list-group-item:last-child {
  margin-bottom: 0;
  border-bottom-right-radius: 2px;
  border-bottom-left-radius: 2px;
}
a.list-group-item,
button.list-group-item {
  color: #555;
}
a.list-group-item .list-group-item-heading,
button.list-group-item .list-group-item-heading {
  color: #333;
}
a.list-group-item:hover,
button.list-group-item:hover,
a.list-group-item:focus,
button.list-group-item:focus {
  text-decoration: none;
  color: #555;
  background-color: #f5f5f5;
}
button.list-group-item {
  width: 100%;
  text-align: left;
}
.list-group-item.disabled,
.list-group-item.disabled:hover,
.list-group-item.disabled:focus {
  background-color: #eeeeee;
  color: #777777;
  cursor: not-allowed;
}
.list-group-item.disabled .list-group-item-heading,
.list-group-item.disabled:hover .list-group-item-heading,
.list-group-item.disabled:focus .list-group-item-heading {
  color: inherit;
}
.list-group-item.disabled .list-group-item-text,
.list-group-item.disabled:hover .list-group-item-text,
.list-group-item.disabled:focus .list-group-item-text {
  color: #777777;
}
.list-group-item.active,
.list-group-item.active:hover,
.list-group-item.active:focus {
  z-index: 2;
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.list-group-item.active .list-group-item-heading,
.list-group-item.active:hover .list-group-item-heading,
.list-group-item.active:focus .list-group-item-heading,
.list-group-item.active .list-group-item-heading > small,
.list-group-item.active:hover .list-group-item-heading > small,
.list-group-item.active:focus .list-group-item-heading > small,
.list-group-item.active .list-group-item-heading > .small,
.list-group-item.active:hover .list-group-item-heading > .small,
.list-group-item.active:focus .list-group-item-heading > .small {
  color: inherit;
}
.list-group-item.active .list-group-item-text,
.list-group-item.active:hover .list-group-item-text,
.list-group-item.active:focus .list-group-item-text {
  color: #c7ddef;
}
.list-group-item-success {
  color: #3c763d;
  background-color: #dff0d8;
}
a.list-group-item-success,
button.list-group-item-success {
  color: #3c763d;
}
a.list-group-item-success .list-group-item-heading,
button.list-group-item-success .list-group-item-heading {
  color: inherit;
}
a.list-group-item-success:hover,
button.list-group-item-success:hover,
a.list-group-item-success:focus,
button.list-group-item-success:focus {
  color: #3c763d;
  background-color: #d0e9c6;
}
a.list-group-item-success.active,
button.list-group-item-success.active,
a.list-group-item-success.active:hover,
button.list-group-item-success.active:hover,
a.list-group-item-success.active:focus,
button.list-group-item-success.active:focus {
  color: #fff;
  background-color: #3c763d;
  border-color: #3c763d;
}
.list-group-item-info {
  color: #31708f;
  background-color: #d9edf7;
}
a.list-group-item-info,
button.list-group-item-info {
  color: #31708f;
}
a.list-group-item-info .list-group-item-heading,
button.list-group-item-info .list-group-item-heading {
  color: inherit;
}
a.list-group-item-info:hover,
button.list-group-item-info:hover,
a.list-group-item-info:focus,
button.list-group-item-info:focus {
  color: #31708f;
  background-color: #c4e3f3;
}
a.list-group-item-info.active,
button.list-group-item-info.active,
a.list-group-item-info.active:hover,
button.list-group-item-info.active:hover,
a.list-group-item-info.active:focus,
button.list-group-item-info.active:focus {
  color: #fff;
  background-color: #31708f;
  border-color: #31708f;
}
.list-group-item-warning {
  color: #8a6d3b;
  background-color: #fcf8e3;
}
a.list-group-item-warning,
button.list-group-item-warning {
  color: #8a6d3b;
}
a.list-group-item-warning .list-group-item-heading,
button.list-group-item-warning .list-group-item-heading {
  color: inherit;
}
a.list-group-item-warning:hover,
button.list-group-item-warning:hover,
a.list-group-item-warning:focus,
button.list-group-item-warning:focus {
  color: #8a6d3b;
  background-color: #faf2cc;
}
a.list-group-item-warning.active,
button.list-group-item-warning.active,
a.list-group-item-warning.active:hover,
button.list-group-item-warning.active:hover,
a.list-group-item-warning.active:focus,
button.list-group-item-warning.active:focus {
  color: #fff;
  background-color: #8a6d3b;
  border-color: #8a6d3b;
}
.list-group-item-danger {
  color: #a94442;
  background-color: #f2dede;
}
a.list-group-item-danger,
button.list-group-item-danger {
  color: #a94442;
}
a.list-group-item-danger .list-group-item-heading,
button.list-group-item-danger .list-group-item-heading {
  color: inherit;
}
a.list-group-item-danger:hover,
button.list-group-item-danger:hover,
a.list-group-item-danger:focus,
button.list-group-item-danger:focus {
  color: #a94442;
  background-color: #ebcccc;
}
a.list-group-item-danger.active,
button.list-group-item-danger.active,
a.list-group-item-danger.active:hover,
button.list-group-item-danger.active:hover,
a.list-group-item-danger.active:focus,
button.list-group-item-danger.active:focus {
  color: #fff;
  background-color: #a94442;
  border-color: #a94442;
}
.list-group-item-heading {
  margin-top: 0;
  margin-bottom: 5px;
}
.list-group-item-text {
  margin-bottom: 0;
  line-height: 1.3;
}
.panel {
  margin-bottom: 18px;
  background-color: #fff;
  border: 1px solid transparent;
  border-radius: 2px;
  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.05);
}
.panel-body {
  padding: 15px;
}
.panel-heading {
  padding: 10px 15px;
  border-bottom: 1px solid transparent;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel-heading > .dropdown .dropdown-toggle {
  color: inherit;
}
.panel-title {
  margin-top: 0;
  margin-bottom: 0;
  font-size: 15px;
  color: inherit;
}
.panel-title > a,
.panel-title > small,
.panel-title > .small,
.panel-title > small > a,
.panel-title > .small > a {
  color: inherit;
}
.panel-footer {
  padding: 10px 15px;
  background-color: #f5f5f5;
  border-top: 1px solid #ddd;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .list-group,
.panel > .panel-collapse > .list-group {
  margin-bottom: 0;
}
.panel > .list-group .list-group-item,
.panel > .panel-collapse > .list-group .list-group-item {
  border-width: 1px 0;
  border-radius: 0;
}
.panel > .list-group:first-child .list-group-item:first-child,
.panel > .panel-collapse > .list-group:first-child .list-group-item:first-child {
  border-top: 0;
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .list-group:last-child .list-group-item:last-child,
.panel > .panel-collapse > .list-group:last-child .list-group-item:last-child {
  border-bottom: 0;
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .panel-heading + .panel-collapse > .list-group .list-group-item:first-child {
  border-top-right-radius: 0;
  border-top-left-radius: 0;
}
.panel-heading + .list-group .list-group-item:first-child {
  border-top-width: 0;
}
.list-group + .panel-footer {
  border-top-width: 0;
}
.panel > .table,
.panel > .table-responsive > .table,
.panel > .panel-collapse > .table {
  margin-bottom: 0;
}
.panel > .table caption,
.panel > .table-responsive > .table caption,
.panel > .panel-collapse > .table caption {
  padding-left: 15px;
  padding-right: 15px;
}
.panel > .table:first-child,
.panel > .table-responsive:first-child > .table:first-child {
  border-top-right-radius: 1px;
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child {
  border-top-left-radius: 1px;
  border-top-right-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:first-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:first-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:first-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:first-child {
  border-top-left-radius: 1px;
}
.panel > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child td:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child td:last-child,
.panel > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > thead:first-child > tr:first-child th:last-child,
.panel > .table:first-child > tbody:first-child > tr:first-child th:last-child,
.panel > .table-responsive:first-child > .table:first-child > tbody:first-child > tr:first-child th:last-child {
  border-top-right-radius: 1px;
}
.panel > .table:last-child,
.panel > .table-responsive:last-child > .table:last-child {
  border-bottom-right-radius: 1px;
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child {
  border-bottom-left-radius: 1px;
  border-bottom-right-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:first-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:first-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:first-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:first-child {
  border-bottom-left-radius: 1px;
}
.panel > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child td:last-child,
.panel > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tbody:last-child > tr:last-child th:last-child,
.panel > .table:last-child > tfoot:last-child > tr:last-child th:last-child,
.panel > .table-responsive:last-child > .table:last-child > tfoot:last-child > tr:last-child th:last-child {
  border-bottom-right-radius: 1px;
}
.panel > .panel-body + .table,
.panel > .panel-body + .table-responsive,
.panel > .table + .panel-body,
.panel > .table-responsive + .panel-body {
  border-top: 1px solid #ddd;
}
.panel > .table > tbody:first-child > tr:first-child th,
.panel > .table > tbody:first-child > tr:first-child td {
  border-top: 0;
}
.panel > .table-bordered,
.panel > .table-responsive > .table-bordered {
  border: 0;
}
.panel > .table-bordered > thead > tr > th:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:first-child,
.panel > .table-bordered > tbody > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:first-child,
.panel > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:first-child,
.panel > .table-bordered > thead > tr > td:first-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:first-child,
.panel > .table-bordered > tbody > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:first-child,
.panel > .table-bordered > tfoot > tr > td:first-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:first-child {
  border-left: 0;
}
.panel > .table-bordered > thead > tr > th:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > th:last-child,
.panel > .table-bordered > tbody > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > th:last-child,
.panel > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > th:last-child,
.panel > .table-bordered > thead > tr > td:last-child,
.panel > .table-responsive > .table-bordered > thead > tr > td:last-child,
.panel > .table-bordered > tbody > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tbody > tr > td:last-child,
.panel > .table-bordered > tfoot > tr > td:last-child,
.panel > .table-responsive > .table-bordered > tfoot > tr > td:last-child {
  border-right: 0;
}
.panel > .table-bordered > thead > tr:first-child > td,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > td,
.panel > .table-bordered > tbody > tr:first-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > td,
.panel > .table-bordered > thead > tr:first-child > th,
.panel > .table-responsive > .table-bordered > thead > tr:first-child > th,
.panel > .table-bordered > tbody > tr:first-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:first-child > th {
  border-bottom: 0;
}
.panel > .table-bordered > tbody > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > td,
.panel > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > td,
.panel > .table-bordered > tbody > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tbody > tr:last-child > th,
.panel > .table-bordered > tfoot > tr:last-child > th,
.panel > .table-responsive > .table-bordered > tfoot > tr:last-child > th {
  border-bottom: 0;
}
.panel > .table-responsive {
  border: 0;
  margin-bottom: 0;
}
.panel-group {
  margin-bottom: 18px;
}
.panel-group .panel {
  margin-bottom: 0;
  border-radius: 2px;
}
.panel-group .panel + .panel {
  margin-top: 5px;
}
.panel-group .panel-heading {
  border-bottom: 0;
}
.panel-group .panel-heading + .panel-collapse > .panel-body,
.panel-group .panel-heading + .panel-collapse > .list-group {
  border-top: 1px solid #ddd;
}
.panel-group .panel-footer {
  border-top: 0;
}
.panel-group .panel-footer + .panel-collapse .panel-body {
  border-bottom: 1px solid #ddd;
}
.panel-default {
  border-color: #ddd;
}
.panel-default > .panel-heading {
  color: #333333;
  background-color: #f5f5f5;
  border-color: #ddd;
}
.panel-default > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ddd;
}
.panel-default > .panel-heading .badge {
  color: #f5f5f5;
  background-color: #333333;
}
.panel-default > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ddd;
}
.panel-primary {
  border-color: #337ab7;
}
.panel-primary > .panel-heading {
  color: #fff;
  background-color: #337ab7;
  border-color: #337ab7;
}
.panel-primary > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #337ab7;
}
.panel-primary > .panel-heading .badge {
  color: #337ab7;
  background-color: #fff;
}
.panel-primary > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #337ab7;
}
.panel-success {
  border-color: #d6e9c6;
}
.panel-success > .panel-heading {
  color: #3c763d;
  background-color: #dff0d8;
  border-color: #d6e9c6;
}
.panel-success > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #d6e9c6;
}
.panel-success > .panel-heading .badge {
  color: #dff0d8;
  background-color: #3c763d;
}
.panel-success > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #d6e9c6;
}
.panel-info {
  border-color: #bce8f1;
}
.panel-info > .panel-heading {
  color: #31708f;
  background-color: #d9edf7;
  border-color: #bce8f1;
}
.panel-info > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #bce8f1;
}
.panel-info > .panel-heading .badge {
  color: #d9edf7;
  background-color: #31708f;
}
.panel-info > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #bce8f1;
}
.panel-warning {
  border-color: #faebcc;
}
.panel-warning > .panel-heading {
  color: #8a6d3b;
  background-color: #fcf8e3;
  border-color: #faebcc;
}
.panel-warning > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #faebcc;
}
.panel-warning > .panel-heading .badge {
  color: #fcf8e3;
  background-color: #8a6d3b;
}
.panel-warning > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #faebcc;
}
.panel-danger {
  border-color: #ebccd1;
}
.panel-danger > .panel-heading {
  color: #a94442;
  background-color: #f2dede;
  border-color: #ebccd1;
}
.panel-danger > .panel-heading + .panel-collapse > .panel-body {
  border-top-color: #ebccd1;
}
.panel-danger > .panel-heading .badge {
  color: #f2dede;
  background-color: #a94442;
}
.panel-danger > .panel-footer + .panel-collapse > .panel-body {
  border-bottom-color: #ebccd1;
}
.embed-responsive {
  position: relative;
  display: block;
  height: 0;
  padding: 0;
  overflow: hidden;
}
.embed-responsive .embed-responsive-item,
.embed-responsive iframe,
.embed-responsive embed,
.embed-responsive object,
.embed-responsive video {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  height: 100%;
  width: 100%;
  border: 0;
}
.embed-responsive-16by9 {
  padding-bottom: 56.25%;
}
.embed-responsive-4by3 {
  padding-bottom: 75%;
}
.well {
  min-height: 20px;
  padding: 19px;
  margin-bottom: 20px;
  background-color: #f5f5f5;
  border: 1px solid #e3e3e3;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);
}
.well blockquote {
  border-color: #ddd;
  border-color: rgba(0, 0, 0, 0.15);
}
.well-lg {
  padding: 24px;
  border-radius: 3px;
}
.well-sm {
  padding: 9px;
  border-radius: 1px;
}
.close {
  float: right;
  font-size: 19.5px;
  font-weight: bold;
  line-height: 1;
  color: #000;
  text-shadow: 0 1px 0 #fff;
  opacity: 0.2;
  filter: alpha(opacity=20);
}
.close:hover,
.close:focus {
  color: #000;
  text-decoration: none;
  cursor: pointer;
  opacity: 0.5;
  filter: alpha(opacity=50);
}
button.close {
  padding: 0;
  cursor: pointer;
  background: transparent;
  border: 0;
  -webkit-appearance: none;
}
.modal-open {
  overflow: hidden;
}
.modal {
  display: none;
  overflow: hidden;
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1050;
  -webkit-overflow-scrolling: touch;
  outline: 0;
}
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, -25%);
  -ms-transform: translate(0, -25%);
  -o-transform: translate(0, -25%);
  transform: translate(0, -25%);
  -webkit-transition: -webkit-transform 0.3s ease-out;
  -moz-transition: -moz-transform 0.3s ease-out;
  -o-transition: -o-transform 0.3s ease-out;
  transition: transform 0.3s ease-out;
}
.modal.in .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
.modal-open .modal {
  overflow-x: hidden;
  overflow-y: auto;
}
.modal-dialog {
  position: relative;
  width: auto;
  margin: 10px;
}
.modal-content {
  position: relative;
  background-color: #fff;
  border: 1px solid #999;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  box-shadow: 0 3px 9px rgba(0, 0, 0, 0.5);
  background-clip: padding-box;
  outline: 0;
}
.modal-backdrop {
  position: fixed;
  top: 0;
  right: 0;
  bottom: 0;
  left: 0;
  z-index: 1040;
  background-color: #000;
}
.modal-backdrop.fade {
  opacity: 0;
  filter: alpha(opacity=0);
}
.modal-backdrop.in {
  opacity: 0.5;
  filter: alpha(opacity=50);
}
.modal-header {
  padding: 15px;
  border-bottom: 1px solid #e5e5e5;
}
.modal-header .close {
  margin-top: -2px;
}
.modal-title {
  margin: 0;
  line-height: 1.42857143;
}
.modal-body {
  position: relative;
  padding: 15px;
}
.modal-footer {
  padding: 15px;
  text-align: right;
  border-top: 1px solid #e5e5e5;
}
.modal-footer .btn + .btn {
  margin-left: 5px;
  margin-bottom: 0;
}
.modal-footer .btn-group .btn + .btn {
  margin-left: -1px;
}
.modal-footer .btn-block + .btn-block {
  margin-left: 0;
}
.modal-scrollbar-measure {
  position: absolute;
  top: -9999px;
  width: 50px;
  height: 50px;
  overflow: scroll;
}
@media (min-width: 768px) {
  .modal-dialog {
    width: 600px;
    margin: 30px auto;
  }
  .modal-content {
    -webkit-box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
    box-shadow: 0 5px 15px rgba(0, 0, 0, 0.5);
  }
  .modal-sm {
    width: 300px;
  }
}
@media (min-width: 992px) {
  .modal-lg {
    width: 900px;
  }
}
.tooltip {
  position: absolute;
  z-index: 1070;
  display: block;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 12px;
  opacity: 0;
  filter: alpha(opacity=0);
}
.tooltip.in {
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.tooltip.top {
  margin-top: -3px;
  padding: 5px 0;
}
.tooltip.right {
  margin-left: 3px;
  padding: 0 5px;
}
.tooltip.bottom {
  margin-top: 3px;
  padding: 5px 0;
}
.tooltip.left {
  margin-left: -3px;
  padding: 0 5px;
}
.tooltip-inner {
  max-width: 200px;
  padding: 3px 8px;
  color: #fff;
  text-align: center;
  background-color: #000;
  border-radius: 2px;
}
.tooltip-arrow {
  position: absolute;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.tooltip.top .tooltip-arrow {
  bottom: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-left .tooltip-arrow {
  bottom: 0;
  right: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.top-right .tooltip-arrow {
  bottom: 0;
  left: 5px;
  margin-bottom: -5px;
  border-width: 5px 5px 0;
  border-top-color: #000;
}
.tooltip.right .tooltip-arrow {
  top: 50%;
  left: 0;
  margin-top: -5px;
  border-width: 5px 5px 5px 0;
  border-right-color: #000;
}
.tooltip.left .tooltip-arrow {
  top: 50%;
  right: 0;
  margin-top: -5px;
  border-width: 5px 0 5px 5px;
  border-left-color: #000;
}
.tooltip.bottom .tooltip-arrow {
  top: 0;
  left: 50%;
  margin-left: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-left .tooltip-arrow {
  top: 0;
  right: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.tooltip.bottom-right .tooltip-arrow {
  top: 0;
  left: 5px;
  margin-top: -5px;
  border-width: 0 5px 5px;
  border-bottom-color: #000;
}
.popover {
  position: absolute;
  top: 0;
  left: 0;
  z-index: 1060;
  display: none;
  max-width: 276px;
  padding: 1px;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
  font-style: normal;
  font-weight: normal;
  letter-spacing: normal;
  line-break: auto;
  line-height: 1.42857143;
  text-align: left;
  text-align: start;
  text-decoration: none;
  text-shadow: none;
  text-transform: none;
  white-space: normal;
  word-break: normal;
  word-spacing: normal;
  word-wrap: normal;
  font-size: 13px;
  background-color: #fff;
  background-clip: padding-box;
  border: 1px solid #ccc;
  border: 1px solid rgba(0, 0, 0, 0.2);
  border-radius: 3px;
  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);
}
.popover.top {
  margin-top: -10px;
}
.popover.right {
  margin-left: 10px;
}
.popover.bottom {
  margin-top: 10px;
}
.popover.left {
  margin-left: -10px;
}
.popover-title {
  margin: 0;
  padding: 8px 14px;
  font-size: 13px;
  background-color: #f7f7f7;
  border-bottom: 1px solid #ebebeb;
  border-radius: 2px 2px 0 0;
}
.popover-content {
  padding: 9px 14px;
}
.popover > .arrow,
.popover > .arrow:after {
  position: absolute;
  display: block;
  width: 0;
  height: 0;
  border-color: transparent;
  border-style: solid;
}
.popover > .arrow {
  border-width: 11px;
}
.popover > .arrow:after {
  border-width: 10px;
  content: "";
}
.popover.top > .arrow {
  left: 50%;
  margin-left: -11px;
  border-bottom-width: 0;
  border-top-color: #999999;
  border-top-color: rgba(0, 0, 0, 0.25);
  bottom: -11px;
}
.popover.top > .arrow:after {
  content: " ";
  bottom: 1px;
  margin-left: -10px;
  border-bottom-width: 0;
  border-top-color: #fff;
}
.popover.right > .arrow {
  top: 50%;
  left: -11px;
  margin-top: -11px;
  border-left-width: 0;
  border-right-color: #999999;
  border-right-color: rgba(0, 0, 0, 0.25);
}
.popover.right > .arrow:after {
  content: " ";
  left: 1px;
  bottom: -10px;
  border-left-width: 0;
  border-right-color: #fff;
}
.popover.bottom > .arrow {
  left: 50%;
  margin-left: -11px;
  border-top-width: 0;
  border-bottom-color: #999999;
  border-bottom-color: rgba(0, 0, 0, 0.25);
  top: -11px;
}
.popover.bottom > .arrow:after {
  content: " ";
  top: 1px;
  margin-left: -10px;
  border-top-width: 0;
  border-bottom-color: #fff;
}
.popover.left > .arrow {
  top: 50%;
  right: -11px;
  margin-top: -11px;
  border-right-width: 0;
  border-left-color: #999999;
  border-left-color: rgba(0, 0, 0, 0.25);
}
.popover.left > .arrow:after {
  content: " ";
  right: 1px;
  border-right-width: 0;
  border-left-color: #fff;
  bottom: -10px;
}
.carousel {
  position: relative;
}
.carousel-inner {
  position: relative;
  overflow: hidden;
  width: 100%;
}
.carousel-inner > .item {
  display: none;
  position: relative;
  -webkit-transition: 0.6s ease-in-out left;
  -o-transition: 0.6s ease-in-out left;
  transition: 0.6s ease-in-out left;
}
.carousel-inner > .item > img,
.carousel-inner > .item > a > img {
  line-height: 1;
}
@media all and (transform-3d), (-webkit-transform-3d) {
  .carousel-inner > .item {
    -webkit-transition: -webkit-transform 0.6s ease-in-out;
    -moz-transition: -moz-transform 0.6s ease-in-out;
    -o-transition: -o-transform 0.6s ease-in-out;
    transition: transform 0.6s ease-in-out;
    -webkit-backface-visibility: hidden;
    -moz-backface-visibility: hidden;
    backface-visibility: hidden;
    -webkit-perspective: 1000px;
    -moz-perspective: 1000px;
    perspective: 1000px;
  }
  .carousel-inner > .item.next,
  .carousel-inner > .item.active.right {
    -webkit-transform: translate3d(100%, 0, 0);
    transform: translate3d(100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.prev,
  .carousel-inner > .item.active.left {
    -webkit-transform: translate3d(-100%, 0, 0);
    transform: translate3d(-100%, 0, 0);
    left: 0;
  }
  .carousel-inner > .item.next.left,
  .carousel-inner > .item.prev.right,
  .carousel-inner > .item.active {
    -webkit-transform: translate3d(0, 0, 0);
    transform: translate3d(0, 0, 0);
    left: 0;
  }
}
.carousel-inner > .active,
.carousel-inner > .next,
.carousel-inner > .prev {
  display: block;
}
.carousel-inner > .active {
  left: 0;
}
.carousel-inner > .next,
.carousel-inner > .prev {
  position: absolute;
  top: 0;
  width: 100%;
}
.carousel-inner > .next {
  left: 100%;
}
.carousel-inner > .prev {
  left: -100%;
}
.carousel-inner > .next.left,
.carousel-inner > .prev.right {
  left: 0;
}
.carousel-inner > .active.left {
  left: -100%;
}
.carousel-inner > .active.right {
  left: 100%;
}
.carousel-control {
  position: absolute;
  top: 0;
  left: 0;
  bottom: 0;
  width: 15%;
  opacity: 0.5;
  filter: alpha(opacity=50);
  font-size: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
  background-color: rgba(0, 0, 0, 0);
}
.carousel-control.left {
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.5) 0%, rgba(0, 0, 0, 0.0001) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#80000000', endColorstr='#00000000', GradientType=1);
}
.carousel-control.right {
  left: auto;
  right: 0;
  background-image: -webkit-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: -o-linear-gradient(left, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-image: linear-gradient(to right, rgba(0, 0, 0, 0.0001) 0%, rgba(0, 0, 0, 0.5) 100%);
  background-repeat: repeat-x;
  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#00000000', endColorstr='#80000000', GradientType=1);
}
.carousel-control:hover,
.carousel-control:focus {
  outline: 0;
  color: #fff;
  text-decoration: none;
  opacity: 0.9;
  filter: alpha(opacity=90);
}
.carousel-control .icon-prev,
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-left,
.carousel-control .glyphicon-chevron-right {
  position: absolute;
  top: 50%;
  margin-top: -10px;
  z-index: 5;
  display: inline-block;
}
.carousel-control .icon-prev,
.carousel-control .glyphicon-chevron-left {
  left: 50%;
  margin-left: -10px;
}
.carousel-control .icon-next,
.carousel-control .glyphicon-chevron-right {
  right: 50%;
  margin-right: -10px;
}
.carousel-control .icon-prev,
.carousel-control .icon-next {
  width: 20px;
  height: 20px;
  line-height: 1;
  font-family: serif;
}
.carousel-control .icon-prev:before {
  content: '\2039';
}
.carousel-control .icon-next:before {
  content: '\203a';
}
.carousel-indicators {
  position: absolute;
  bottom: 10px;
  left: 50%;
  z-index: 15;
  width: 60%;
  margin-left: -30%;
  padding-left: 0;
  list-style: none;
  text-align: center;
}
.carousel-indicators li {
  display: inline-block;
  width: 10px;
  height: 10px;
  margin: 1px;
  text-indent: -999px;
  border: 1px solid #fff;
  border-radius: 10px;
  cursor: pointer;
  background-color: #000 \9;
  background-color: rgba(0, 0, 0, 0);
}
.carousel-indicators .active {
  margin: 0;
  width: 12px;
  height: 12px;
  background-color: #fff;
}
.carousel-caption {
  position: absolute;
  left: 15%;
  right: 15%;
  bottom: 20px;
  z-index: 10;
  padding-top: 20px;
  padding-bottom: 20px;
  color: #fff;
  text-align: center;
  text-shadow: 0 1px 2px rgba(0, 0, 0, 0.6);
}
.carousel-caption .btn {
  text-shadow: none;
}
@media screen and (min-width: 768px) {
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-prev,
  .carousel-control .icon-next {
    width: 30px;
    height: 30px;
    margin-top: -10px;
    font-size: 30px;
  }
  .carousel-control .glyphicon-chevron-left,
  .carousel-control .icon-prev {
    margin-left: -10px;
  }
  .carousel-control .glyphicon-chevron-right,
  .carousel-control .icon-next {
    margin-right: -10px;
  }
  .carousel-caption {
    left: 20%;
    right: 20%;
    padding-bottom: 30px;
  }
  .carousel-indicators {
    bottom: 20px;
  }
}
.clearfix:before,
.clearfix:after,
.dl-horizontal dd:before,
.dl-horizontal dd:after,
.container:before,
.container:after,
.container-fluid:before,
.container-fluid:after,
.row:before,
.row:after,
.form-horizontal .form-group:before,
.form-horizontal .form-group:after,
.btn-toolbar:before,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:before,
.btn-group-vertical > .btn-group:after,
.nav:before,
.nav:after,
.navbar:before,
.navbar:after,
.navbar-header:before,
.navbar-header:after,
.navbar-collapse:before,
.navbar-collapse:after,
.pager:before,
.pager:after,
.panel-body:before,
.panel-body:after,
.modal-header:before,
.modal-header:after,
.modal-footer:before,
.modal-footer:after,
.item_buttons:before,
.item_buttons:after {
  content: " ";
  display: table;
}
.clearfix:after,
.dl-horizontal dd:after,
.container:after,
.container-fluid:after,
.row:after,
.form-horizontal .form-group:after,
.btn-toolbar:after,
.btn-group-vertical > .btn-group:after,
.nav:after,
.navbar:after,
.navbar-header:after,
.navbar-collapse:after,
.pager:after,
.panel-body:after,
.modal-header:after,
.modal-footer:after,
.item_buttons:after {
  clear: both;
}
.center-block {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.pull-right {
  float: right !important;
}
.pull-left {
  float: left !important;
}
.hide {
  display: none !important;
}
.show {
  display: block !important;
}
.invisible {
  visibility: hidden;
}
.text-hide {
  font: 0/0 a;
  color: transparent;
  text-shadow: none;
  background-color: transparent;
  border: 0;
}
.hidden {
  display: none !important;
}
.affix {
  position: fixed;
}
@-ms-viewport {
  width: device-width;
}
.visible-xs,
.visible-sm,
.visible-md,
.visible-lg {
  display: none !important;
}
.visible-xs-block,
.visible-xs-inline,
.visible-xs-inline-block,
.visible-sm-block,
.visible-sm-inline,
.visible-sm-inline-block,
.visible-md-block,
.visible-md-inline,
.visible-md-inline-block,
.visible-lg-block,
.visible-lg-inline,
.visible-lg-inline-block {
  display: none !important;
}
@media (max-width: 767px) {
  .visible-xs {
    display: block !important;
  }
  table.visible-xs {
    display: table !important;
  }
  tr.visible-xs {
    display: table-row !important;
  }
  th.visible-xs,
  td.visible-xs {
    display: table-cell !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-block {
    display: block !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline {
    display: inline !important;
  }
}
@media (max-width: 767px) {
  .visible-xs-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm {
    display: block !important;
  }
  table.visible-sm {
    display: table !important;
  }
  tr.visible-sm {
    display: table-row !important;
  }
  th.visible-sm,
  td.visible-sm {
    display: table-cell !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-block {
    display: block !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline {
    display: inline !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .visible-sm-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md {
    display: block !important;
  }
  table.visible-md {
    display: table !important;
  }
  tr.visible-md {
    display: table-row !important;
  }
  th.visible-md,
  td.visible-md {
    display: table-cell !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-block {
    display: block !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline {
    display: inline !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .visible-md-inline-block {
    display: inline-block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg {
    display: block !important;
  }
  table.visible-lg {
    display: table !important;
  }
  tr.visible-lg {
    display: table-row !important;
  }
  th.visible-lg,
  td.visible-lg {
    display: table-cell !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-block {
    display: block !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline {
    display: inline !important;
  }
}
@media (min-width: 1200px) {
  .visible-lg-inline-block {
    display: inline-block !important;
  }
}
@media (max-width: 767px) {
  .hidden-xs {
    display: none !important;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  .hidden-sm {
    display: none !important;
  }
}
@media (min-width: 992px) and (max-width: 1199px) {
  .hidden-md {
    display: none !important;
  }
}
@media (min-width: 1200px) {
  .hidden-lg {
    display: none !important;
  }
}
.visible-print {
  display: none !important;
}
@media print {
  .visible-print {
    display: block !important;
  }
  table.visible-print {
    display: table !important;
  }
  tr.visible-print {
    display: table-row !important;
  }
  th.visible-print,
  td.visible-print {
    display: table-cell !important;
  }
}
.visible-print-block {
  display: none !important;
}
@media print {
  .visible-print-block {
    display: block !important;
  }
}
.visible-print-inline {
  display: none !important;
}
@media print {
  .visible-print-inline {
    display: inline !important;
  }
}
.visible-print-inline-block {
  display: none !important;
}
@media print {
  .visible-print-inline-block {
    display: inline-block !important;
  }
}
@media print {
  .hidden-print {
    display: none !important;
  }
}
/*!
*
* Font Awesome
*
*/
/*!
 *  Font Awesome 4.7.0 by @davegandy - http://fontawesome.io - @fontawesome
 *  License - http://fontawesome.io/license (Font: SIL OFL 1.1, CSS: MIT License)
 */
/* FONT PATH
 * -------------------------- */
@font-face {
  font-family: 'FontAwesome';
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?v=4.7.0');
  src: url('../components/font-awesome/fonts/fontawesome-webfont.eot?#iefix&v=4.7.0') format('embedded-opentype'), url('../components/font-awesome/fonts/fontawesome-webfont.woff2?v=4.7.0') format('woff2'), url('../components/font-awesome/fonts/fontawesome-webfont.woff?v=4.7.0') format('woff'), url('../components/font-awesome/fonts/fontawesome-webfont.ttf?v=4.7.0') format('truetype'), url('../components/font-awesome/fonts/fontawesome-webfont.svg?v=4.7.0#fontawesomeregular') format('svg');
  font-weight: normal;
  font-style: normal;
}
.fa {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
}
/* makes the font 33% larger relative to the icon container */
.fa-lg {
  font-size: 1.33333333em;
  line-height: 0.75em;
  vertical-align: -15%;
}
.fa-2x {
  font-size: 2em;
}
.fa-3x {
  font-size: 3em;
}
.fa-4x {
  font-size: 4em;
}
.fa-5x {
  font-size: 5em;
}
.fa-fw {
  width: 1.28571429em;
  text-align: center;
}
.fa-ul {
  padding-left: 0;
  margin-left: 2.14285714em;
  list-style-type: none;
}
.fa-ul > li {
  position: relative;
}
.fa-li {
  position: absolute;
  left: -2.14285714em;
  width: 2.14285714em;
  top: 0.14285714em;
  text-align: center;
}
.fa-li.fa-lg {
  left: -1.85714286em;
}
.fa-border {
  padding: .2em .25em .15em;
  border: solid 0.08em #eee;
  border-radius: .1em;
}
.fa-pull-left {
  float: left;
}
.fa-pull-right {
  float: right;
}
.fa.fa-pull-left {
  margin-right: .3em;
}
.fa.fa-pull-right {
  margin-left: .3em;
}
/* Deprecated as of 4.4.0 */
.pull-right {
  float: right;
}
.pull-left {
  float: left;
}
.fa.pull-left {
  margin-right: .3em;
}
.fa.pull-right {
  margin-left: .3em;
}
.fa-spin {
  -webkit-animation: fa-spin 2s infinite linear;
  animation: fa-spin 2s infinite linear;
}
.fa-pulse {
  -webkit-animation: fa-spin 1s infinite steps(8);
  animation: fa-spin 1s infinite steps(8);
}
@-webkit-keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
@keyframes fa-spin {
  0% {
    -webkit-transform: rotate(0deg);
    transform: rotate(0deg);
  }
  100% {
    -webkit-transform: rotate(359deg);
    transform: rotate(359deg);
  }
}
.fa-rotate-90 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=1)";
  -webkit-transform: rotate(90deg);
  -ms-transform: rotate(90deg);
  transform: rotate(90deg);
}
.fa-rotate-180 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=2)";
  -webkit-transform: rotate(180deg);
  -ms-transform: rotate(180deg);
  transform: rotate(180deg);
}
.fa-rotate-270 {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=3)";
  -webkit-transform: rotate(270deg);
  -ms-transform: rotate(270deg);
  transform: rotate(270deg);
}
.fa-flip-horizontal {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=0, mirror=1)";
  -webkit-transform: scale(-1, 1);
  -ms-transform: scale(-1, 1);
  transform: scale(-1, 1);
}
.fa-flip-vertical {
  -ms-filter: "progid:DXImageTransform.Microsoft.BasicImage(rotation=2, mirror=1)";
  -webkit-transform: scale(1, -1);
  -ms-transform: scale(1, -1);
  transform: scale(1, -1);
}
:root .fa-rotate-90,
:root .fa-rotate-180,
:root .fa-rotate-270,
:root .fa-flip-horizontal,
:root .fa-flip-vertical {
  filter: none;
}
.fa-stack {
  position: relative;
  display: inline-block;
  width: 2em;
  height: 2em;
  line-height: 2em;
  vertical-align: middle;
}
.fa-stack-1x,
.fa-stack-2x {
  position: absolute;
  left: 0;
  width: 100%;
  text-align: center;
}
.fa-stack-1x {
  line-height: inherit;
}
.fa-stack-2x {
  font-size: 2em;
}
.fa-inverse {
  color: #fff;
}
/* Font Awesome uses the Unicode Private Use Area (PUA) to ensure screen
   readers do not read off random characters that represent icons */
.fa-glass:before {
  content: "\f000";
}
.fa-music:before {
  content: "\f001";
}
.fa-search:before {
  content: "\f002";
}
.fa-envelope-o:before {
  content: "\f003";
}
.fa-heart:before {
  content: "\f004";
}
.fa-star:before {
  content: "\f005";
}
.fa-star-o:before {
  content: "\f006";
}
.fa-user:before {
  content: "\f007";
}
.fa-film:before {
  content: "\f008";
}
.fa-th-large:before {
  content: "\f009";
}
.fa-th:before {
  content: "\f00a";
}
.fa-th-list:before {
  content: "\f00b";
}
.fa-check:before {
  content: "\f00c";
}
.fa-remove:before,
.fa-close:before,
.fa-times:before {
  content: "\f00d";
}
.fa-search-plus:before {
  content: "\f00e";
}
.fa-search-minus:before {
  content: "\f010";
}
.fa-power-off:before {
  content: "\f011";
}
.fa-signal:before {
  content: "\f012";
}
.fa-gear:before,
.fa-cog:before {
  content: "\f013";
}
.fa-trash-o:before {
  content: "\f014";
}
.fa-home:before {
  content: "\f015";
}
.fa-file-o:before {
  content: "\f016";
}
.fa-clock-o:before {
  content: "\f017";
}
.fa-road:before {
  content: "\f018";
}
.fa-download:before {
  content: "\f019";
}
.fa-arrow-circle-o-down:before {
  content: "\f01a";
}
.fa-arrow-circle-o-up:before {
  content: "\f01b";
}
.fa-inbox:before {
  content: "\f01c";
}
.fa-play-circle-o:before {
  content: "\f01d";
}
.fa-rotate-right:before,
.fa-repeat:before {
  content: "\f01e";
}
.fa-refresh:before {
  content: "\f021";
}
.fa-list-alt:before {
  content: "\f022";
}
.fa-lock:before {
  content: "\f023";
}
.fa-flag:before {
  content: "\f024";
}
.fa-headphones:before {
  content: "\f025";
}
.fa-volume-off:before {
  content: "\f026";
}
.fa-volume-down:before {
  content: "\f027";
}
.fa-volume-up:before {
  content: "\f028";
}
.fa-qrcode:before {
  content: "\f029";
}
.fa-barcode:before {
  content: "\f02a";
}
.fa-tag:before {
  content: "\f02b";
}
.fa-tags:before {
  content: "\f02c";
}
.fa-book:before {
  content: "\f02d";
}
.fa-bookmark:before {
  content: "\f02e";
}
.fa-print:before {
  content: "\f02f";
}
.fa-camera:before {
  content: "\f030";
}
.fa-font:before {
  content: "\f031";
}
.fa-bold:before {
  content: "\f032";
}
.fa-italic:before {
  content: "\f033";
}
.fa-text-height:before {
  content: "\f034";
}
.fa-text-width:before {
  content: "\f035";
}
.fa-align-left:before {
  content: "\f036";
}
.fa-align-center:before {
  content: "\f037";
}
.fa-align-right:before {
  content: "\f038";
}
.fa-align-justify:before {
  content: "\f039";
}
.fa-list:before {
  content: "\f03a";
}
.fa-dedent:before,
.fa-outdent:before {
  content: "\f03b";
}
.fa-indent:before {
  content: "\f03c";
}
.fa-video-camera:before {
  content: "\f03d";
}
.fa-photo:before,
.fa-image:before,
.fa-picture-o:before {
  content: "\f03e";
}
.fa-pencil:before {
  content: "\f040";
}
.fa-map-marker:before {
  content: "\f041";
}
.fa-adjust:before {
  content: "\f042";
}
.fa-tint:before {
  content: "\f043";
}
.fa-edit:before,
.fa-pencil-square-o:before {
  content: "\f044";
}
.fa-share-square-o:before {
  content: "\f045";
}
.fa-check-square-o:before {
  content: "\f046";
}
.fa-arrows:before {
  content: "\f047";
}
.fa-step-backward:before {
  content: "\f048";
}
.fa-fast-backward:before {
  content: "\f049";
}
.fa-backward:before {
  content: "\f04a";
}
.fa-play:before {
  content: "\f04b";
}
.fa-pause:before {
  content: "\f04c";
}
.fa-stop:before {
  content: "\f04d";
}
.fa-forward:before {
  content: "\f04e";
}
.fa-fast-forward:before {
  content: "\f050";
}
.fa-step-forward:before {
  content: "\f051";
}
.fa-eject:before {
  content: "\f052";
}
.fa-chevron-left:before {
  content: "\f053";
}
.fa-chevron-right:before {
  content: "\f054";
}
.fa-plus-circle:before {
  content: "\f055";
}
.fa-minus-circle:before {
  content: "\f056";
}
.fa-times-circle:before {
  content: "\f057";
}
.fa-check-circle:before {
  content: "\f058";
}
.fa-question-circle:before {
  content: "\f059";
}
.fa-info-circle:before {
  content: "\f05a";
}
.fa-crosshairs:before {
  content: "\f05b";
}
.fa-times-circle-o:before {
  content: "\f05c";
}
.fa-check-circle-o:before {
  content: "\f05d";
}
.fa-ban:before {
  content: "\f05e";
}
.fa-arrow-left:before {
  content: "\f060";
}
.fa-arrow-right:before {
  content: "\f061";
}
.fa-arrow-up:before {
  content: "\f062";
}
.fa-arrow-down:before {
  content: "\f063";
}
.fa-mail-forward:before,
.fa-share:before {
  content: "\f064";
}
.fa-expand:before {
  content: "\f065";
}
.fa-compress:before {
  content: "\f066";
}
.fa-plus:before {
  content: "\f067";
}
.fa-minus:before {
  content: "\f068";
}
.fa-asterisk:before {
  content: "\f069";
}
.fa-exclamation-circle:before {
  content: "\f06a";
}
.fa-gift:before {
  content: "\f06b";
}
.fa-leaf:before {
  content: "\f06c";
}
.fa-fire:before {
  content: "\f06d";
}
.fa-eye:before {
  content: "\f06e";
}
.fa-eye-slash:before {
  content: "\f070";
}
.fa-warning:before,
.fa-exclamation-triangle:before {
  content: "\f071";
}
.fa-plane:before {
  content: "\f072";
}
.fa-calendar:before {
  content: "\f073";
}
.fa-random:before {
  content: "\f074";
}
.fa-comment:before {
  content: "\f075";
}
.fa-magnet:before {
  content: "\f076";
}
.fa-chevron-up:before {
  content: "\f077";
}
.fa-chevron-down:before {
  content: "\f078";
}
.fa-retweet:before {
  content: "\f079";
}
.fa-shopping-cart:before {
  content: "\f07a";
}
.fa-folder:before {
  content: "\f07b";
}
.fa-folder-open:before {
  content: "\f07c";
}
.fa-arrows-v:before {
  content: "\f07d";
}
.fa-arrows-h:before {
  content: "\f07e";
}
.fa-bar-chart-o:before,
.fa-bar-chart:before {
  content: "\f080";
}
.fa-twitter-square:before {
  content: "\f081";
}
.fa-facebook-square:before {
  content: "\f082";
}
.fa-camera-retro:before {
  content: "\f083";
}
.fa-key:before {
  content: "\f084";
}
.fa-gears:before,
.fa-cogs:before {
  content: "\f085";
}
.fa-comments:before {
  content: "\f086";
}
.fa-thumbs-o-up:before {
  content: "\f087";
}
.fa-thumbs-o-down:before {
  content: "\f088";
}
.fa-star-half:before {
  content: "\f089";
}
.fa-heart-o:before {
  content: "\f08a";
}
.fa-sign-out:before {
  content: "\f08b";
}
.fa-linkedin-square:before {
  content: "\f08c";
}
.fa-thumb-tack:before {
  content: "\f08d";
}
.fa-external-link:before {
  content: "\f08e";
}
.fa-sign-in:before {
  content: "\f090";
}
.fa-trophy:before {
  content: "\f091";
}
.fa-github-square:before {
  content: "\f092";
}
.fa-upload:before {
  content: "\f093";
}
.fa-lemon-o:before {
  content: "\f094";
}
.fa-phone:before {
  content: "\f095";
}
.fa-square-o:before {
  content: "\f096";
}
.fa-bookmark-o:before {
  content: "\f097";
}
.fa-phone-square:before {
  content: "\f098";
}
.fa-twitter:before {
  content: "\f099";
}
.fa-facebook-f:before,
.fa-facebook:before {
  content: "\f09a";
}
.fa-github:before {
  content: "\f09b";
}
.fa-unlock:before {
  content: "\f09c";
}
.fa-credit-card:before {
  content: "\f09d";
}
.fa-feed:before,
.fa-rss:before {
  content: "\f09e";
}
.fa-hdd-o:before {
  content: "\f0a0";
}
.fa-bullhorn:before {
  content: "\f0a1";
}
.fa-bell:before {
  content: "\f0f3";
}
.fa-certificate:before {
  content: "\f0a3";
}
.fa-hand-o-right:before {
  content: "\f0a4";
}
.fa-hand-o-left:before {
  content: "\f0a5";
}
.fa-hand-o-up:before {
  content: "\f0a6";
}
.fa-hand-o-down:before {
  content: "\f0a7";
}
.fa-arrow-circle-left:before {
  content: "\f0a8";
}
.fa-arrow-circle-right:before {
  content: "\f0a9";
}
.fa-arrow-circle-up:before {
  content: "\f0aa";
}
.fa-arrow-circle-down:before {
  content: "\f0ab";
}
.fa-globe:before {
  content: "\f0ac";
}
.fa-wrench:before {
  content: "\f0ad";
}
.fa-tasks:before {
  content: "\f0ae";
}
.fa-filter:before {
  content: "\f0b0";
}
.fa-briefcase:before {
  content: "\f0b1";
}
.fa-arrows-alt:before {
  content: "\f0b2";
}
.fa-group:before,
.fa-users:before {
  content: "\f0c0";
}
.fa-chain:before,
.fa-link:before {
  content: "\f0c1";
}
.fa-cloud:before {
  content: "\f0c2";
}
.fa-flask:before {
  content: "\f0c3";
}
.fa-cut:before,
.fa-scissors:before {
  content: "\f0c4";
}
.fa-copy:before,
.fa-files-o:before {
  content: "\f0c5";
}
.fa-paperclip:before {
  content: "\f0c6";
}
.fa-save:before,
.fa-floppy-o:before {
  content: "\f0c7";
}
.fa-square:before {
  content: "\f0c8";
}
.fa-navicon:before,
.fa-reorder:before,
.fa-bars:before {
  content: "\f0c9";
}
.fa-list-ul:before {
  content: "\f0ca";
}
.fa-list-ol:before {
  content: "\f0cb";
}
.fa-strikethrough:before {
  content: "\f0cc";
}
.fa-underline:before {
  content: "\f0cd";
}
.fa-table:before {
  content: "\f0ce";
}
.fa-magic:before {
  content: "\f0d0";
}
.fa-truck:before {
  content: "\f0d1";
}
.fa-pinterest:before {
  content: "\f0d2";
}
.fa-pinterest-square:before {
  content: "\f0d3";
}
.fa-google-plus-square:before {
  content: "\f0d4";
}
.fa-google-plus:before {
  content: "\f0d5";
}
.fa-money:before {
  content: "\f0d6";
}
.fa-caret-down:before {
  content: "\f0d7";
}
.fa-caret-up:before {
  content: "\f0d8";
}
.fa-caret-left:before {
  content: "\f0d9";
}
.fa-caret-right:before {
  content: "\f0da";
}
.fa-columns:before {
  content: "\f0db";
}
.fa-unsorted:before,
.fa-sort:before {
  content: "\f0dc";
}
.fa-sort-down:before,
.fa-sort-desc:before {
  content: "\f0dd";
}
.fa-sort-up:before,
.fa-sort-asc:before {
  content: "\f0de";
}
.fa-envelope:before {
  content: "\f0e0";
}
.fa-linkedin:before {
  content: "\f0e1";
}
.fa-rotate-left:before,
.fa-undo:before {
  content: "\f0e2";
}
.fa-legal:before,
.fa-gavel:before {
  content: "\f0e3";
}
.fa-dashboard:before,
.fa-tachometer:before {
  content: "\f0e4";
}
.fa-comment-o:before {
  content: "\f0e5";
}
.fa-comments-o:before {
  content: "\f0e6";
}
.fa-flash:before,
.fa-bolt:before {
  content: "\f0e7";
}
.fa-sitemap:before {
  content: "\f0e8";
}
.fa-umbrella:before {
  content: "\f0e9";
}
.fa-paste:before,
.fa-clipboard:before {
  content: "\f0ea";
}
.fa-lightbulb-o:before {
  content: "\f0eb";
}
.fa-exchange:before {
  content: "\f0ec";
}
.fa-cloud-download:before {
  content: "\f0ed";
}
.fa-cloud-upload:before {
  content: "\f0ee";
}
.fa-user-md:before {
  content: "\f0f0";
}
.fa-stethoscope:before {
  content: "\f0f1";
}
.fa-suitcase:before {
  content: "\f0f2";
}
.fa-bell-o:before {
  content: "\f0a2";
}
.fa-coffee:before {
  content: "\f0f4";
}
.fa-cutlery:before {
  content: "\f0f5";
}
.fa-file-text-o:before {
  content: "\f0f6";
}
.fa-building-o:before {
  content: "\f0f7";
}
.fa-hospital-o:before {
  content: "\f0f8";
}
.fa-ambulance:before {
  content: "\f0f9";
}
.fa-medkit:before {
  content: "\f0fa";
}
.fa-fighter-jet:before {
  content: "\f0fb";
}
.fa-beer:before {
  content: "\f0fc";
}
.fa-h-square:before {
  content: "\f0fd";
}
.fa-plus-square:before {
  content: "\f0fe";
}
.fa-angle-double-left:before {
  content: "\f100";
}
.fa-angle-double-right:before {
  content: "\f101";
}
.fa-angle-double-up:before {
  content: "\f102";
}
.fa-angle-double-down:before {
  content: "\f103";
}
.fa-angle-left:before {
  content: "\f104";
}
.fa-angle-right:before {
  content: "\f105";
}
.fa-angle-up:before {
  content: "\f106";
}
.fa-angle-down:before {
  content: "\f107";
}
.fa-desktop:before {
  content: "\f108";
}
.fa-laptop:before {
  content: "\f109";
}
.fa-tablet:before {
  content: "\f10a";
}
.fa-mobile-phone:before,
.fa-mobile:before {
  content: "\f10b";
}
.fa-circle-o:before {
  content: "\f10c";
}
.fa-quote-left:before {
  content: "\f10d";
}
.fa-quote-right:before {
  content: "\f10e";
}
.fa-spinner:before {
  content: "\f110";
}
.fa-circle:before {
  content: "\f111";
}
.fa-mail-reply:before,
.fa-reply:before {
  content: "\f112";
}
.fa-github-alt:before {
  content: "\f113";
}
.fa-folder-o:before {
  content: "\f114";
}
.fa-folder-open-o:before {
  content: "\f115";
}
.fa-smile-o:before {
  content: "\f118";
}
.fa-frown-o:before {
  content: "\f119";
}
.fa-meh-o:before {
  content: "\f11a";
}
.fa-gamepad:before {
  content: "\f11b";
}
.fa-keyboard-o:before {
  content: "\f11c";
}
.fa-flag-o:before {
  content: "\f11d";
}
.fa-flag-checkered:before {
  content: "\f11e";
}
.fa-terminal:before {
  content: "\f120";
}
.fa-code:before {
  content: "\f121";
}
.fa-mail-reply-all:before,
.fa-reply-all:before {
  content: "\f122";
}
.fa-star-half-empty:before,
.fa-star-half-full:before,
.fa-star-half-o:before {
  content: "\f123";
}
.fa-location-arrow:before {
  content: "\f124";
}
.fa-crop:before {
  content: "\f125";
}
.fa-code-fork:before {
  content: "\f126";
}
.fa-unlink:before,
.fa-chain-broken:before {
  content: "\f127";
}
.fa-question:before {
  content: "\f128";
}
.fa-info:before {
  content: "\f129";
}
.fa-exclamation:before {
  content: "\f12a";
}
.fa-superscript:before {
  content: "\f12b";
}
.fa-subscript:before {
  content: "\f12c";
}
.fa-eraser:before {
  content: "\f12d";
}
.fa-puzzle-piece:before {
  content: "\f12e";
}
.fa-microphone:before {
  content: "\f130";
}
.fa-microphone-slash:before {
  content: "\f131";
}
.fa-shield:before {
  content: "\f132";
}
.fa-calendar-o:before {
  content: "\f133";
}
.fa-fire-extinguisher:before {
  content: "\f134";
}
.fa-rocket:before {
  content: "\f135";
}
.fa-maxcdn:before {
  content: "\f136";
}
.fa-chevron-circle-left:before {
  content: "\f137";
}
.fa-chevron-circle-right:before {
  content: "\f138";
}
.fa-chevron-circle-up:before {
  content: "\f139";
}
.fa-chevron-circle-down:before {
  content: "\f13a";
}
.fa-html5:before {
  content: "\f13b";
}
.fa-css3:before {
  content: "\f13c";
}
.fa-anchor:before {
  content: "\f13d";
}
.fa-unlock-alt:before {
  content: "\f13e";
}
.fa-bullseye:before {
  content: "\f140";
}
.fa-ellipsis-h:before {
  content: "\f141";
}
.fa-ellipsis-v:before {
  content: "\f142";
}
.fa-rss-square:before {
  content: "\f143";
}
.fa-play-circle:before {
  content: "\f144";
}
.fa-ticket:before {
  content: "\f145";
}
.fa-minus-square:before {
  content: "\f146";
}
.fa-minus-square-o:before {
  content: "\f147";
}
.fa-level-up:before {
  content: "\f148";
}
.fa-level-down:before {
  content: "\f149";
}
.fa-check-square:before {
  content: "\f14a";
}
.fa-pencil-square:before {
  content: "\f14b";
}
.fa-external-link-square:before {
  content: "\f14c";
}
.fa-share-square:before {
  content: "\f14d";
}
.fa-compass:before {
  content: "\f14e";
}
.fa-toggle-down:before,
.fa-caret-square-o-down:before {
  content: "\f150";
}
.fa-toggle-up:before,
.fa-caret-square-o-up:before {
  content: "\f151";
}
.fa-toggle-right:before,
.fa-caret-square-o-right:before {
  content: "\f152";
}
.fa-euro:before,
.fa-eur:before {
  content: "\f153";
}
.fa-gbp:before {
  content: "\f154";
}
.fa-dollar:before,
.fa-usd:before {
  content: "\f155";
}
.fa-rupee:before,
.fa-inr:before {
  content: "\f156";
}
.fa-cny:before,
.fa-rmb:before,
.fa-yen:before,
.fa-jpy:before {
  content: "\f157";
}
.fa-ruble:before,
.fa-rouble:before,
.fa-rub:before {
  content: "\f158";
}
.fa-won:before,
.fa-krw:before {
  content: "\f159";
}
.fa-bitcoin:before,
.fa-btc:before {
  content: "\f15a";
}
.fa-file:before {
  content: "\f15b";
}
.fa-file-text:before {
  content: "\f15c";
}
.fa-sort-alpha-asc:before {
  content: "\f15d";
}
.fa-sort-alpha-desc:before {
  content: "\f15e";
}
.fa-sort-amount-asc:before {
  content: "\f160";
}
.fa-sort-amount-desc:before {
  content: "\f161";
}
.fa-sort-numeric-asc:before {
  content: "\f162";
}
.fa-sort-numeric-desc:before {
  content: "\f163";
}
.fa-thumbs-up:before {
  content: "\f164";
}
.fa-thumbs-down:before {
  content: "\f165";
}
.fa-youtube-square:before {
  content: "\f166";
}
.fa-youtube:before {
  content: "\f167";
}
.fa-xing:before {
  content: "\f168";
}
.fa-xing-square:before {
  content: "\f169";
}
.fa-youtube-play:before {
  content: "\f16a";
}
.fa-dropbox:before {
  content: "\f16b";
}
.fa-stack-overflow:before {
  content: "\f16c";
}
.fa-instagram:before {
  content: "\f16d";
}
.fa-flickr:before {
  content: "\f16e";
}
.fa-adn:before {
  content: "\f170";
}
.fa-bitbucket:before {
  content: "\f171";
}
.fa-bitbucket-square:before {
  content: "\f172";
}
.fa-tumblr:before {
  content: "\f173";
}
.fa-tumblr-square:before {
  content: "\f174";
}
.fa-long-arrow-down:before {
  content: "\f175";
}
.fa-long-arrow-up:before {
  content: "\f176";
}
.fa-long-arrow-left:before {
  content: "\f177";
}
.fa-long-arrow-right:before {
  content: "\f178";
}
.fa-apple:before {
  content: "\f179";
}
.fa-windows:before {
  content: "\f17a";
}
.fa-android:before {
  content: "\f17b";
}
.fa-linux:before {
  content: "\f17c";
}
.fa-dribbble:before {
  content: "\f17d";
}
.fa-skype:before {
  content: "\f17e";
}
.fa-foursquare:before {
  content: "\f180";
}
.fa-trello:before {
  content: "\f181";
}
.fa-female:before {
  content: "\f182";
}
.fa-male:before {
  content: "\f183";
}
.fa-gittip:before,
.fa-gratipay:before {
  content: "\f184";
}
.fa-sun-o:before {
  content: "\f185";
}
.fa-moon-o:before {
  content: "\f186";
}
.fa-archive:before {
  content: "\f187";
}
.fa-bug:before {
  content: "\f188";
}
.fa-vk:before {
  content: "\f189";
}
.fa-weibo:before {
  content: "\f18a";
}
.fa-renren:before {
  content: "\f18b";
}
.fa-pagelines:before {
  content: "\f18c";
}
.fa-stack-exchange:before {
  content: "\f18d";
}
.fa-arrow-circle-o-right:before {
  content: "\f18e";
}
.fa-arrow-circle-o-left:before {
  content: "\f190";
}
.fa-toggle-left:before,
.fa-caret-square-o-left:before {
  content: "\f191";
}
.fa-dot-circle-o:before {
  content: "\f192";
}
.fa-wheelchair:before {
  content: "\f193";
}
.fa-vimeo-square:before {
  content: "\f194";
}
.fa-turkish-lira:before,
.fa-try:before {
  content: "\f195";
}
.fa-plus-square-o:before {
  content: "\f196";
}
.fa-space-shuttle:before {
  content: "\f197";
}
.fa-slack:before {
  content: "\f198";
}
.fa-envelope-square:before {
  content: "\f199";
}
.fa-wordpress:before {
  content: "\f19a";
}
.fa-openid:before {
  content: "\f19b";
}
.fa-institution:before,
.fa-bank:before,
.fa-university:before {
  content: "\f19c";
}
.fa-mortar-board:before,
.fa-graduation-cap:before {
  content: "\f19d";
}
.fa-yahoo:before {
  content: "\f19e";
}
.fa-google:before {
  content: "\f1a0";
}
.fa-reddit:before {
  content: "\f1a1";
}
.fa-reddit-square:before {
  content: "\f1a2";
}
.fa-stumbleupon-circle:before {
  content: "\f1a3";
}
.fa-stumbleupon:before {
  content: "\f1a4";
}
.fa-delicious:before {
  content: "\f1a5";
}
.fa-digg:before {
  content: "\f1a6";
}
.fa-pied-piper-pp:before {
  content: "\f1a7";
}
.fa-pied-piper-alt:before {
  content: "\f1a8";
}
.fa-drupal:before {
  content: "\f1a9";
}
.fa-joomla:before {
  content: "\f1aa";
}
.fa-language:before {
  content: "\f1ab";
}
.fa-fax:before {
  content: "\f1ac";
}
.fa-building:before {
  content: "\f1ad";
}
.fa-child:before {
  content: "\f1ae";
}
.fa-paw:before {
  content: "\f1b0";
}
.fa-spoon:before {
  content: "\f1b1";
}
.fa-cube:before {
  content: "\f1b2";
}
.fa-cubes:before {
  content: "\f1b3";
}
.fa-behance:before {
  content: "\f1b4";
}
.fa-behance-square:before {
  content: "\f1b5";
}
.fa-steam:before {
  content: "\f1b6";
}
.fa-steam-square:before {
  content: "\f1b7";
}
.fa-recycle:before {
  content: "\f1b8";
}
.fa-automobile:before,
.fa-car:before {
  content: "\f1b9";
}
.fa-cab:before,
.fa-taxi:before {
  content: "\f1ba";
}
.fa-tree:before {
  content: "\f1bb";
}
.fa-spotify:before {
  content: "\f1bc";
}
.fa-deviantart:before {
  content: "\f1bd";
}
.fa-soundcloud:before {
  content: "\f1be";
}
.fa-database:before {
  content: "\f1c0";
}
.fa-file-pdf-o:before {
  content: "\f1c1";
}
.fa-file-word-o:before {
  content: "\f1c2";
}
.fa-file-excel-o:before {
  content: "\f1c3";
}
.fa-file-powerpoint-o:before {
  content: "\f1c4";
}
.fa-file-photo-o:before,
.fa-file-picture-o:before,
.fa-file-image-o:before {
  content: "\f1c5";
}
.fa-file-zip-o:before,
.fa-file-archive-o:before {
  content: "\f1c6";
}
.fa-file-sound-o:before,
.fa-file-audio-o:before {
  content: "\f1c7";
}
.fa-file-movie-o:before,
.fa-file-video-o:before {
  content: "\f1c8";
}
.fa-file-code-o:before {
  content: "\f1c9";
}
.fa-vine:before {
  content: "\f1ca";
}
.fa-codepen:before {
  content: "\f1cb";
}
.fa-jsfiddle:before {
  content: "\f1cc";
}
.fa-life-bouy:before,
.fa-life-buoy:before,
.fa-life-saver:before,
.fa-support:before,
.fa-life-ring:before {
  content: "\f1cd";
}
.fa-circle-o-notch:before {
  content: "\f1ce";
}
.fa-ra:before,
.fa-resistance:before,
.fa-rebel:before {
  content: "\f1d0";
}
.fa-ge:before,
.fa-empire:before {
  content: "\f1d1";
}
.fa-git-square:before {
  content: "\f1d2";
}
.fa-git:before {
  content: "\f1d3";
}
.fa-y-combinator-square:before,
.fa-yc-square:before,
.fa-hacker-news:before {
  content: "\f1d4";
}
.fa-tencent-weibo:before {
  content: "\f1d5";
}
.fa-qq:before {
  content: "\f1d6";
}
.fa-wechat:before,
.fa-weixin:before {
  content: "\f1d7";
}
.fa-send:before,
.fa-paper-plane:before {
  content: "\f1d8";
}
.fa-send-o:before,
.fa-paper-plane-o:before {
  content: "\f1d9";
}
.fa-history:before {
  content: "\f1da";
}
.fa-circle-thin:before {
  content: "\f1db";
}
.fa-header:before {
  content: "\f1dc";
}
.fa-paragraph:before {
  content: "\f1dd";
}
.fa-sliders:before {
  content: "\f1de";
}
.fa-share-alt:before {
  content: "\f1e0";
}
.fa-share-alt-square:before {
  content: "\f1e1";
}
.fa-bomb:before {
  content: "\f1e2";
}
.fa-soccer-ball-o:before,
.fa-futbol-o:before {
  content: "\f1e3";
}
.fa-tty:before {
  content: "\f1e4";
}
.fa-binoculars:before {
  content: "\f1e5";
}
.fa-plug:before {
  content: "\f1e6";
}
.fa-slideshare:before {
  content: "\f1e7";
}
.fa-twitch:before {
  content: "\f1e8";
}
.fa-yelp:before {
  content: "\f1e9";
}
.fa-newspaper-o:before {
  content: "\f1ea";
}
.fa-wifi:before {
  content: "\f1eb";
}
.fa-calculator:before {
  content: "\f1ec";
}
.fa-paypal:before {
  content: "\f1ed";
}
.fa-google-wallet:before {
  content: "\f1ee";
}
.fa-cc-visa:before {
  content: "\f1f0";
}
.fa-cc-mastercard:before {
  content: "\f1f1";
}
.fa-cc-discover:before {
  content: "\f1f2";
}
.fa-cc-amex:before {
  content: "\f1f3";
}
.fa-cc-paypal:before {
  content: "\f1f4";
}
.fa-cc-stripe:before {
  content: "\f1f5";
}
.fa-bell-slash:before {
  content: "\f1f6";
}
.fa-bell-slash-o:before {
  content: "\f1f7";
}
.fa-trash:before {
  content: "\f1f8";
}
.fa-copyright:before {
  content: "\f1f9";
}
.fa-at:before {
  content: "\f1fa";
}
.fa-eyedropper:before {
  content: "\f1fb";
}
.fa-paint-brush:before {
  content: "\f1fc";
}
.fa-birthday-cake:before {
  content: "\f1fd";
}
.fa-area-chart:before {
  content: "\f1fe";
}
.fa-pie-chart:before {
  content: "\f200";
}
.fa-line-chart:before {
  content: "\f201";
}
.fa-lastfm:before {
  content: "\f202";
}
.fa-lastfm-square:before {
  content: "\f203";
}
.fa-toggle-off:before {
  content: "\f204";
}
.fa-toggle-on:before {
  content: "\f205";
}
.fa-bicycle:before {
  content: "\f206";
}
.fa-bus:before {
  content: "\f207";
}
.fa-ioxhost:before {
  content: "\f208";
}
.fa-angellist:before {
  content: "\f209";
}
.fa-cc:before {
  content: "\f20a";
}
.fa-shekel:before,
.fa-sheqel:before,
.fa-ils:before {
  content: "\f20b";
}
.fa-meanpath:before {
  content: "\f20c";
}
.fa-buysellads:before {
  content: "\f20d";
}
.fa-connectdevelop:before {
  content: "\f20e";
}
.fa-dashcube:before {
  content: "\f210";
}
.fa-forumbee:before {
  content: "\f211";
}
.fa-leanpub:before {
  content: "\f212";
}
.fa-sellsy:before {
  content: "\f213";
}
.fa-shirtsinbulk:before {
  content: "\f214";
}
.fa-simplybuilt:before {
  content: "\f215";
}
.fa-skyatlas:before {
  content: "\f216";
}
.fa-cart-plus:before {
  content: "\f217";
}
.fa-cart-arrow-down:before {
  content: "\f218";
}
.fa-diamond:before {
  content: "\f219";
}
.fa-ship:before {
  content: "\f21a";
}
.fa-user-secret:before {
  content: "\f21b";
}
.fa-motorcycle:before {
  content: "\f21c";
}
.fa-street-view:before {
  content: "\f21d";
}
.fa-heartbeat:before {
  content: "\f21e";
}
.fa-venus:before {
  content: "\f221";
}
.fa-mars:before {
  content: "\f222";
}
.fa-mercury:before {
  content: "\f223";
}
.fa-intersex:before,
.fa-transgender:before {
  content: "\f224";
}
.fa-transgender-alt:before {
  content: "\f225";
}
.fa-venus-double:before {
  content: "\f226";
}
.fa-mars-double:before {
  content: "\f227";
}
.fa-venus-mars:before {
  content: "\f228";
}
.fa-mars-stroke:before {
  content: "\f229";
}
.fa-mars-stroke-v:before {
  content: "\f22a";
}
.fa-mars-stroke-h:before {
  content: "\f22b";
}
.fa-neuter:before {
  content: "\f22c";
}
.fa-genderless:before {
  content: "\f22d";
}
.fa-facebook-official:before {
  content: "\f230";
}
.fa-pinterest-p:before {
  content: "\f231";
}
.fa-whatsapp:before {
  content: "\f232";
}
.fa-server:before {
  content: "\f233";
}
.fa-user-plus:before {
  content: "\f234";
}
.fa-user-times:before {
  content: "\f235";
}
.fa-hotel:before,
.fa-bed:before {
  content: "\f236";
}
.fa-viacoin:before {
  content: "\f237";
}
.fa-train:before {
  content: "\f238";
}
.fa-subway:before {
  content: "\f239";
}
.fa-medium:before {
  content: "\f23a";
}
.fa-yc:before,
.fa-y-combinator:before {
  content: "\f23b";
}
.fa-optin-monster:before {
  content: "\f23c";
}
.fa-opencart:before {
  content: "\f23d";
}
.fa-expeditedssl:before {
  content: "\f23e";
}
.fa-battery-4:before,
.fa-battery:before,
.fa-battery-full:before {
  content: "\f240";
}
.fa-battery-3:before,
.fa-battery-three-quarters:before {
  content: "\f241";
}
.fa-battery-2:before,
.fa-battery-half:before {
  content: "\f242";
}
.fa-battery-1:before,
.fa-battery-quarter:before {
  content: "\f243";
}
.fa-battery-0:before,
.fa-battery-empty:before {
  content: "\f244";
}
.fa-mouse-pointer:before {
  content: "\f245";
}
.fa-i-cursor:before {
  content: "\f246";
}
.fa-object-group:before {
  content: "\f247";
}
.fa-object-ungroup:before {
  content: "\f248";
}
.fa-sticky-note:before {
  content: "\f249";
}
.fa-sticky-note-o:before {
  content: "\f24a";
}
.fa-cc-jcb:before {
  content: "\f24b";
}
.fa-cc-diners-club:before {
  content: "\f24c";
}
.fa-clone:before {
  content: "\f24d";
}
.fa-balance-scale:before {
  content: "\f24e";
}
.fa-hourglass-o:before {
  content: "\f250";
}
.fa-hourglass-1:before,
.fa-hourglass-start:before {
  content: "\f251";
}
.fa-hourglass-2:before,
.fa-hourglass-half:before {
  content: "\f252";
}
.fa-hourglass-3:before,
.fa-hourglass-end:before {
  content: "\f253";
}
.fa-hourglass:before {
  content: "\f254";
}
.fa-hand-grab-o:before,
.fa-hand-rock-o:before {
  content: "\f255";
}
.fa-hand-stop-o:before,
.fa-hand-paper-o:before {
  content: "\f256";
}
.fa-hand-scissors-o:before {
  content: "\f257";
}
.fa-hand-lizard-o:before {
  content: "\f258";
}
.fa-hand-spock-o:before {
  content: "\f259";
}
.fa-hand-pointer-o:before {
  content: "\f25a";
}
.fa-hand-peace-o:before {
  content: "\f25b";
}
.fa-trademark:before {
  content: "\f25c";
}
.fa-registered:before {
  content: "\f25d";
}
.fa-creative-commons:before {
  content: "\f25e";
}
.fa-gg:before {
  content: "\f260";
}
.fa-gg-circle:before {
  content: "\f261";
}
.fa-tripadvisor:before {
  content: "\f262";
}
.fa-odnoklassniki:before {
  content: "\f263";
}
.fa-odnoklassniki-square:before {
  content: "\f264";
}
.fa-get-pocket:before {
  content: "\f265";
}
.fa-wikipedia-w:before {
  content: "\f266";
}
.fa-safari:before {
  content: "\f267";
}
.fa-chrome:before {
  content: "\f268";
}
.fa-firefox:before {
  content: "\f269";
}
.fa-opera:before {
  content: "\f26a";
}
.fa-internet-explorer:before {
  content: "\f26b";
}
.fa-tv:before,
.fa-television:before {
  content: "\f26c";
}
.fa-contao:before {
  content: "\f26d";
}
.fa-500px:before {
  content: "\f26e";
}
.fa-amazon:before {
  content: "\f270";
}
.fa-calendar-plus-o:before {
  content: "\f271";
}
.fa-calendar-minus-o:before {
  content: "\f272";
}
.fa-calendar-times-o:before {
  content: "\f273";
}
.fa-calendar-check-o:before {
  content: "\f274";
}
.fa-industry:before {
  content: "\f275";
}
.fa-map-pin:before {
  content: "\f276";
}
.fa-map-signs:before {
  content: "\f277";
}
.fa-map-o:before {
  content: "\f278";
}
.fa-map:before {
  content: "\f279";
}
.fa-commenting:before {
  content: "\f27a";
}
.fa-commenting-o:before {
  content: "\f27b";
}
.fa-houzz:before {
  content: "\f27c";
}
.fa-vimeo:before {
  content: "\f27d";
}
.fa-black-tie:before {
  content: "\f27e";
}
.fa-fonticons:before {
  content: "\f280";
}
.fa-reddit-alien:before {
  content: "\f281";
}
.fa-edge:before {
  content: "\f282";
}
.fa-credit-card-alt:before {
  content: "\f283";
}
.fa-codiepie:before {
  content: "\f284";
}
.fa-modx:before {
  content: "\f285";
}
.fa-fort-awesome:before {
  content: "\f286";
}
.fa-usb:before {
  content: "\f287";
}
.fa-product-hunt:before {
  content: "\f288";
}
.fa-mixcloud:before {
  content: "\f289";
}
.fa-scribd:before {
  content: "\f28a";
}
.fa-pause-circle:before {
  content: "\f28b";
}
.fa-pause-circle-o:before {
  content: "\f28c";
}
.fa-stop-circle:before {
  content: "\f28d";
}
.fa-stop-circle-o:before {
  content: "\f28e";
}
.fa-shopping-bag:before {
  content: "\f290";
}
.fa-shopping-basket:before {
  content: "\f291";
}
.fa-hashtag:before {
  content: "\f292";
}
.fa-bluetooth:before {
  content: "\f293";
}
.fa-bluetooth-b:before {
  content: "\f294";
}
.fa-percent:before {
  content: "\f295";
}
.fa-gitlab:before {
  content: "\f296";
}
.fa-wpbeginner:before {
  content: "\f297";
}
.fa-wpforms:before {
  content: "\f298";
}
.fa-envira:before {
  content: "\f299";
}
.fa-universal-access:before {
  content: "\f29a";
}
.fa-wheelchair-alt:before {
  content: "\f29b";
}
.fa-question-circle-o:before {
  content: "\f29c";
}
.fa-blind:before {
  content: "\f29d";
}
.fa-audio-description:before {
  content: "\f29e";
}
.fa-volume-control-phone:before {
  content: "\f2a0";
}
.fa-braille:before {
  content: "\f2a1";
}
.fa-assistive-listening-systems:before {
  content: "\f2a2";
}
.fa-asl-interpreting:before,
.fa-american-sign-language-interpreting:before {
  content: "\f2a3";
}
.fa-deafness:before,
.fa-hard-of-hearing:before,
.fa-deaf:before {
  content: "\f2a4";
}
.fa-glide:before {
  content: "\f2a5";
}
.fa-glide-g:before {
  content: "\f2a6";
}
.fa-signing:before,
.fa-sign-language:before {
  content: "\f2a7";
}
.fa-low-vision:before {
  content: "\f2a8";
}
.fa-viadeo:before {
  content: "\f2a9";
}
.fa-viadeo-square:before {
  content: "\f2aa";
}
.fa-snapchat:before {
  content: "\f2ab";
}
.fa-snapchat-ghost:before {
  content: "\f2ac";
}
.fa-snapchat-square:before {
  content: "\f2ad";
}
.fa-pied-piper:before {
  content: "\f2ae";
}
.fa-first-order:before {
  content: "\f2b0";
}
.fa-yoast:before {
  content: "\f2b1";
}
.fa-themeisle:before {
  content: "\f2b2";
}
.fa-google-plus-circle:before,
.fa-google-plus-official:before {
  content: "\f2b3";
}
.fa-fa:before,
.fa-font-awesome:before {
  content: "\f2b4";
}
.fa-handshake-o:before {
  content: "\f2b5";
}
.fa-envelope-open:before {
  content: "\f2b6";
}
.fa-envelope-open-o:before {
  content: "\f2b7";
}
.fa-linode:before {
  content: "\f2b8";
}
.fa-address-book:before {
  content: "\f2b9";
}
.fa-address-book-o:before {
  content: "\f2ba";
}
.fa-vcard:before,
.fa-address-card:before {
  content: "\f2bb";
}
.fa-vcard-o:before,
.fa-address-card-o:before {
  content: "\f2bc";
}
.fa-user-circle:before {
  content: "\f2bd";
}
.fa-user-circle-o:before {
  content: "\f2be";
}
.fa-user-o:before {
  content: "\f2c0";
}
.fa-id-badge:before {
  content: "\f2c1";
}
.fa-drivers-license:before,
.fa-id-card:before {
  content: "\f2c2";
}
.fa-drivers-license-o:before,
.fa-id-card-o:before {
  content: "\f2c3";
}
.fa-quora:before {
  content: "\f2c4";
}
.fa-free-code-camp:before {
  content: "\f2c5";
}
.fa-telegram:before {
  content: "\f2c6";
}
.fa-thermometer-4:before,
.fa-thermometer:before,
.fa-thermometer-full:before {
  content: "\f2c7";
}
.fa-thermometer-3:before,
.fa-thermometer-three-quarters:before {
  content: "\f2c8";
}
.fa-thermometer-2:before,
.fa-thermometer-half:before {
  content: "\f2c9";
}
.fa-thermometer-1:before,
.fa-thermometer-quarter:before {
  content: "\f2ca";
}
.fa-thermometer-0:before,
.fa-thermometer-empty:before {
  content: "\f2cb";
}
.fa-shower:before {
  content: "\f2cc";
}
.fa-bathtub:before,
.fa-s15:before,
.fa-bath:before {
  content: "\f2cd";
}
.fa-podcast:before {
  content: "\f2ce";
}
.fa-window-maximize:before {
  content: "\f2d0";
}
.fa-window-minimize:before {
  content: "\f2d1";
}
.fa-window-restore:before {
  content: "\f2d2";
}
.fa-times-rectangle:before,
.fa-window-close:before {
  content: "\f2d3";
}
.fa-times-rectangle-o:before,
.fa-window-close-o:before {
  content: "\f2d4";
}
.fa-bandcamp:before {
  content: "\f2d5";
}
.fa-grav:before {
  content: "\f2d6";
}
.fa-etsy:before {
  content: "\f2d7";
}
.fa-imdb:before {
  content: "\f2d8";
}
.fa-ravelry:before {
  content: "\f2d9";
}
.fa-eercast:before {
  content: "\f2da";
}
.fa-microchip:before {
  content: "\f2db";
}
.fa-snowflake-o:before {
  content: "\f2dc";
}
.fa-superpowers:before {
  content: "\f2dd";
}
.fa-wpexplorer:before {
  content: "\f2de";
}
.fa-meetup:before {
  content: "\f2e0";
}
.sr-only {
  position: absolute;
  width: 1px;
  height: 1px;
  padding: 0;
  margin: -1px;
  overflow: hidden;
  clip: rect(0, 0, 0, 0);
  border: 0;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
.sr-only-focusable:active,
.sr-only-focusable:focus {
  position: static;
  width: auto;
  height: auto;
  margin: 0;
  overflow: visible;
  clip: auto;
}
/*!
*
* IPython base
*
*/
.modal.fade .modal-dialog {
  -webkit-transform: translate(0, 0);
  -ms-transform: translate(0, 0);
  -o-transform: translate(0, 0);
  transform: translate(0, 0);
}
code {
  color: #000;
}
pre {
  font-size: inherit;
  line-height: inherit;
}
label {
  font-weight: normal;
}
/* Make the page background atleast 100% the height of the view port */
/* Make the page itself atleast 70% the height of the view port */
.border-box-sizing {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.corner-all {
  border-radius: 2px;
}
.no-padding {
  padding: 0px;
}
/* Flexible box model classes */
/* Taken from Alex Russell http://infrequently.org/2009/08/css-3-progress/ */
/* This file is a compatability layer.  It allows the usage of flexible box 
model layouts accross multiple browsers, including older browsers.  The newest,
universal implementation of the flexible box model is used when available (see
`Modern browsers` comments below).  Browsers that are known to implement this 
new spec completely include:

    Firefox 28.0+
    Chrome 29.0+
    Internet Explorer 11+ 
    Opera 17.0+

Browsers not listed, including Safari, are supported via the styling under the
`Old browsers` comments below.
*/
.hbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
.hbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.vbox {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
.vbox > * {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
}
.hbox.reverse,
.vbox.reverse,
.reverse {
  /* Old browsers */
  -webkit-box-direction: reverse;
  -moz-box-direction: reverse;
  box-direction: reverse;
  /* Modern browsers */
  flex-direction: row-reverse;
}
.hbox.box-flex0,
.vbox.box-flex0,
.box-flex0 {
  /* Old browsers */
  -webkit-box-flex: 0;
  -moz-box-flex: 0;
  box-flex: 0;
  /* Modern browsers */
  flex: none;
  width: auto;
}
.hbox.box-flex1,
.vbox.box-flex1,
.box-flex1 {
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex,
.vbox.box-flex,
.box-flex {
  /* Old browsers */
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
.hbox.box-flex2,
.vbox.box-flex2,
.box-flex2 {
  /* Old browsers */
  -webkit-box-flex: 2;
  -moz-box-flex: 2;
  box-flex: 2;
  /* Modern browsers */
  flex: 2;
}
.box-group1 {
  /*  Deprecated */
  -webkit-box-flex-group: 1;
  -moz-box-flex-group: 1;
  box-flex-group: 1;
}
.box-group2 {
  /* Deprecated */
  -webkit-box-flex-group: 2;
  -moz-box-flex-group: 2;
  box-flex-group: 2;
}
.hbox.start,
.vbox.start,
.start {
  /* Old browsers */
  -webkit-box-pack: start;
  -moz-box-pack: start;
  box-pack: start;
  /* Modern browsers */
  justify-content: flex-start;
}
.hbox.end,
.vbox.end,
.end {
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
}
.hbox.center,
.vbox.center,
.center {
  /* Old browsers */
  -webkit-box-pack: center;
  -moz-box-pack: center;
  box-pack: center;
  /* Modern browsers */
  justify-content: center;
}
.hbox.baseline,
.vbox.baseline,
.baseline {
  /* Old browsers */
  -webkit-box-pack: baseline;
  -moz-box-pack: baseline;
  box-pack: baseline;
  /* Modern browsers */
  justify-content: baseline;
}
.hbox.stretch,
.vbox.stretch,
.stretch {
  /* Old browsers */
  -webkit-box-pack: stretch;
  -moz-box-pack: stretch;
  box-pack: stretch;
  /* Modern browsers */
  justify-content: stretch;
}
.hbox.align-start,
.vbox.align-start,
.align-start {
  /* Old browsers */
  -webkit-box-align: start;
  -moz-box-align: start;
  box-align: start;
  /* Modern browsers */
  align-items: flex-start;
}
.hbox.align-end,
.vbox.align-end,
.align-end {
  /* Old browsers */
  -webkit-box-align: end;
  -moz-box-align: end;
  box-align: end;
  /* Modern browsers */
  align-items: flex-end;
}
.hbox.align-center,
.vbox.align-center,
.align-center {
  /* Old browsers */
  -webkit-box-align: center;
  -moz-box-align: center;
  box-align: center;
  /* Modern browsers */
  align-items: center;
}
.hbox.align-baseline,
.vbox.align-baseline,
.align-baseline {
  /* Old browsers */
  -webkit-box-align: baseline;
  -moz-box-align: baseline;
  box-align: baseline;
  /* Modern browsers */
  align-items: baseline;
}
.hbox.align-stretch,
.vbox.align-stretch,
.align-stretch {
  /* Old browsers */
  -webkit-box-align: stretch;
  -moz-box-align: stretch;
  box-align: stretch;
  /* Modern browsers */
  align-items: stretch;
}
div.error {
  margin: 2em;
  text-align: center;
}
div.error > h1 {
  font-size: 500%;
  line-height: normal;
}
div.error > p {
  font-size: 200%;
  line-height: normal;
}
div.traceback-wrapper {
  text-align: left;
  max-width: 800px;
  margin: auto;
}
div.traceback-wrapper pre.traceback {
  max-height: 600px;
  overflow: auto;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
body {
  background-color: #fff;
  /* This makes sure that the body covers the entire window and needs to
       be in a different element than the display: box in wrapper below */
  position: absolute;
  left: 0px;
  right: 0px;
  top: 0px;
  bottom: 0px;
  overflow: visible;
}
body > #header {
  /* Initially hidden to prevent FLOUC */
  display: none;
  background-color: #fff;
  /* Display over codemirror */
  position: relative;
  z-index: 100;
}
body > #header #header-container {
  display: flex;
  flex-direction: row;
  justify-content: space-between;
  padding: 5px;
  padding-bottom: 5px;
  padding-top: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
body > #header .header-bar {
  width: 100%;
  height: 1px;
  background: #e7e7e7;
  margin-bottom: -1px;
}
@media print {
  body > #header {
    display: none !important;
  }
}
#header-spacer {
  width: 100%;
  visibility: hidden;
}
@media print {
  #header-spacer {
    display: none;
  }
}
#ipython_notebook {
  padding-left: 0px;
  padding-top: 1px;
  padding-bottom: 1px;
}
[dir="rtl"] #ipython_notebook {
  margin-right: 10px;
  margin-left: 0;
}
[dir="rtl"] #ipython_notebook.pull-left {
  float: right !important;
  float: right;
}
.flex-spacer {
  flex: 1;
}
#noscript {
  width: auto;
  padding-top: 16px;
  padding-bottom: 16px;
  text-align: center;
  font-size: 22px;
  color: red;
  font-weight: bold;
}
#ipython_notebook img {
  height: 28px;
}
#site {
  width: 100%;
  display: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  overflow: auto;
}
@media print {
  #site {
    height: auto !important;
  }
}
/* Smaller buttons */
.ui-button .ui-button-text {
  padding: 0.2em 0.8em;
  font-size: 77%;
}
input.ui-button {
  padding: 0.3em 0.9em;
}
span#kernel_logo_widget {
  margin: 0 10px;
}
span#login_widget {
  float: right;
}
[dir="rtl"] span#login_widget {
  float: left;
}
span#login_widget > .button,
#logout {
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button:focus,
#logout:focus,
span#login_widget > .button.focus,
#logout.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
span#login_widget > .button:hover,
#logout:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
span#login_widget > .button:active:hover,
#logout:active:hover,
span#login_widget > .button.active:hover,
#logout.active:hover,
.open > .dropdown-togglespan#login_widget > .button:hover,
.open > .dropdown-toggle#logout:hover,
span#login_widget > .button:active:focus,
#logout:active:focus,
span#login_widget > .button.active:focus,
#logout.active:focus,
.open > .dropdown-togglespan#login_widget > .button:focus,
.open > .dropdown-toggle#logout:focus,
span#login_widget > .button:active.focus,
#logout:active.focus,
span#login_widget > .button.active.focus,
#logout.active.focus,
.open > .dropdown-togglespan#login_widget > .button.focus,
.open > .dropdown-toggle#logout.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
span#login_widget > .button:active,
#logout:active,
span#login_widget > .button.active,
#logout.active,
.open > .dropdown-togglespan#login_widget > .button,
.open > .dropdown-toggle#logout {
  background-image: none;
}
span#login_widget > .button.disabled:hover,
#logout.disabled:hover,
span#login_widget > .button[disabled]:hover,
#logout[disabled]:hover,
fieldset[disabled] span#login_widget > .button:hover,
fieldset[disabled] #logout:hover,
span#login_widget > .button.disabled:focus,
#logout.disabled:focus,
span#login_widget > .button[disabled]:focus,
#logout[disabled]:focus,
fieldset[disabled] span#login_widget > .button:focus,
fieldset[disabled] #logout:focus,
span#login_widget > .button.disabled.focus,
#logout.disabled.focus,
span#login_widget > .button[disabled].focus,
#logout[disabled].focus,
fieldset[disabled] span#login_widget > .button.focus,
fieldset[disabled] #logout.focus {
  background-color: #fff;
  border-color: #ccc;
}
span#login_widget > .button .badge,
#logout .badge {
  color: #fff;
  background-color: #333;
}
.nav-header {
  text-transform: none;
}
#header > span {
  margin-top: 10px;
}
.modal_stretch .modal-dialog {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  min-height: 80vh;
}
.modal_stretch .modal-dialog .modal-body {
  max-height: calc(100vh - 200px);
  overflow: auto;
  flex: 1;
}
.modal-header {
  cursor: move;
}
@media (min-width: 768px) {
  .modal .modal-dialog {
    width: 700px;
  }
}
@media (min-width: 768px) {
  select.form-control {
    margin-left: 12px;
    margin-right: 12px;
  }
}
/*!
*
* IPython auth
*
*/
.center-nav {
  display: inline-block;
  margin-bottom: -4px;
}
[dir="rtl"] .center-nav form.pull-left {
  float: right !important;
  float: right;
}
[dir="rtl"] .center-nav .navbar-text {
  float: right;
}
[dir="rtl"] .navbar-inner {
  text-align: right;
}
[dir="rtl"] div.text-left {
  text-align: right;
}
/*!
*
* IPython tree view
*
*/
/* We need an invisible input field on top of the sentense*/
/* "Drag file onto the list ..." */
.alternate_upload {
  background-color: none;
  display: inline;
}
.alternate_upload.form {
  padding: 0;
  margin: 0;
}
.alternate_upload input.fileinput {
  position: absolute;
  display: block;
  width: 100%;
  height: 100%;
  overflow: hidden;
  cursor: pointer;
  opacity: 0;
  z-index: 2;
}
.alternate_upload .btn-xs > input.fileinput {
  margin: -1px -5px;
}
.alternate_upload .btn-upload {
  position: relative;
  height: 22px;
}
::-webkit-file-upload-button {
  cursor: pointer;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
ul#tabs {
  margin-bottom: 4px;
}
ul#tabs a {
  padding-top: 6px;
  padding-bottom: 4px;
}
[dir="rtl"] ul#tabs.nav-tabs > li {
  float: right;
}
[dir="rtl"] ul#tabs.nav.nav-tabs {
  padding-right: 0;
}
ul.breadcrumb a:focus,
ul.breadcrumb a:hover {
  text-decoration: none;
}
ul.breadcrumb i.icon-home {
  font-size: 16px;
  margin-right: 4px;
}
ul.breadcrumb span {
  color: #5e5e5e;
}
.list_toolbar {
  padding: 4px 0 4px 0;
  vertical-align: middle;
}
.list_toolbar .tree-buttons {
  padding-top: 1px;
}
[dir="rtl"] .list_toolbar .tree-buttons .pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .list_toolbar .col-sm-4,
[dir="rtl"] .list_toolbar .col-sm-8 {
  float: right;
}
.dynamic-buttons {
  padding-top: 3px;
  display: inline-block;
}
.list_toolbar [class*="span"] {
  min-height: 24px;
}
.list_header {
  font-weight: bold;
  background-color: #EEE;
}
.list_placeholder {
  font-weight: bold;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
}
.list_container {
  margin-top: 4px;
  margin-bottom: 20px;
  border: 1px solid #ddd;
  border-radius: 2px;
}
.list_container > div {
  border-bottom: 1px solid #ddd;
}
.list_container > div:hover .list-item {
  background-color: red;
}
.list_container > div:last-child {
  border: none;
}
.list_item:hover .list_item {
  background-color: #ddd;
}
.list_item a {
  text-decoration: none;
}
.list_item:hover {
  background-color: #fafafa;
}
.list_header > div,
.list_item > div {
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
.list_header > div input,
.list_item > div input {
  margin-right: 7px;
  margin-left: 14px;
  vertical-align: text-bottom;
  line-height: 22px;
  position: relative;
  top: -1px;
}
.list_header > div .item_link,
.list_item > div .item_link {
  margin-left: -1px;
  vertical-align: baseline;
  line-height: 22px;
}
[dir="rtl"] .list_item > div input {
  margin-right: 0;
}
.new-file input[type=checkbox] {
  visibility: hidden;
}
.item_name {
  line-height: 22px;
  height: 24px;
}
.item_icon {
  font-size: 14px;
  color: #5e5e5e;
  margin-right: 7px;
  margin-left: 7px;
  line-height: 22px;
  vertical-align: baseline;
}
.item_modified {
  margin-right: 7px;
  margin-left: 7px;
}
[dir="rtl"] .item_modified.pull-right {
  float: left !important;
  float: left;
}
.item_buttons {
  line-height: 1em;
  margin-left: -5px;
}
.item_buttons .btn,
.item_buttons .btn-group,
.item_buttons .input-group {
  float: left;
}
.item_buttons > .btn,
.item_buttons > .btn-group,
.item_buttons > .input-group {
  margin-left: 5px;
}
.item_buttons .btn {
  min-width: 13ex;
}
.item_buttons .running-indicator {
  padding-top: 4px;
  color: #5cb85c;
}
.item_buttons .kernel-name {
  padding-top: 4px;
  color: #5bc0de;
  margin-right: 7px;
  float: left;
}
[dir="rtl"] .item_buttons.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .item_buttons .kernel-name {
  margin-left: 7px;
  float: right;
}
.toolbar_info {
  height: 24px;
  line-height: 24px;
}
.list_item input:not([type=checkbox]) {
  padding-top: 3px;
  padding-bottom: 3px;
  height: 22px;
  line-height: 14px;
  margin: 0px;
}
.highlight_text {
  color: blue;
}
#project_name {
  display: inline-block;
  padding-left: 7px;
  margin-left: -2px;
}
#project_name > .breadcrumb {
  padding: 0px;
  margin-bottom: 0px;
  background-color: transparent;
  font-weight: bold;
}
.sort_button {
  display: inline-block;
  padding-left: 7px;
}
[dir="rtl"] .sort_button.pull-right {
  float: left !important;
  float: left;
}
#tree-selector {
  padding-right: 0px;
}
#button-select-all {
  min-width: 50px;
}
[dir="rtl"] #button-select-all.btn {
  float: right ;
}
#select-all {
  margin-left: 7px;
  margin-right: 2px;
  margin-top: 2px;
  height: 16px;
}
[dir="rtl"] #select-all.pull-left {
  float: right !important;
  float: right;
}
.menu_icon {
  margin-right: 2px;
}
.tab-content .row {
  margin-left: 0px;
  margin-right: 0px;
}
.folder_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f114";
}
.folder_icon:before.fa-pull-left {
  margin-right: .3em;
}
.folder_icon:before.fa-pull-right {
  margin-left: .3em;
}
.folder_icon:before.pull-left {
  margin-right: .3em;
}
.folder_icon:before.pull-right {
  margin-left: .3em;
}
.notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
}
.notebook_icon:before.fa-pull-left {
  margin-right: .3em;
}
.notebook_icon:before.fa-pull-right {
  margin-left: .3em;
}
.notebook_icon:before.pull-left {
  margin-right: .3em;
}
.notebook_icon:before.pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f02d";
  position: relative;
  top: -1px;
  color: #5cb85c;
}
.running_notebook_icon:before.fa-pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.fa-pull-right {
  margin-left: .3em;
}
.running_notebook_icon:before.pull-left {
  margin-right: .3em;
}
.running_notebook_icon:before.pull-right {
  margin-left: .3em;
}
.file_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f016";
  position: relative;
  top: -2px;
}
.file_icon:before.fa-pull-left {
  margin-right: .3em;
}
.file_icon:before.fa-pull-right {
  margin-left: .3em;
}
.file_icon:before.pull-left {
  margin-right: .3em;
}
.file_icon:before.pull-right {
  margin-left: .3em;
}
#notebook_toolbar .pull-right {
  padding-top: 0px;
  margin-right: -1px;
}
ul#new-menu {
  left: auto;
  right: 0;
}
#new-menu .dropdown-header {
  font-size: 10px;
  border-bottom: 1px solid #e5e5e5;
  padding: 0 0 3px;
  margin: -3px 20px 0;
}
.kernel-menu-icon {
  padding-right: 12px;
  width: 24px;
  content: "\f096";
}
.kernel-menu-icon:before {
  content: "\f096";
}
.kernel-menu-icon-current:before {
  content: "\f00c";
}
#tab_content {
  padding-top: 20px;
}
#running .panel-group .panel {
  margin-top: 3px;
  margin-bottom: 1em;
}
#running .panel-group .panel .panel-heading {
  background-color: #EEE;
  padding-top: 4px;
  padding-bottom: 4px;
  padding-left: 7px;
  padding-right: 7px;
  line-height: 22px;
}
#running .panel-group .panel .panel-heading a:focus,
#running .panel-group .panel .panel-heading a:hover {
  text-decoration: none;
}
#running .panel-group .panel .panel-body {
  padding: 0px;
}
#running .panel-group .panel .panel-body .list_container {
  margin-top: 0px;
  margin-bottom: 0px;
  border: 0px;
  border-radius: 0px;
}
#running .panel-group .panel .panel-body .list_container .list_item {
  border-bottom: 1px solid #ddd;
}
#running .panel-group .panel .panel-body .list_container .list_item:last-child {
  border-bottom: 0px;
}
.delete-button {
  display: none;
}
.duplicate-button {
  display: none;
}
.rename-button {
  display: none;
}
.move-button {
  display: none;
}
.download-button {
  display: none;
}
.shutdown-button {
  display: none;
}
.dynamic-instructions {
  display: inline-block;
  padding-top: 4px;
}
/*!
*
* IPython text editor webapp
*
*/
.selected-keymap i.fa {
  padding: 0px 5px;
}
.selected-keymap i.fa:before {
  content: "\f00c";
}
#mode-menu {
  overflow: auto;
  max-height: 20em;
}
.edit_app #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.edit_app #menubar .navbar {
  /* Use a negative 1 bottom margin, so the border overlaps the border of the
    header */
  margin-bottom: -1px;
}
.dirty-indicator {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator.pull-left {
  margin-right: .3em;
}
.dirty-indicator.pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-dirty.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-dirty.pull-left {
  margin-right: .3em;
}
.dirty-indicator-dirty.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  width: 20px;
}
.dirty-indicator-clean.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean.pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f00c";
}
.dirty-indicator-clean:before.fa-pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.fa-pull-right {
  margin-left: .3em;
}
.dirty-indicator-clean:before.pull-left {
  margin-right: .3em;
}
.dirty-indicator-clean:before.pull-right {
  margin-left: .3em;
}
#filename {
  font-size: 16pt;
  display: table;
  padding: 0px 5px;
}
#current-mode {
  padding-left: 5px;
  padding-right: 5px;
}
#texteditor-backdrop {
  padding-top: 20px;
  padding-bottom: 20px;
}
@media not print {
  #texteditor-backdrop {
    background-color: #EEE;
  }
}
@media print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container .CodeMirror-gutter,
  #texteditor-backdrop #texteditor-container .CodeMirror-gutters {
    background-color: #fff;
  }
}
@media not print {
  #texteditor-backdrop #texteditor-container {
    padding: 0px;
    background-color: #fff;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
.CodeMirror-dialog {
  background-color: #fff;
}
/*!
*
* IPython notebook
*
*/
/* CSS font colors for translated ANSI escape sequences */
/* The color values are a mix of
   http://www.xcolors.net/dl/baskerville-ivorylight and
   http://www.xcolors.net/dl/euphrasia */
.ansi-black-fg {
  color: #3E424D;
}
.ansi-black-bg {
  background-color: #3E424D;
}
.ansi-black-intense-fg {
  color: #282C36;
}
.ansi-black-intense-bg {
  background-color: #282C36;
}
.ansi-red-fg {
  color: #E75C58;
}
.ansi-red-bg {
  background-color: #E75C58;
}
.ansi-red-intense-fg {
  color: #B22B31;
}
.ansi-red-intense-bg {
  background-color: #B22B31;
}
.ansi-green-fg {
  color: #00A250;
}
.ansi-green-bg {
  background-color: #00A250;
}
.ansi-green-intense-fg {
  color: #007427;
}
.ansi-green-intense-bg {
  background-color: #007427;
}
.ansi-yellow-fg {
  color: #DDB62B;
}
.ansi-yellow-bg {
  background-color: #DDB62B;
}
.ansi-yellow-intense-fg {
  color: #B27D12;
}
.ansi-yellow-intense-bg {
  background-color: #B27D12;
}
.ansi-blue-fg {
  color: #208FFB;
}
.ansi-blue-bg {
  background-color: #208FFB;
}
.ansi-blue-intense-fg {
  color: #0065CA;
}
.ansi-blue-intense-bg {
  background-color: #0065CA;
}
.ansi-magenta-fg {
  color: #D160C4;
}
.ansi-magenta-bg {
  background-color: #D160C4;
}
.ansi-magenta-intense-fg {
  color: #A03196;
}
.ansi-magenta-intense-bg {
  background-color: #A03196;
}
.ansi-cyan-fg {
  color: #60C6C8;
}
.ansi-cyan-bg {
  background-color: #60C6C8;
}
.ansi-cyan-intense-fg {
  color: #258F8F;
}
.ansi-cyan-intense-bg {
  background-color: #258F8F;
}
.ansi-white-fg {
  color: #C5C1B4;
}
.ansi-white-bg {
  background-color: #C5C1B4;
}
.ansi-white-intense-fg {
  color: #A1A6B2;
}
.ansi-white-intense-bg {
  background-color: #A1A6B2;
}
.ansi-default-inverse-fg {
  color: #FFFFFF;
}
.ansi-default-inverse-bg {
  background-color: #000000;
}
.ansi-bold {
  font-weight: bold;
}
.ansi-underline {
  text-decoration: underline;
}
/* The following styles are deprecated an will be removed in a future version */
.ansibold {
  font-weight: bold;
}
.ansi-inverse {
  outline: 0.5px dotted;
}
/* use dark versions for foreground, to improve visibility */
.ansiblack {
  color: black;
}
.ansired {
  color: darkred;
}
.ansigreen {
  color: darkgreen;
}
.ansiyellow {
  color: #c4a000;
}
.ansiblue {
  color: darkblue;
}
.ansipurple {
  color: darkviolet;
}
.ansicyan {
  color: steelblue;
}
.ansigray {
  color: gray;
}
/* and light for background, for the same reason */
.ansibgblack {
  background-color: black;
}
.ansibgred {
  background-color: red;
}
.ansibggreen {
  background-color: green;
}
.ansibgyellow {
  background-color: yellow;
}
.ansibgblue {
  background-color: blue;
}
.ansibgpurple {
  background-color: magenta;
}
.ansibgcyan {
  background-color: cyan;
}
.ansibggray {
  background-color: gray;
}
div.cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  border-radius: 2px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  border-width: 1px;
  border-style: solid;
  border-color: transparent;
  width: 100%;
  padding: 5px;
  /* This acts as a spacer between cells, that is outside the border */
  margin: 0px;
  outline: none;
  position: relative;
  overflow: visible;
}
div.cell:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: transparent;
}
div.cell.jupyter-soft-selected {
  border-left-color: #E3F2FD;
  border-left-width: 1px;
  padding-left: 5px;
  border-right-color: #E3F2FD;
  border-right-width: 1px;
  background: #E3F2FD;
}
@media print {
  div.cell.jupyter-soft-selected {
    border-color: transparent;
  }
}
div.cell.selected,
div.cell.selected.jupyter-soft-selected {
  border-color: #ababab;
}
div.cell.selected:before,
div.cell.selected.jupyter-soft-selected:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: #42A5F5;
}
@media print {
  div.cell.selected,
  div.cell.selected.jupyter-soft-selected {
    border-color: transparent;
  }
}
.edit_mode div.cell.selected {
  border-color: #66BB6A;
}
.edit_mode div.cell.selected:before {
  position: absolute;
  display: block;
  top: -1px;
  left: -1px;
  width: 5px;
  height: calc(100% +  2px);
  content: '';
  background: #66BB6A;
}
@media print {
  .edit_mode div.cell.selected {
    border-color: transparent;
  }
}
.prompt {
  /* This needs to be wide enough for 3 digit prompt numbers: In[100]: */
  min-width: 14ex;
  /* This padding is tuned to match the padding on the CodeMirror editor. */
  padding: 0.4em;
  margin: 0px;
  font-family: monospace;
  text-align: right;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
  /* Don't highlight prompt number selection */
  -webkit-touch-callout: none;
  -webkit-user-select: none;
  -khtml-user-select: none;
  -moz-user-select: none;
  -ms-user-select: none;
  user-select: none;
  /* Use default cursor */
  cursor: default;
}
@media (max-width: 540px) {
  .prompt {
    text-align: left;
  }
}
div.inner_cell {
  min-width: 0;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_area {
  border: 1px solid #cfcfcf;
  border-radius: 2px;
  background: #f7f7f7;
  line-height: 1.21429em;
}
/* This is needed so that empty prompt areas can collapse to zero height when there
   is no content in the output_subarea and the prompt. The main purpose of this is
   to make sure that empty JavaScript output_subareas have no height. */
div.prompt:empty {
  padding-top: 0;
  padding-bottom: 0;
}
div.unrecognized_cell {
  padding: 5px 5px 5px 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.unrecognized_cell .inner_cell {
  border-radius: 2px;
  padding: 5px;
  font-weight: bold;
  color: red;
  border: 1px solid #cfcfcf;
  background: #eaeaea;
}
div.unrecognized_cell .inner_cell a {
  color: inherit;
  text-decoration: none;
}
div.unrecognized_cell .inner_cell a:hover {
  color: inherit;
  text-decoration: none;
}
@media (max-width: 540px) {
  div.unrecognized_cell > div.prompt {
    display: none;
  }
}
div.code_cell {
  /* avoid page breaking on code cells when printing */
}
@media print {
  div.code_cell {
    page-break-inside: avoid;
  }
}
/* any special styling for code cells that are currently running goes here */
div.input {
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.input {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
/* input_area and input_prompt must match in top border and margin for alignment */
div.input_prompt {
  color: #303F9F;
  border-top: 1px solid transparent;
}
div.input_area > div.highlight {
  margin: 0.4em;
  border: none;
  padding: 0px;
  background-color: transparent;
}
div.input_area > div.highlight > pre {
  margin: 0px;
  border: none;
  padding: 0px;
  background-color: transparent;
}
/* The following gets added to the <head> if it is detected that the user has a
 * monospace font with inconsistent normal/bold/italic height.  See
 * notebookmain.js.  Such fonts will have keywords vertically offset with
 * respect to the rest of the text.  The user should select a better font.
 * See: https://github.com/ipython/ipython/issues/1503
 *
 * .CodeMirror span {
 *      vertical-align: bottom;
 * }
 */
.CodeMirror {
  line-height: 1.21429em;
  /* Changed from 1em to our global default */
  font-size: 14px;
  height: auto;
  /* Changed to auto to autogrow */
  background: none;
  /* Changed from white to allow our bg to show through */
}
.CodeMirror-scroll {
  /*  The CodeMirror docs are a bit fuzzy on if overflow-y should be hidden or visible.*/
  /*  We have found that if it is visible, vertical scrollbars appear with font size changes.*/
  overflow-y: hidden;
  overflow-x: auto;
}
.CodeMirror-lines {
  /* In CM2, this used to be 0.4em, but in CM3 it went to 4px. We need the em value because */
  /* we have set a different line-height and want this to scale with that. */
  /* Note that this should set vertical padding only, since CodeMirror assumes
       that horizontal padding will be set on CodeMirror pre */
  padding: 0.4em 0;
}
.CodeMirror-linenumber {
  padding: 0 8px 0 4px;
}
.CodeMirror-gutters {
  border-bottom-left-radius: 2px;
  border-top-left-radius: 2px;
}
.CodeMirror pre {
  /* In CM3 this went to 4px from 0 in CM2. This sets horizontal padding only,
    use .CodeMirror-lines for vertical */
  padding: 0 0.4em;
  border: 0;
  border-radius: 0;
}
.CodeMirror-cursor {
  border-left: 1.4px solid black;
}
@media screen and (min-width: 2138px) and (max-width: 4319px) {
  .CodeMirror-cursor {
    border-left: 2px solid black;
  }
}
@media screen and (min-width: 4320px) {
  .CodeMirror-cursor {
    border-left: 4px solid black;
  }
}
/*

Original style from softwaremaniacs.org (c) Ivan Sagalaev <Maniac@SoftwareManiacs.Org>
Adapted from GitHub theme

*/
.highlight-base {
  color: #000;
}
.highlight-variable {
  color: #000;
}
.highlight-variable-2 {
  color: #1a1a1a;
}
.highlight-variable-3 {
  color: #333333;
}
.highlight-string {
  color: #BA2121;
}
.highlight-comment {
  color: #408080;
  font-style: italic;
}
.highlight-number {
  color: #080;
}
.highlight-atom {
  color: #88F;
}
.highlight-keyword {
  color: #008000;
  font-weight: bold;
}
.highlight-builtin {
  color: #008000;
}
.highlight-error {
  color: #f00;
}
.highlight-operator {
  color: #AA22FF;
  font-weight: bold;
}
.highlight-meta {
  color: #AA22FF;
}
/* previously not defined, copying from default codemirror */
.highlight-def {
  color: #00f;
}
.highlight-string-2 {
  color: #f50;
}
.highlight-qualifier {
  color: #555;
}
.highlight-bracket {
  color: #997;
}
.highlight-tag {
  color: #170;
}
.highlight-attribute {
  color: #00c;
}
.highlight-header {
  color: blue;
}
.highlight-quote {
  color: #090;
}
.highlight-link {
  color: #00c;
}
/* apply the same style to codemirror */
.cm-s-ipython span.cm-keyword {
  color: #008000;
  font-weight: bold;
}
.cm-s-ipython span.cm-atom {
  color: #88F;
}
.cm-s-ipython span.cm-number {
  color: #080;
}
.cm-s-ipython span.cm-def {
  color: #00f;
}
.cm-s-ipython span.cm-variable {
  color: #000;
}
.cm-s-ipython span.cm-operator {
  color: #AA22FF;
  font-weight: bold;
}
.cm-s-ipython span.cm-variable-2 {
  color: #1a1a1a;
}
.cm-s-ipython span.cm-variable-3 {
  color: #333333;
}
.cm-s-ipython span.cm-comment {
  color: #408080;
  font-style: italic;
}
.cm-s-ipython span.cm-string {
  color: #BA2121;
}
.cm-s-ipython span.cm-string-2 {
  color: #f50;
}
.cm-s-ipython span.cm-meta {
  color: #AA22FF;
}
.cm-s-ipython span.cm-qualifier {
  color: #555;
}
.cm-s-ipython span.cm-builtin {
  color: #008000;
}
.cm-s-ipython span.cm-bracket {
  color: #997;
}
.cm-s-ipython span.cm-tag {
  color: #170;
}
.cm-s-ipython span.cm-attribute {
  color: #00c;
}
.cm-s-ipython span.cm-header {
  color: blue;
}
.cm-s-ipython span.cm-quote {
  color: #090;
}
.cm-s-ipython span.cm-link {
  color: #00c;
}
.cm-s-ipython span.cm-error {
  color: #f00;
}
.cm-s-ipython span.cm-tab {
  background: url(data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAMCAYAAAAkuj5RAAAAAXNSR0IArs4c6QAAAGFJREFUSMft1LsRQFAQheHPowAKoACx3IgEKtaEHujDjORSgWTH/ZOdnZOcM/sgk/kFFWY0qV8foQwS4MKBCS3qR6ixBJvElOobYAtivseIE120FaowJPN75GMu8j/LfMwNjh4HUpwg4LUAAAAASUVORK5CYII=);
  background-position: right;
  background-repeat: no-repeat;
}
div.output_wrapper {
  /* this position must be relative to enable descendents to be absolute within it */
  position: relative;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
  z-index: 1;
}
/* class for the output area when it should be height-limited */
div.output_scroll {
  /* ideally, this would be max-height, but FF barfs all over that */
  height: 24em;
  /* FF needs this *and the wrapper* to specify full width, or it will shrinkwrap */
  width: 100%;
  overflow: auto;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  box-shadow: inset 0 2px 8px rgba(0, 0, 0, 0.8);
  display: block;
}
/* output div while it is collapsed */
div.output_collapsed {
  margin: 0px;
  padding: 0px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
div.out_prompt_overlay {
  height: 100%;
  padding: 0px 0.4em;
  position: absolute;
  border-radius: 2px;
}
div.out_prompt_overlay:hover {
  /* use inner shadow to get border that is computed the same on WebKit/FF */
  -webkit-box-shadow: inset 0 0 1px #000;
  box-shadow: inset 0 0 1px #000;
  background: rgba(240, 240, 240, 0.5);
}
div.output_prompt {
  color: #D84315;
}
/* This class is the outer container of all output sections. */
div.output_area {
  padding: 0px;
  page-break-inside: avoid;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
div.output_area .MathJax_Display {
  text-align: left !important;
}
div.output_area .rendered_html table {
  margin-left: 0;
  margin-right: 0;
}
div.output_area .rendered_html img {
  margin-left: 0;
  margin-right: 0;
}
div.output_area img,
div.output_area svg {
  max-width: 100%;
  height: auto;
}
div.output_area img.unconfined,
div.output_area svg.unconfined {
  max-width: none;
}
div.output_area .mglyph > img {
  max-width: none;
}
/* This is needed to protect the pre formating from global settings such
   as that of bootstrap */
.output {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: vertical;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: vertical;
  -moz-box-align: stretch;
  display: box;
  box-orient: vertical;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: column;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.output_area {
    /* Old browsers */
    display: -webkit-box;
    -webkit-box-orient: vertical;
    -webkit-box-align: stretch;
    display: -moz-box;
    -moz-box-orient: vertical;
    -moz-box-align: stretch;
    display: box;
    box-orient: vertical;
    box-align: stretch;
    /* Modern browsers */
    display: flex;
    flex-direction: column;
    align-items: stretch;
  }
}
div.output_area pre {
  margin: 0;
  padding: 1px 0 1px 0;
  border: 0;
  vertical-align: baseline;
  color: black;
  background-color: transparent;
  border-radius: 0;
}
/* This class is for the output subarea inside the output_area and after
   the prompt div. */
div.output_subarea {
  overflow-x: auto;
  padding: 0.4em;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
  max-width: calc(100% - 14ex);
}
div.output_scroll div.output_subarea {
  overflow-x: visible;
}
/* The rest of the output_* classes are for special styling of the different
   output types */
/* all text output has this class: */
div.output_text {
  text-align: left;
  color: #000;
  /* This has to match that of the the CodeMirror class line-height below */
  line-height: 1.21429em;
}
/* stdout/stderr are 'text' as well as 'stream', but execute_result/error are *not* streams */
div.output_stderr {
  background: #fdd;
  /* very light red background for stderr */
}
div.output_latex {
  text-align: left;
}
/* Empty output_javascript divs should have no height */
div.output_javascript:empty {
  padding: 0;
}
.js-error {
  color: darkred;
}
/* raw_input styles */
div.raw_input_container {
  line-height: 1.21429em;
  padding-top: 5px;
}
pre.raw_input_prompt {
  /* nothing needed here. */
}
input.raw_input {
  font-family: monospace;
  font-size: inherit;
  color: inherit;
  width: auto;
  /* make sure input baseline aligns with prompt */
  vertical-align: baseline;
  /* padding + margin = 0.5em between prompt and cursor */
  padding: 0em 0.25em;
  margin: 0em 0.25em;
}
input.raw_input:focus {
  box-shadow: none;
}
p.p-space {
  margin-bottom: 10px;
}
div.output_unrecognized {
  padding: 5px;
  font-weight: bold;
  color: red;
}
div.output_unrecognized a {
  color: inherit;
  text-decoration: none;
}
div.output_unrecognized a:hover {
  color: inherit;
  text-decoration: none;
}
.rendered_html {
  color: #000;
  /* any extras will just be numbers: */
}
.rendered_html em {
  font-style: italic;
}
.rendered_html strong {
  font-weight: bold;
}
.rendered_html u {
  text-decoration: underline;
}
.rendered_html :link {
  text-decoration: underline;
}
.rendered_html :visited {
  text-decoration: underline;
}
.rendered_html h1 {
  font-size: 185.7%;
  margin: 1.08em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h2 {
  font-size: 157.1%;
  margin: 1.27em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h3 {
  font-size: 128.6%;
  margin: 1.55em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h4 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
}
.rendered_html h5 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h6 {
  font-size: 100%;
  margin: 2em 0 0 0;
  font-weight: bold;
  line-height: 1.0;
  font-style: italic;
}
.rendered_html h1:first-child {
  margin-top: 0.538em;
}
.rendered_html h2:first-child {
  margin-top: 0.636em;
}
.rendered_html h3:first-child {
  margin-top: 0.777em;
}
.rendered_html h4:first-child {
  margin-top: 1em;
}
.rendered_html h5:first-child {
  margin-top: 1em;
}
.rendered_html h6:first-child {
  margin-top: 1em;
}
.rendered_html ul:not(.list-inline),
.rendered_html ol:not(.list-inline) {
  padding-left: 2em;
}
.rendered_html ul {
  list-style: disc;
}
.rendered_html ul ul {
  list-style: square;
  margin-top: 0;
}
.rendered_html ul ul ul {
  list-style: circle;
}
.rendered_html ol {
  list-style: decimal;
}
.rendered_html ol ol {
  list-style: upper-alpha;
  margin-top: 0;
}
.rendered_html ol ol ol {
  list-style: lower-alpha;
}
.rendered_html ol ol ol ol {
  list-style: lower-roman;
}
.rendered_html ol ol ol ol ol {
  list-style: decimal;
}
.rendered_html * + ul {
  margin-top: 1em;
}
.rendered_html * + ol {
  margin-top: 1em;
}
.rendered_html hr {
  color: black;
  background-color: black;
}
.rendered_html pre {
  margin: 1em 2em;
  padding: 0px;
  background-color: #fff;
}
.rendered_html code {
  background-color: #eff0f1;
}
.rendered_html p code {
  padding: 1px 5px;
}
.rendered_html pre code {
  background-color: #fff;
}
.rendered_html pre,
.rendered_html code {
  border: 0;
  color: #000;
  font-size: 100%;
}
.rendered_html blockquote {
  margin: 1em 2em;
}
.rendered_html table {
  margin-left: auto;
  margin-right: auto;
  border: none;
  border-collapse: collapse;
  border-spacing: 0;
  color: black;
  font-size: 12px;
  table-layout: fixed;
}
.rendered_html thead {
  border-bottom: 1px solid black;
  vertical-align: bottom;
}
.rendered_html tr,
.rendered_html th,
.rendered_html td {
  text-align: right;
  vertical-align: middle;
  padding: 0.5em 0.5em;
  line-height: normal;
  white-space: normal;
  max-width: none;
  border: none;
}
.rendered_html th {
  font-weight: bold;
}
.rendered_html tbody tr:nth-child(odd) {
  background: #f5f5f5;
}
.rendered_html tbody tr:hover {
  background: rgba(66, 165, 245, 0.2);
}
.rendered_html * + table {
  margin-top: 1em;
}
.rendered_html p {
  text-align: left;
}
.rendered_html * + p {
  margin-top: 1em;
}
.rendered_html img {
  display: block;
  margin-left: auto;
  margin-right: auto;
}
.rendered_html * + img {
  margin-top: 1em;
}
.rendered_html img,
.rendered_html svg {
  max-width: 100%;
  height: auto;
}
.rendered_html img.unconfined,
.rendered_html svg.unconfined {
  max-width: none;
}
.rendered_html .alert {
  margin-bottom: initial;
}
.rendered_html * + .alert {
  margin-top: 1em;
}
[dir="rtl"] .rendered_html p {
  text-align: right;
}
div.text_cell {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
}
@media (max-width: 540px) {
  div.text_cell > div.prompt {
    display: none;
  }
}
div.text_cell_render {
  /*font-family: "Helvetica Neue", Arial, Helvetica, Geneva, sans-serif;*/
  outline: none;
  resize: none;
  width: inherit;
  border-style: none;
  padding: 0.5em 0.5em 0.5em 0.4em;
  color: #000;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
a.anchor-link:link {
  text-decoration: none;
  padding: 0px 20px;
  visibility: hidden;
}
h1:hover .anchor-link,
h2:hover .anchor-link,
h3:hover .anchor-link,
h4:hover .anchor-link,
h5:hover .anchor-link,
h6:hover .anchor-link {
  visibility: visible;
}
.text_cell.rendered .input_area {
  display: none;
}
.text_cell.rendered .rendered_html {
  overflow-x: auto;
  overflow-y: hidden;
}
.text_cell.rendered .rendered_html tr,
.text_cell.rendered .rendered_html th,
.text_cell.rendered .rendered_html td {
  max-width: none;
}
.text_cell.unrendered .text_cell_render {
  display: none;
}
.text_cell .dropzone .input_area {
  border: 2px dashed #bababa;
  margin: -1px;
}
.cm-header-1,
.cm-header-2,
.cm-header-3,
.cm-header-4,
.cm-header-5,
.cm-header-6 {
  font-weight: bold;
  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
}
.cm-header-1 {
  font-size: 185.7%;
}
.cm-header-2 {
  font-size: 157.1%;
}
.cm-header-3 {
  font-size: 128.6%;
}
.cm-header-4 {
  font-size: 110%;
}
.cm-header-5 {
  font-size: 100%;
  font-style: italic;
}
.cm-header-6 {
  font-size: 100%;
  font-style: italic;
}
/*!
*
* IPython notebook webapp
*
*/
@media (max-width: 767px) {
  .notebook_app {
    padding-left: 0px;
    padding-right: 0px;
  }
}
#ipython-main-app {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook_panel {
  margin: 0px;
  padding: 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  height: 100%;
}
div#notebook {
  font-size: 14px;
  line-height: 20px;
  overflow-y: hidden;
  overflow-x: auto;
  width: 100%;
  /* This spaces the page away from the edge of the notebook area */
  padding-top: 20px;
  margin: 0px;
  outline: none;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  min-height: 100%;
}
@media not print {
  #notebook-container {
    padding: 15px;
    background-color: #fff;
    min-height: 0;
    -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
    box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  }
}
@media print {
  #notebook-container {
    width: 100%;
  }
}
div.ui-widget-content {
  border: 1px solid #ababab;
  outline: none;
}
pre.dialog {
  background-color: #f7f7f7;
  border: 1px solid #ddd;
  border-radius: 2px;
  padding: 0.4em;
  padding-left: 2em;
}
p.dialog {
  padding: 0.2em;
}
/* Word-wrap output correctly.  This is the CSS3 spelling, though Firefox seems
   to not honor it correctly.  Webkit browsers (Chrome, rekonq, Safari) do.
 */
pre,
code,
kbd,
samp {
  white-space: pre-wrap;
}
#fonttest {
  font-family: monospace;
}
p {
  margin-bottom: 0;
}
.end_space {
  min-height: 100px;
  transition: height .2s ease;
}
.notebook_app > #header {
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
@media not print {
  .notebook_app {
    background-color: #EEE;
  }
}
kbd {
  border-style: solid;
  border-width: 1px;
  box-shadow: none;
  margin: 2px;
  padding-left: 2px;
  padding-right: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
.jupyter-keybindings {
  padding: 1px;
  line-height: 24px;
  border-bottom: 1px solid gray;
}
.jupyter-keybindings input {
  margin: 0;
  padding: 0;
  border: none;
}
.jupyter-keybindings i {
  padding: 6px;
}
.well code {
  background-color: #ffffff;
  border-color: #ababab;
  border-width: 1px;
  border-style: solid;
  padding: 2px;
  padding-top: 1px;
  padding-bottom: 1px;
}
/* CSS for the cell toolbar */
.celltoolbar {
  border: thin solid #CFCFCF;
  border-bottom: none;
  background: #EEE;
  border-radius: 2px 2px 0px 0px;
  width: 100%;
  height: 29px;
  padding-right: 4px;
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  /* Old browsers */
  -webkit-box-pack: end;
  -moz-box-pack: end;
  box-pack: end;
  /* Modern browsers */
  justify-content: flex-end;
  display: -webkit-flex;
}
@media print {
  .celltoolbar {
    display: none;
  }
}
.ctb_hideshow {
  display: none;
  vertical-align: bottom;
}
/* ctb_show is added to the ctb_hideshow div to show the cell toolbar.
   Cell toolbars are only shown when the ctb_global_show class is also set.
*/
.ctb_global_show .ctb_show.ctb_hideshow {
  display: block;
}
.ctb_global_show .ctb_show + .input_area,
.ctb_global_show .ctb_show + div.text_cell_input,
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border-top-right-radius: 0px;
  border-top-left-radius: 0px;
}
.ctb_global_show .ctb_show ~ div.text_cell_render {
  border: 1px solid #cfcfcf;
}
.celltoolbar {
  font-size: 87%;
  padding-top: 3px;
}
.celltoolbar select {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  width: inherit;
  font-size: inherit;
  height: 22px;
  padding: 0px;
  display: inline-block;
}
.celltoolbar select:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.celltoolbar select::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.celltoolbar select:-ms-input-placeholder {
  color: #999;
}
.celltoolbar select::-webkit-input-placeholder {
  color: #999;
}
.celltoolbar select::-ms-expand {
  border: 0;
  background-color: transparent;
}
.celltoolbar select[disabled],
.celltoolbar select[readonly],
fieldset[disabled] .celltoolbar select {
  background-color: #eeeeee;
  opacity: 1;
}
.celltoolbar select[disabled],
fieldset[disabled] .celltoolbar select {
  cursor: not-allowed;
}
textarea.celltoolbar select {
  height: auto;
}
select.celltoolbar select {
  height: 30px;
  line-height: 30px;
}
textarea.celltoolbar select,
select[multiple].celltoolbar select {
  height: auto;
}
.celltoolbar label {
  margin-left: 5px;
  margin-right: 5px;
}
.tags_button_container {
  width: 100%;
  display: flex;
}
.tag-container {
  display: flex;
  flex-direction: row;
  flex-grow: 1;
  overflow: hidden;
  position: relative;
}
.tag-container > * {
  margin: 0 4px;
}
.remove-tag-btn {
  margin-left: 4px;
}
.tags-input {
  display: flex;
}
.cell-tag:last-child:after {
  content: "";
  position: absolute;
  right: 0;
  width: 40px;
  height: 100%;
  /* Fade to background color of cell toolbar */
  background: linear-gradient(to right, rgba(0, 0, 0, 0), #EEE);
}
.tags-input > * {
  margin-left: 4px;
}
.cell-tag,
.tags-input input,
.tags-input button {
  display: block;
  width: 100%;
  height: 32px;
  padding: 6px 12px;
  font-size: 13px;
  line-height: 1.42857143;
  color: #555555;
  background-color: #fff;
  background-image: none;
  border: 1px solid #ccc;
  border-radius: 2px;
  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);
  -webkit-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  -o-transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  transition: border-color ease-in-out .15s, box-shadow ease-in-out .15s;
  height: 30px;
  padding: 5px 10px;
  font-size: 12px;
  line-height: 1.5;
  border-radius: 1px;
  box-shadow: none;
  width: inherit;
  font-size: inherit;
  height: 22px;
  line-height: 22px;
  padding: 0px 4px;
  display: inline-block;
}
.cell-tag:focus,
.tags-input input:focus,
.tags-input button:focus {
  border-color: #66afe9;
  outline: 0;
  -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
  box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(102, 175, 233, 0.6);
}
.cell-tag::-moz-placeholder,
.tags-input input::-moz-placeholder,
.tags-input button::-moz-placeholder {
  color: #999;
  opacity: 1;
}
.cell-tag:-ms-input-placeholder,
.tags-input input:-ms-input-placeholder,
.tags-input button:-ms-input-placeholder {
  color: #999;
}
.cell-tag::-webkit-input-placeholder,
.tags-input input::-webkit-input-placeholder,
.tags-input button::-webkit-input-placeholder {
  color: #999;
}
.cell-tag::-ms-expand,
.tags-input input::-ms-expand,
.tags-input button::-ms-expand {
  border: 0;
  background-color: transparent;
}
.cell-tag[disabled],
.tags-input input[disabled],
.tags-input button[disabled],
.cell-tag[readonly],
.tags-input input[readonly],
.tags-input button[readonly],
fieldset[disabled] .cell-tag,
fieldset[disabled] .tags-input input,
fieldset[disabled] .tags-input button {
  background-color: #eeeeee;
  opacity: 1;
}
.cell-tag[disabled],
.tags-input input[disabled],
.tags-input button[disabled],
fieldset[disabled] .cell-tag,
fieldset[disabled] .tags-input input,
fieldset[disabled] .tags-input button {
  cursor: not-allowed;
}
textarea.cell-tag,
textarea.tags-input input,
textarea.tags-input button {
  height: auto;
}
select.cell-tag,
select.tags-input input,
select.tags-input button {
  height: 30px;
  line-height: 30px;
}
textarea.cell-tag,
textarea.tags-input input,
textarea.tags-input button,
select[multiple].cell-tag,
select[multiple].tags-input input,
select[multiple].tags-input button {
  height: auto;
}
.cell-tag,
.tags-input button {
  padding: 0px 4px;
}
.cell-tag {
  background-color: #fff;
  white-space: nowrap;
}
.tags-input input[type=text]:focus {
  outline: none;
  box-shadow: none;
  border-color: #ccc;
}
.completions {
  position: absolute;
  z-index: 110;
  overflow: hidden;
  border: 1px solid #ababab;
  border-radius: 2px;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  line-height: 1;
}
.completions select {
  background: white;
  outline: none;
  border: none;
  padding: 0px;
  margin: 0px;
  overflow: auto;
  font-family: monospace;
  font-size: 110%;
  color: #000;
  width: auto;
}
.completions select option.context {
  color: #286090;
}
#kernel_logo_widget .current_kernel_logo {
  display: none;
  margin-top: -1px;
  margin-bottom: -1px;
  width: 32px;
  height: 32px;
}
[dir="rtl"] #kernel_logo_widget {
  float: left !important;
  float: left;
}
.modal .modal-body .move-path {
  display: flex;
  flex-direction: row;
  justify-content: space;
  align-items: center;
}
.modal .modal-body .move-path .server-root {
  padding-right: 20px;
}
.modal .modal-body .move-path .path-input {
  flex: 1;
}
#menubar {
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
  margin-top: 1px;
}
#menubar .navbar {
  border-top: 1px;
  border-radius: 0px 0px 2px 2px;
  margin-bottom: 0px;
}
#menubar .navbar-toggle {
  float: left;
  padding-top: 7px;
  padding-bottom: 7px;
  border: none;
}
#menubar .navbar-collapse {
  clear: left;
}
[dir="rtl"] #menubar .navbar-toggle {
  float: right;
}
[dir="rtl"] #menubar .navbar-collapse {
  clear: right;
}
[dir="rtl"] #menubar .navbar-nav {
  float: right;
}
[dir="rtl"] #menubar .nav {
  padding-right: 0px;
}
[dir="rtl"] #menubar .navbar-nav > li {
  float: right;
}
[dir="rtl"] #menubar .navbar-right {
  float: left !important;
}
[dir="rtl"] ul.dropdown-menu {
  text-align: right;
  left: auto;
}
[dir="rtl"] ul#new-menu.dropdown-menu {
  right: auto;
  left: 0;
}
.nav-wrapper {
  border-bottom: 1px solid #e7e7e7;
}
i.menu-icon {
  padding-top: 4px;
}
[dir="rtl"] i.menu-icon.pull-right {
  float: left !important;
  float: left;
}
ul#help_menu li a {
  overflow: hidden;
  padding-right: 2.2em;
}
ul#help_menu li a i {
  margin-right: -1.2em;
}
[dir="rtl"] ul#help_menu li a {
  padding-left: 2.2em;
}
[dir="rtl"] ul#help_menu li a i {
  margin-right: 0;
  margin-left: -1.2em;
}
[dir="rtl"] ul#help_menu li a i.pull-right {
  float: left !important;
  float: left;
}
.dropdown-submenu {
  position: relative;
}
.dropdown-submenu > .dropdown-menu {
  top: 0;
  left: 100%;
  margin-top: -6px;
  margin-left: -1px;
}
[dir="rtl"] .dropdown-submenu > .dropdown-menu {
  right: 100%;
  margin-right: -1px;
}
.dropdown-submenu:hover > .dropdown-menu {
  display: block;
}
.dropdown-submenu > a:after {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  display: block;
  content: "\f0da";
  float: right;
  color: #333333;
  margin-top: 2px;
  margin-right: -10px;
}
.dropdown-submenu > a:after.fa-pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.fa-pull-right {
  margin-left: .3em;
}
.dropdown-submenu > a:after.pull-left {
  margin-right: .3em;
}
.dropdown-submenu > a:after.pull-right {
  margin-left: .3em;
}
[dir="rtl"] .dropdown-submenu > a:after {
  float: left;
  content: "\f0d9";
  margin-right: 0;
  margin-left: -10px;
}
.dropdown-submenu:hover > a:after {
  color: #262626;
}
.dropdown-submenu.pull-left {
  float: none;
}
.dropdown-submenu.pull-left > .dropdown-menu {
  left: -100%;
  margin-left: 10px;
}
#notification_area {
  float: right !important;
  float: right;
  z-index: 10;
}
[dir="rtl"] #notification_area {
  float: left !important;
  float: left;
}
.indicator_area {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
[dir="rtl"] .indicator_area {
  float: left !important;
  float: left;
}
#kernel_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  border-left: 1px solid;
}
#kernel_indicator .kernel_indicator_name {
  padding-left: 5px;
  padding-right: 5px;
}
[dir="rtl"] #kernel_indicator {
  float: left !important;
  float: left;
  border-left: 0;
  border-right: 1px solid;
}
#modal_indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
}
[dir="rtl"] #modal_indicator {
  float: left !important;
  float: left;
}
#readonly-indicator {
  float: right !important;
  float: right;
  color: #777;
  margin-left: 5px;
  margin-right: 5px;
  width: 11px;
  z-index: 10;
  text-align: center;
  width: auto;
  margin-top: 2px;
  margin-bottom: 0px;
  margin-left: 0px;
  margin-right: 0px;
  display: none;
}
.modal_indicator:before {
  width: 1.28571429em;
  text-align: center;
}
.edit_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f040";
}
.edit_mode .modal_indicator:before.fa-pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.fa-pull-right {
  margin-left: .3em;
}
.edit_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.edit_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: ' ';
}
.command_mode .modal_indicator:before.fa-pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.fa-pull-right {
  margin-left: .3em;
}
.command_mode .modal_indicator:before.pull-left {
  margin-right: .3em;
}
.command_mode .modal_indicator:before.pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f10c";
}
.kernel_idle_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_idle_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_idle_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f111";
}
.kernel_busy_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_busy_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_busy_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f1e2";
}
.kernel_dead_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_dead_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_dead_icon:before.pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before {
  display: inline-block;
  font: normal normal normal 14px/1 FontAwesome;
  font-size: inherit;
  text-rendering: auto;
  -webkit-font-smoothing: antialiased;
  -moz-osx-font-smoothing: grayscale;
  content: "\f127";
}
.kernel_disconnected_icon:before.fa-pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.fa-pull-right {
  margin-left: .3em;
}
.kernel_disconnected_icon:before.pull-left {
  margin-right: .3em;
}
.kernel_disconnected_icon:before.pull-right {
  margin-left: .3em;
}
.notification_widget {
  color: #777;
  z-index: 10;
  background: rgba(240, 240, 240, 0.5);
  margin-right: 4px;
  color: #333;
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget:focus,
.notification_widget.focus {
  color: #333;
  background-color: #e6e6e6;
  border-color: #8c8c8c;
}
.notification_widget:hover {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  color: #333;
  background-color: #e6e6e6;
  border-color: #adadad;
}
.notification_widget:active:hover,
.notification_widget.active:hover,
.open > .dropdown-toggle.notification_widget:hover,
.notification_widget:active:focus,
.notification_widget.active:focus,
.open > .dropdown-toggle.notification_widget:focus,
.notification_widget:active.focus,
.notification_widget.active.focus,
.open > .dropdown-toggle.notification_widget.focus {
  color: #333;
  background-color: #d4d4d4;
  border-color: #8c8c8c;
}
.notification_widget:active,
.notification_widget.active,
.open > .dropdown-toggle.notification_widget {
  background-image: none;
}
.notification_widget.disabled:hover,
.notification_widget[disabled]:hover,
fieldset[disabled] .notification_widget:hover,
.notification_widget.disabled:focus,
.notification_widget[disabled]:focus,
fieldset[disabled] .notification_widget:focus,
.notification_widget.disabled.focus,
.notification_widget[disabled].focus,
fieldset[disabled] .notification_widget.focus {
  background-color: #fff;
  border-color: #ccc;
}
.notification_widget .badge {
  color: #fff;
  background-color: #333;
}
.notification_widget.warning {
  color: #fff;
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning:focus,
.notification_widget.warning.focus {
  color: #fff;
  background-color: #ec971f;
  border-color: #985f0d;
}
.notification_widget.warning:hover {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  color: #fff;
  background-color: #ec971f;
  border-color: #d58512;
}
.notification_widget.warning:active:hover,
.notification_widget.warning.active:hover,
.open > .dropdown-toggle.notification_widget.warning:hover,
.notification_widget.warning:active:focus,
.notification_widget.warning.active:focus,
.open > .dropdown-toggle.notification_widget.warning:focus,
.notification_widget.warning:active.focus,
.notification_widget.warning.active.focus,
.open > .dropdown-toggle.notification_widget.warning.focus {
  color: #fff;
  background-color: #d58512;
  border-color: #985f0d;
}
.notification_widget.warning:active,
.notification_widget.warning.active,
.open > .dropdown-toggle.notification_widget.warning {
  background-image: none;
}
.notification_widget.warning.disabled:hover,
.notification_widget.warning[disabled]:hover,
fieldset[disabled] .notification_widget.warning:hover,
.notification_widget.warning.disabled:focus,
.notification_widget.warning[disabled]:focus,
fieldset[disabled] .notification_widget.warning:focus,
.notification_widget.warning.disabled.focus,
.notification_widget.warning[disabled].focus,
fieldset[disabled] .notification_widget.warning.focus {
  background-color: #f0ad4e;
  border-color: #eea236;
}
.notification_widget.warning .badge {
  color: #f0ad4e;
  background-color: #fff;
}
.notification_widget.success {
  color: #fff;
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success:focus,
.notification_widget.success.focus {
  color: #fff;
  background-color: #449d44;
  border-color: #255625;
}
.notification_widget.success:hover {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  color: #fff;
  background-color: #449d44;
  border-color: #398439;
}
.notification_widget.success:active:hover,
.notification_widget.success.active:hover,
.open > .dropdown-toggle.notification_widget.success:hover,
.notification_widget.success:active:focus,
.notification_widget.success.active:focus,
.open > .dropdown-toggle.notification_widget.success:focus,
.notification_widget.success:active.focus,
.notification_widget.success.active.focus,
.open > .dropdown-toggle.notification_widget.success.focus {
  color: #fff;
  background-color: #398439;
  border-color: #255625;
}
.notification_widget.success:active,
.notification_widget.success.active,
.open > .dropdown-toggle.notification_widget.success {
  background-image: none;
}
.notification_widget.success.disabled:hover,
.notification_widget.success[disabled]:hover,
fieldset[disabled] .notification_widget.success:hover,
.notification_widget.success.disabled:focus,
.notification_widget.success[disabled]:focus,
fieldset[disabled] .notification_widget.success:focus,
.notification_widget.success.disabled.focus,
.notification_widget.success[disabled].focus,
fieldset[disabled] .notification_widget.success.focus {
  background-color: #5cb85c;
  border-color: #4cae4c;
}
.notification_widget.success .badge {
  color: #5cb85c;
  background-color: #fff;
}
.notification_widget.info {
  color: #fff;
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info:focus,
.notification_widget.info.focus {
  color: #fff;
  background-color: #31b0d5;
  border-color: #1b6d85;
}
.notification_widget.info:hover {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  color: #fff;
  background-color: #31b0d5;
  border-color: #269abc;
}
.notification_widget.info:active:hover,
.notification_widget.info.active:hover,
.open > .dropdown-toggle.notification_widget.info:hover,
.notification_widget.info:active:focus,
.notification_widget.info.active:focus,
.open > .dropdown-toggle.notification_widget.info:focus,
.notification_widget.info:active.focus,
.notification_widget.info.active.focus,
.open > .dropdown-toggle.notification_widget.info.focus {
  color: #fff;
  background-color: #269abc;
  border-color: #1b6d85;
}
.notification_widget.info:active,
.notification_widget.info.active,
.open > .dropdown-toggle.notification_widget.info {
  background-image: none;
}
.notification_widget.info.disabled:hover,
.notification_widget.info[disabled]:hover,
fieldset[disabled] .notification_widget.info:hover,
.notification_widget.info.disabled:focus,
.notification_widget.info[disabled]:focus,
fieldset[disabled] .notification_widget.info:focus,
.notification_widget.info.disabled.focus,
.notification_widget.info[disabled].focus,
fieldset[disabled] .notification_widget.info.focus {
  background-color: #5bc0de;
  border-color: #46b8da;
}
.notification_widget.info .badge {
  color: #5bc0de;
  background-color: #fff;
}
.notification_widget.danger {
  color: #fff;
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger:focus,
.notification_widget.danger.focus {
  color: #fff;
  background-color: #c9302c;
  border-color: #761c19;
}
.notification_widget.danger:hover {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  color: #fff;
  background-color: #c9302c;
  border-color: #ac2925;
}
.notification_widget.danger:active:hover,
.notification_widget.danger.active:hover,
.open > .dropdown-toggle.notification_widget.danger:hover,
.notification_widget.danger:active:focus,
.notification_widget.danger.active:focus,
.open > .dropdown-toggle.notification_widget.danger:focus,
.notification_widget.danger:active.focus,
.notification_widget.danger.active.focus,
.open > .dropdown-toggle.notification_widget.danger.focus {
  color: #fff;
  background-color: #ac2925;
  border-color: #761c19;
}
.notification_widget.danger:active,
.notification_widget.danger.active,
.open > .dropdown-toggle.notification_widget.danger {
  background-image: none;
}
.notification_widget.danger.disabled:hover,
.notification_widget.danger[disabled]:hover,
fieldset[disabled] .notification_widget.danger:hover,
.notification_widget.danger.disabled:focus,
.notification_widget.danger[disabled]:focus,
fieldset[disabled] .notification_widget.danger:focus,
.notification_widget.danger.disabled.focus,
.notification_widget.danger[disabled].focus,
fieldset[disabled] .notification_widget.danger.focus {
  background-color: #d9534f;
  border-color: #d43f3a;
}
.notification_widget.danger .badge {
  color: #d9534f;
  background-color: #fff;
}
div#pager {
  background-color: #fff;
  font-size: 14px;
  line-height: 20px;
  overflow: hidden;
  display: none;
  position: fixed;
  bottom: 0px;
  width: 100%;
  max-height: 50%;
  padding-top: 8px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  /* Display over codemirror */
  z-index: 100;
  /* Hack which prevents jquery ui resizable from changing top. */
  top: auto !important;
}
div#pager pre {
  line-height: 1.21429em;
  color: #000;
  background-color: #f7f7f7;
  padding: 0.4em;
}
div#pager #pager-button-area {
  position: absolute;
  top: 8px;
  right: 20px;
}
div#pager #pager-contents {
  position: relative;
  overflow: auto;
  width: 100%;
  height: 100%;
}
div#pager #pager-contents #pager-container {
  position: relative;
  padding: 15px 0px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
div#pager .ui-resizable-handle {
  top: 0px;
  height: 8px;
  background: #f7f7f7;
  border-top: 1px solid #cfcfcf;
  border-bottom: 1px solid #cfcfcf;
  /* This injects handle bars (a short, wide = symbol) for 
        the resize handle. */
}
div#pager .ui-resizable-handle::after {
  content: '';
  top: 2px;
  left: 50%;
  height: 3px;
  width: 30px;
  margin-left: -15px;
  position: absolute;
  border-top: 1px solid #cfcfcf;
}
.quickhelp {
  /* Old browsers */
  display: -webkit-box;
  -webkit-box-orient: horizontal;
  -webkit-box-align: stretch;
  display: -moz-box;
  -moz-box-orient: horizontal;
  -moz-box-align: stretch;
  display: box;
  box-orient: horizontal;
  box-align: stretch;
  /* Modern browsers */
  display: flex;
  flex-direction: row;
  align-items: stretch;
  line-height: 1.8em;
}
.shortcut_key {
  display: inline-block;
  width: 21ex;
  text-align: right;
  font-family: monospace;
}
.shortcut_descr {
  display: inline-block;
  /* Old browsers */
  -webkit-box-flex: 1;
  -moz-box-flex: 1;
  box-flex: 1;
  /* Modern browsers */
  flex: 1;
}
span.save_widget {
  height: 30px;
  margin-top: 4px;
  display: flex;
  justify-content: flex-start;
  align-items: baseline;
  width: 50%;
  flex: 1;
}
span.save_widget span.filename {
  height: 100%;
  line-height: 1em;
  margin-left: 16px;
  border: none;
  font-size: 146.5%;
  text-overflow: ellipsis;
  overflow: hidden;
  white-space: nowrap;
  border-radius: 2px;
}
span.save_widget span.filename:hover {
  background-color: #e6e6e6;
}
[dir="rtl"] span.save_widget.pull-left {
  float: right !important;
  float: right;
}
[dir="rtl"] span.save_widget span.filename {
  margin-left: 0;
  margin-right: 16px;
}
span.checkpoint_status,
span.autosave_status {
  font-size: small;
  white-space: nowrap;
  padding: 0 5px;
}
@media (max-width: 767px) {
  span.save_widget {
    font-size: small;
    padding: 0 0 0 5px;
  }
  span.checkpoint_status,
  span.autosave_status {
    display: none;
  }
}
@media (min-width: 768px) and (max-width: 991px) {
  span.checkpoint_status {
    display: none;
  }
  span.autosave_status {
    font-size: x-small;
  }
}
.toolbar {
  padding: 0px;
  margin-left: -5px;
  margin-top: 2px;
  margin-bottom: 5px;
  box-sizing: border-box;
  -moz-box-sizing: border-box;
  -webkit-box-sizing: border-box;
}
.toolbar select,
.toolbar label {
  width: auto;
  vertical-align: middle;
  margin-right: 2px;
  margin-bottom: 0px;
  display: inline;
  font-size: 92%;
  margin-left: 0.3em;
  margin-right: 0.3em;
  padding: 0px;
  padding-top: 3px;
}
.toolbar .btn {
  padding: 2px 8px;
}
.toolbar .btn-group {
  margin-top: 0px;
  margin-left: 5px;
}
.toolbar-btn-label {
  margin-left: 6px;
}
#maintoolbar {
  margin-bottom: -3px;
  margin-top: -8px;
  border: 0px;
  min-height: 27px;
  margin-left: 0px;
  padding-top: 11px;
  padding-bottom: 3px;
}
#maintoolbar .navbar-text {
  float: none;
  vertical-align: middle;
  text-align: right;
  margin-left: 5px;
  margin-right: 0px;
  margin-top: 0px;
}
.select-xs {
  height: 24px;
}
[dir="rtl"] .btn-group > .btn,
.btn-group-vertical > .btn {
  float: right;
}
.pulse,
.dropdown-menu > li > a.pulse,
li.pulse > a.dropdown-toggle,
li.pulse.open > a.dropdown-toggle {
  background-color: #F37626;
  color: white;
}
/**
 * Primary styles
 *
 * Author: Jupyter Development Team
 */
/** WARNING IF YOU ARE EDITTING THIS FILE, if this is a .css file, It has a lot
 * of chance of beeing generated from the ../less/[samename].less file, you can
 * try to get back the less file by reverting somme commit in history
 **/
/*
 * We'll try to get something pretty, so we
 * have some strange css to have the scroll bar on
 * the left with fix button on the top right of the tooltip
 */
@-moz-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-webkit-keyframes fadeOut {
  from {
    opacity: 1;
  }
  to {
    opacity: 0;
  }
}
@-moz-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
@-webkit-keyframes fadeIn {
  from {
    opacity: 0;
  }
  to {
    opacity: 1;
  }
}
/*properties of tooltip after "expand"*/
.bigtooltip {
  overflow: auto;
  height: 200px;
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
}
/*properties of tooltip before "expand"*/
.smalltooltip {
  -webkit-transition-property: height;
  -webkit-transition-duration: 500ms;
  -moz-transition-property: height;
  -moz-transition-duration: 500ms;
  transition-property: height;
  transition-duration: 500ms;
  text-overflow: ellipsis;
  overflow: hidden;
  height: 80px;
}
.tooltipbuttons {
  position: absolute;
  padding-right: 15px;
  top: 0px;
  right: 0px;
}
.tooltiptext {
  /*avoid the button to overlap on some docstring*/
  padding-right: 30px;
}
.ipython_tooltip {
  max-width: 700px;
  /*fade-in animation when inserted*/
  -webkit-animation: fadeOut 400ms;
  -moz-animation: fadeOut 400ms;
  animation: fadeOut 400ms;
  -webkit-animation: fadeIn 400ms;
  -moz-animation: fadeIn 400ms;
  animation: fadeIn 400ms;
  vertical-align: middle;
  background-color: #f7f7f7;
  overflow: visible;
  border: #ababab 1px solid;
  outline: none;
  padding: 3px;
  margin: 0px;
  padding-left: 7px;
  font-family: monospace;
  min-height: 50px;
  -moz-box-shadow: 0px 6px 10px -1px #adadad;
  -webkit-box-shadow: 0px 6px 10px -1px #adadad;
  box-shadow: 0px 6px 10px -1px #adadad;
  border-radius: 2px;
  position: absolute;
  z-index: 1000;
}
.ipython_tooltip a {
  float: right;
}
.ipython_tooltip .tooltiptext pre {
  border: 0;
  border-radius: 0;
  font-size: 100%;
  background-color: #f7f7f7;
}
.pretooltiparrow {
  left: 0px;
  margin: 0px;
  top: -16px;
  width: 40px;
  height: 16px;
  overflow: hidden;
  position: absolute;
}
.pretooltiparrow:before {
  background-color: #f7f7f7;
  border: 1px #ababab solid;
  z-index: 11;
  content: "";
  position: absolute;
  left: 15px;
  top: 10px;
  width: 25px;
  height: 25px;
  -webkit-transform: rotate(45deg);
  -moz-transform: rotate(45deg);
  -ms-transform: rotate(45deg);
  -o-transform: rotate(45deg);
}
ul.typeahead-list i {
  margin-left: -10px;
  width: 18px;
}
[dir="rtl"] ul.typeahead-list i {
  margin-left: 0;
  margin-right: -10px;
}
ul.typeahead-list {
  max-height: 80vh;
  overflow: auto;
}
ul.typeahead-list > li > a {
  /** Firefox bug **/
  /* see https://github.com/jupyter/notebook/issues/559 */
  white-space: normal;
}
ul.typeahead-list  > li > a.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .typeahead-list {
  text-align: right;
}
.cmd-palette .modal-body {
  padding: 7px;
}
.cmd-palette form {
  background: white;
}
.cmd-palette input {
  outline: none;
}
.no-shortcut {
  min-width: 20px;
  color: transparent;
}
[dir="rtl"] .no-shortcut.pull-right {
  float: left !important;
  float: left;
}
[dir="rtl"] .command-shortcut.pull-right {
  float: left !important;
  float: left;
}
.command-shortcut:before {
  content: "(command mode)";
  padding-right: 3px;
  color: #777777;
}
.edit-shortcut:before {
  content: "(edit)";
  padding-right: 3px;
  color: #777777;
}
[dir="rtl"] .edit-shortcut.pull-right {
  float: left !important;
  float: left;
}
#find-and-replace #replace-preview .match,
#find-and-replace #replace-preview .insert {
  background-color: #BBDEFB;
  border-color: #90CAF9;
  border-style: solid;
  border-width: 1px;
  border-radius: 0px;
}
[dir="ltr"] #find-and-replace .input-group-btn + .form-control {
  border-left: none;
}
[dir="rtl"] #find-and-replace .input-group-btn + .form-control {
  border-right: none;
}
#find-and-replace #replace-preview .replace .match {
  background-color: #FFCDD2;
  border-color: #EF9A9A;
  border-radius: 0px;
}
#find-and-replace #replace-preview .replace .insert {
  background-color: #C8E6C9;
  border-color: #A5D6A7;
  border-radius: 0px;
}
#find-and-replace #replace-preview {
  max-height: 60vh;
  overflow: auto;
}
#find-and-replace #replace-preview pre {
  padding: 5px 10px;
}
.terminal-app {
  background: #EEE;
}
.terminal-app #header {
  background: #fff;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.2);
}
.terminal-app .terminal {
  width: 100%;
  float: left;
  font-family: monospace;
  color: white;
  background: black;
  padding: 0.4em;
  border-radius: 2px;
  -webkit-box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
  box-shadow: 0px 0px 12px 1px rgba(87, 87, 87, 0.4);
}
.terminal-app .terminal,
.terminal-app .terminal dummy-screen {
  line-height: 1em;
  font-size: 14px;
}
.terminal-app .terminal .xterm-rows {
  padding: 10px;
}
.terminal-app .terminal-cursor {
  color: black;
  background: white;
}
.terminal-app #terminado-container {
  margin-top: 20px;
}
/*# sourceMappingURL=style.min.css.map */
    </style>
<style type="text/css">
    .highlight .hll { background-color: #ffffcc }
.highlight  { background: #f8f8f8; }
.highlight .c { color: #408080; font-style: italic } /* Comment */
.highlight .err { border: 1px solid #FF0000 } /* Error */
.highlight .k { color: #008000; font-weight: bold } /* Keyword */
.highlight .o { color: #666666 } /* Operator */
.highlight .ch { color: #408080; font-style: italic } /* Comment.Hashbang */
.highlight .cm { color: #408080; font-style: italic } /* Comment.Multiline */
.highlight .cp { color: #BC7A00 } /* Comment.Preproc */
.highlight .cpf { color: #408080; font-style: italic } /* Comment.PreprocFile */
.highlight .c1 { color: #408080; font-style: italic } /* Comment.Single */
.highlight .cs { color: #408080; font-style: italic } /* Comment.Special */
.highlight .gd { color: #A00000 } /* Generic.Deleted */
.highlight .ge { font-style: italic } /* Generic.Emph */
.highlight .gr { color: #FF0000 } /* Generic.Error */
.highlight .gh { color: #000080; font-weight: bold } /* Generic.Heading */
.highlight .gi { color: #00A000 } /* Generic.Inserted */
.highlight .go { color: #888888 } /* Generic.Output */
.highlight .gp { color: #000080; font-weight: bold } /* Generic.Prompt */
.highlight .gs { font-weight: bold } /* Generic.Strong */
.highlight .gu { color: #800080; font-weight: bold } /* Generic.Subheading */
.highlight .gt { color: #0044DD } /* Generic.Traceback */
.highlight .kc { color: #008000; font-weight: bold } /* Keyword.Constant */
.highlight .kd { color: #008000; font-weight: bold } /* Keyword.Declaration */
.highlight .kn { color: #008000; font-weight: bold } /* Keyword.Namespace */
.highlight .kp { color: #008000 } /* Keyword.Pseudo */
.highlight .kr { color: #008000; font-weight: bold } /* Keyword.Reserved */
.highlight .kt { color: #B00040 } /* Keyword.Type */
.highlight .m { color: #666666 } /* Literal.Number */
.highlight .s { color: #BA2121 } /* Literal.String */
.highlight .na { color: #7D9029 } /* Name.Attribute */
.highlight .nb { color: #008000 } /* Name.Builtin */
.highlight .nc { color: #0000FF; font-weight: bold } /* Name.Class */
.highlight .no { color: #880000 } /* Name.Constant */
.highlight .nd { color: #AA22FF } /* Name.Decorator */
.highlight .ni { color: #999999; font-weight: bold } /* Name.Entity */
.highlight .ne { color: #D2413A; font-weight: bold } /* Name.Exception */
.highlight .nf { color: #0000FF } /* Name.Function */
.highlight .nl { color: #A0A000 } /* Name.Label */
.highlight .nn { color: #0000FF; font-weight: bold } /* Name.Namespace */
.highlight .nt { color: #008000; font-weight: bold } /* Name.Tag */
.highlight .nv { color: #19177C } /* Name.Variable */
.highlight .ow { color: #AA22FF; font-weight: bold } /* Operator.Word */
.highlight .w { color: #bbbbbb } /* Text.Whitespace */
.highlight .mb { color: #666666 } /* Literal.Number.Bin */
.highlight .mf { color: #666666 } /* Literal.Number.Float */
.highlight .mh { color: #666666 } /* Literal.Number.Hex */
.highlight .mi { color: #666666 } /* Literal.Number.Integer */
.highlight .mo { color: #666666 } /* Literal.Number.Oct */
.highlight .sa { color: #BA2121 } /* Literal.String.Affix */
.highlight .sb { color: #BA2121 } /* Literal.String.Backtick */
.highlight .sc { color: #BA2121 } /* Literal.String.Char */
.highlight .dl { color: #BA2121 } /* Literal.String.Delimiter */
.highlight .sd { color: #BA2121; font-style: italic } /* Literal.String.Doc */
.highlight .s2 { color: #BA2121 } /* Literal.String.Double */
.highlight .se { color: #BB6622; font-weight: bold } /* Literal.String.Escape */
.highlight .sh { color: #BA2121 } /* Literal.String.Heredoc */
.highlight .si { color: #BB6688; font-weight: bold } /* Literal.String.Interpol */
.highlight .sx { color: #008000 } /* Literal.String.Other */
.highlight .sr { color: #BB6688 } /* Literal.String.Regex */
.highlight .s1 { color: #BA2121 } /* Literal.String.Single */
.highlight .ss { color: #19177C } /* Literal.String.Symbol */
.highlight .bp { color: #008000 } /* Name.Builtin.Pseudo */
.highlight .fm { color: #0000FF } /* Name.Function.Magic */
.highlight .vc { color: #19177C } /* Name.Variable.Class */
.highlight .vg { color: #19177C } /* Name.Variable.Global */
.highlight .vi { color: #19177C } /* Name.Variable.Instance */
.highlight .vm { color: #19177C } /* Name.Variable.Magic */
.highlight .il { color: #666666 } /* Literal.Number.Integer.Long */
    </style>
<style type="text/css">
    
/* Temporary definitions which will become obsolete with Notebook release 5.0 */
.ansi-black-fg { color: #3E424D; }
.ansi-black-bg { background-color: #3E424D; }
.ansi-black-intense-fg { color: #282C36; }
.ansi-black-intense-bg { background-color: #282C36; }
.ansi-red-fg { color: #E75C58; }
.ansi-red-bg { background-color: #E75C58; }
.ansi-red-intense-fg { color: #B22B31; }
.ansi-red-intense-bg { background-color: #B22B31; }
.ansi-green-fg { color: #00A250; }
.ansi-green-bg { background-color: #00A250; }
.ansi-green-intense-fg { color: #007427; }
.ansi-green-intense-bg { background-color: #007427; }
.ansi-yellow-fg { color: #DDB62B; }
.ansi-yellow-bg { background-color: #DDB62B; }
.ansi-yellow-intense-fg { color: #B27D12; }
.ansi-yellow-intense-bg { background-color: #B27D12; }
.ansi-blue-fg { color: #208FFB; }
.ansi-blue-bg { background-color: #208FFB; }
.ansi-blue-intense-fg { color: #0065CA; }
.ansi-blue-intense-bg { background-color: #0065CA; }
.ansi-magenta-fg { color: #D160C4; }
.ansi-magenta-bg { background-color: #D160C4; }
.ansi-magenta-intense-fg { color: #A03196; }
.ansi-magenta-intense-bg { background-color: #A03196; }
.ansi-cyan-fg { color: #60C6C8; }
.ansi-cyan-bg { background-color: #60C6C8; }
.ansi-cyan-intense-fg { color: #258F8F; }
.ansi-cyan-intense-bg { background-color: #258F8F; }
.ansi-white-fg { color: #C5C1B4; }
.ansi-white-bg { background-color: #C5C1B4; }
.ansi-white-intense-fg { color: #A1A6B2; }
.ansi-white-intense-bg { background-color: #A1A6B2; }

.ansi-bold { font-weight: bold; }

    </style>


<style type="text/css">
/* Overrides of notebook CSS for static HTML export */
body {
  overflow: visible;
  padding: 8px;
}

div#notebook {
  overflow: visible;
  border-top: none;
}@media print {
  div.cell {
    display: block;
    page-break-inside: avoid;
  } 
  div.output_wrapper { 
    display: block;
    page-break-inside: avoid; 
  }
  div.output { 
    display: block;
    page-break-inside: avoid; 
  }
}
</style>

<!-- Custom stylesheet, it must be in the same directory as the html file -->
<link rel="stylesheet" href="custom.css">

<!-- Loading mathjax macro -->
<!-- Load mathjax -->
    <script src="https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.1/MathJax.js?config=TeX-AMS_HTML"></script>
    <!-- MathJax configuration -->
    <script type="text/x-mathjax-config">
    MathJax.Hub.Config({
        tex2jax: {
            inlineMath: [ ['$','$'], ["\\(","\\)"] ],
            displayMath: [ ['$$','$$'], ["\\[","\\]"] ],
            processEscapes: true,
            processEnvironments: true
        },
        // Center justify equations in code and markdown cells. Elsewhere
        // we use CSS to left justify single line equations in code cells.
        displayAlign: 'center',
        "HTML-CSS": {
            styles: {'.MathJax_Display': {"margin": 0}},
            linebreaks: { automatic: true }
        }
    });
    </script>
    <!-- End of mathjax configuration --></head>
<body>
  <div tabindex="-1" id="notebook" class="border-box-sizing">
    <div class="container" id="notebook-container">

<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="&#928;&#961;&#959;&#947;&#961;&#945;&#956;&#956;&#945;&#964;&#953;&#963;&#956;&#972;&#962;-&#956;&#949;-&#964;&#951;-&#947;&#955;&#974;&#963;&#963;&#945;-python">&#928;&#961;&#959;&#947;&#961;&#945;&#956;&#956;&#945;&#964;&#953;&#963;&#956;&#972;&#962; &#956;&#949; &#964;&#951; &#947;&#955;&#974;&#963;&#963;&#945; python<a class="anchor-link" href="#&#928;&#961;&#959;&#947;&#961;&#945;&#956;&#956;&#945;&#964;&#953;&#963;&#956;&#972;&#962;-&#956;&#949;-&#964;&#951;-&#947;&#955;&#974;&#963;&#963;&#945;-python">&#182;</a></h2><h3 id="Alexandros-Kanterakis-kantale@ics.forth.gr">Alexandros Kanterakis <a href="mailto:kantale@ics.forth.gr">kantale@ics.forth.gr</a><a class="anchor-link" href="#Alexandros-Kanterakis-kantale@ics.forth.gr">&#182;</a></h3><h3 id="&#916;&#953;&#940;&#955;&#949;&#958;&#951;-12&#951;,-&#928;&#945;&#961;&#945;&#963;&#954;&#949;&#965;&#942;-26-&#921;&#945;&#957;&#959;&#965;&#945;&#961;&#943;&#959;&#965;-2018">&#916;&#953;&#940;&#955;&#949;&#958;&#951; 12&#951;, &#928;&#945;&#961;&#945;&#963;&#954;&#949;&#965;&#942; 26 &#921;&#945;&#957;&#959;&#965;&#945;&#961;&#943;&#959;&#965; 2018<a class="anchor-link" href="#&#916;&#953;&#940;&#955;&#949;&#958;&#951;-12&#951;,-&#928;&#945;&#961;&#945;&#963;&#954;&#949;&#965;&#942;-26-&#921;&#945;&#957;&#959;&#965;&#945;&#961;&#943;&#959;&#965;-2018">&#182;</a></h3>
</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Σκοπός αυτής της διάλεξης είναι η εισαγωγή σε μεθόδους για να προσπελαύνουμε υπάρχοντες online βάσεις δεδομένων οι οποίες περιέχουν γενετικές-βιολογικές πληροφορίες.</p>
<p>Καταρχήν πρέπει να αναφέρουμε ότι υπάρχουν χιλιάδες τέτοιες βάσεις οι οποίες περιέχουν πληροφορίες για όλες τις μορφές των -omics data. Μία πολύ καλή λίστα βρίσκεται εδώ: <a href="https://www.oxfordjournals.org/nar/database/a/">https://www.oxfordjournals.org/nar/database/a/</a> (προφανώς και η λίστα δεν είναι πλήρης).</p>
<p>Πως λοιπόν μπορούμε προγραμματιστικά να προσπελάσουμε αυτές τις βάσεις;</p>
<h3 id="HTTP-GET-and-POST-requests">HTTP GET and POST requests<a class="anchor-link" href="#HTTP-GET-and-POST-requests">&#182;</a></h3><p>Πριν απαντήσουμε σε αυτό πρέπει να πούμε κάποια βασικά στοιχεία για το <a href="https://en.wikipedia.org/wiki/Hypertext_Transfer_Protocol">HTTP</a> πρωτόκολλο. Το HTTP είναι ένα πρωτόκολλο που καθορίζει πως δύο υπολογιστές μπορούν να επικοινωνήσουν ώστε ο ένας να "πάρει" κάποια πληροφορία από τον άλλο. Αυτή η "πληροφορία" είναι συνήθως μία HTML σελίδα, αλλά μπορεί να είναι και οποιαδίποτε άλλη μορφή πληροφορίας. Μία πηγή πληροφορίας ορίζεται σύμφωνα με το HTTP ως ένα URL ή αλλιώς ένα link. π.χ: <a href="http://bioinfo-grad.gr/eclass/">http://bioinfo-grad.gr/eclass/</a>.</p>
<p>Ένας υπολογιστής που "ζητάει" πληροφορία συνήθως αναφέρεται ως "client" ενώ ένας υπολογιστής που μπορεί να τη δώσει ονομάζεται ως server. Ένας client για να "ζητήσει" πληροφορία από τον "server" πρέπει να ξέρει το URL του server. Στη συνέχεια εκτελεί ένα "request" (υποθέτω "αίτημα" στα ελληνικά),  προς τον server και του δηλώνει ποια είναι η μορφή της πληροφορίας που θέλει. Ο server αποφασίζει αν την έχει (και αν πρέπει να τη δώσει) την πληροφορία και ανάλογα την επιστρέφει στον client (κάτι σαν το ΚΕΠ..). Σε περίπτωση που κάτι δεν πάει καλά, ο server μπορεί να ενημερώσει τον client τι λάθος έγινε επιστρέφοντας έναν <a href="https://en.wikipedia.org/wiki/List_of_HTTP_status_codes">κωδικό</a>. Αν ο κωδικός είναι το 200, τότε δεν συνέβει κανένα λάθος. Όταν ένας server "απαντάει" σε ένα request, τότε λέμε ότι έστειλε ένα responce.</p>
<p>Όταν ο client επικοινωνεί με τον server του δηλώνει: Τι θέλει, και σε ποια μορφή το θέλει.</p>
<p>Σχετικά με το "τι θέλω" υπάρχουν ΔΥΟ βασικοί τρόποι δήλωσης: οι <a href="http://www.w3schools.com/tags/ref_httpmethods.asp">"GET" και "POST"</a>.</p>
<p>H GET είναι ένας τρόπος να δηλώσεις τι θέλεις από έναν server, κωδικοποιώντας το αίτημα σου πάνω στο link. Αν υποθέσουμε π.χ. ότι θέλεις πληροροφίες για το προιόν με id=123 και το οποίο ανοίκει στη κατηγορία category=678 τότε το link που εκτελεί ένα GET request θα έχει τη μορφή: <a href="http://www.example.com/index.html?id=123&amp;category=678">http://www.example.com/index.html?id=123&amp;category=678</a>. Για παράδειγμα αν κοιτάξουμε αυτό το εντελώς τυχαίο link: <a href="http://news.in.gr/greece/article/?aid=1500029633">http://news.in.gr/greece/article/?aid=1500029633</a> θα δούμε ότι  είναι ένα GET request στη σελίδα news.in.gr/greece/article όπου ζητάει το "resource" το οποίο έχει aid=1500029633. Το GET request είναι ο κύριος τρόπος επικοινωνίας των browsers με τους web servers.</p>
<p>Τα GET requests έχουν δύο μειονεκτήματα:</p>
<ul>
<li>Αυτό που ζητάει ο client "φαίνεται" πάνω στο link. Γενικότερα τα links δεν θεωρούνται "ασφαλή" πληροφορία και είναι προσβάσιμα από πολλούς "ενδιάμεσους". Αν για παράδειγμα ζητάμε κάποια δεδομένα με βάση προσωπικές μας πληροφορίες (π.χ. τηλέφωνο) δεν είναι καλή ιδέα να φαίνεται αυτό στο link. </li>
<li>Δεδομένου ότι αυτό που ζητάμε βρίσκεται πάνω στο link. Αν αυτό που ζητάμε είναι πολύπλοκο, τότε το link μπορεί να γίνει τεράστιο και μη διαχειρίσιμο. Για παράδειγμα να ένα άσχημο link με πολλά GET πεδία: <a href="https://www.amazon.com/Data-Visualization-Python-JavaScript-Transform/dp/1491920513/ref=s9_cartx_gw_g14_i5_r?_encoding=UTF8&amp;fpl=fresh&amp;pf_rd_m=ATVPDKIKX0DER&amp;pf_rd_s=&amp;pf_rd_r=WRMBPSF9K3H62TEWG5DW&amp;pf_rd_t=36701&amp;pf_rd_p=a6aaf593-1ba4-4f4e-bdcc-0febe090b8ed&amp;pf_rd_i=desktop">https://www.amazon.com/Data-Visualization-Python-JavaScript-Transform/dp/1491920513/ref=s9_cartx_gw_g14_i5_r?_encoding=UTF8&amp;fpl=fresh&amp;pf_rd_m=ATVPDKIKX0DER&amp;pf_rd_s=&amp;pf_rd_r=WRMBPSF9K3H62TEWG5DW&amp;pf_rd_t=36701&amp;pf_rd_p=a6aaf593-1ba4-4f4e-bdcc-0febe090b8ed&amp;pf_rd_i=desktop</a> </li>
</ul>
<p>O δεύτερος τρόπος επικοινωνίας του client με τον server είναι μεσώ του POST request. Όταν κάνουμε POST βάζουμε μέσα σε ένα ειδικό πεδίο τα δεδομένα μας και το HTTP πρωτόκολο στέλνει αυτά τα δεδομένα στον server χωρίς να φαίνονται στο link. Π.χ. όταν κάνετε login στο site: <a href="http://bioinfo-grad.gr/eclass/">http://bioinfo-grad.gr/eclass/</a> βάζετε το username και το password σας. Στη συνέχεια ο browser στέλνει αυτά τα δεδομένα στον server για επιβεβαίωση. Αυτά τα δεδομένα ΔΕΝ πρέπει προφανώς να φαίνονται στο link. Πως γίνεται αυτό; Αν κοιτάξετε τον κώδικα της σελίδας (π.χ. από Firefox μπορείτε να το δείτε επιλέγοντας Tools -&gt; Web Developer -&gt; Page Source). Θα δείτε σε ένα σημείο να γράφει:</p>
<div class="highlight"><pre><span></span><span class="p">&lt;</span><span class="nt">h2</span><span class="p">&gt;</span>Σύνδεση χρήστη<span class="p">&lt;/</span><span class="nt">h2</span><span class="p">&gt;</span>
<span class="p">&lt;</span><span class="nt">div</span><span class="p">&gt;&lt;</span><span class="nt">form</span> <span class="na">action</span><span class="o">=</span><span class="s">&#39;http://bioinfo-grad.gr/eclass/&#39;</span> <span class="na">method</span><span class="o">=</span><span class="s">&#39;post&#39;</span><span class="p">&gt;</span>
</pre></div>
<p>Δηλαδή λέει: τα δεδομένα που βάζουμε σε αυτή τη φόρμα (form) θέλω να στέλνονται στον server μέσω POST request.</p>
<p>Ένα τελευταίο σημείο για το HTTP είναι οι <a href="https://en.wikipedia.org/wiki/List_of_HTTP_header_fields">headers</a>. Τα headers (επικεφαλίδες;;) είναι πεδία με προ-καθορισμένα ονόματα στα οποία μπορούμε να βάλουμε πληροφορίες που διευκολύνουν τον server να διεκπεραιώσει το request μας. Π.χ. αν βάλουμε στο header με το όνομα "Content-Type" τη τιμή "application/json", τότε λέμε στον server ότι τα δεδομένα που του στέλνουμε μέσω POST είναι σε μορφή JSON.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="python-requests-package">python requests package<a class="anchor-link" href="#python-requests-package">&#182;</a></h3><p>Ωραία όλα αυτά, αλλά πως τα κάνουμε μέσω python; Παρόλο που η python έχει βιβλιοθήκες για να κάνουμε GET και POST, θα χρησιμοποιήσουμε ένα εξωτερικό πακέτο το οποίο είναι εξαιρετικά εύχρηστο. Αυτό το πακέτο είναι το requests: <a href="http://docs.python-requests.org/en/master/">http://docs.python-requests.org/en/master/</a> . Για να το εγκαταστίσετε τρέξτε:</p>
<div class="highlight"><pre><span></span>pip install requests
</pre></div>
<p><strong>ΠΡΟΣΟΧΗ!</strong> πρέπει να βεβαιωθείτε ότι το πρόγραμμα pip βρίσκεται στο ίδιο σημείο που είναι και η python που τρέχετε!.
Για παράδειγμα:</p>
<div class="highlight"><pre><span></span>$ which pip
/Users/alexandroskanterakis/anaconda3/bin/pip
$ which python
/Users/alexandroskanterakis/anaconda3/bin/python
</pre></div>
<p>Βλέπουμε δηλαδή ότι το pip και η python που τρέχω είναι στο ίδιο σημείο. Διαφορετικά θα πρέπει να γράψετε κάτι σαν αυτό:</p>
<div class="highlight"><pre><span></span>/Directory/where/your/python/is/pip install requests
</pre></div>
<p>Για να βεβαιωθείτε ότι έχει εγκατασταθεί σωστά θα πρέπει να μπορείτε να κάνετε import αυτό το πακέτο χωρίς πρόβλημα:</p>
<div class="highlight"><pre><span></span>$ python
Python <span class="m">3</span>.5.2 <span class="p">|</span>Anaconda <span class="m">4</span>.1.1 <span class="o">(</span>x86_64<span class="o">)</span><span class="p">|</span> <span class="o">(</span>default, Jul  <span class="m">2</span> <span class="m">2016</span>, <span class="m">17</span>:52:12<span class="o">)</span> 
<span class="o">[</span>GCC <span class="m">4</span>.2.1 Compatible Apple LLVM <span class="m">4</span>.2 <span class="o">(</span>clang-425.0.28<span class="o">)]</span> on darwin
Type <span class="s2">&quot;help&quot;</span>, <span class="s2">&quot;copyright&quot;</span>, <span class="s2">&quot;credits&quot;</span> or <span class="s2">&quot;license&quot;</span> <span class="k">for</span> more information.
&gt;&gt;&gt; import requests
&gt;&gt;&gt;
</pre></div>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="&#928;&#961;&#959;&#963;&#960;&#949;&#955;&#945;&#973;&#957;&#959;&#957;&#964;&#945;&#962;-&#964;&#951;&#957;-ENSEMBL">&#928;&#961;&#959;&#963;&#960;&#949;&#955;&#945;&#973;&#957;&#959;&#957;&#964;&#945;&#962; &#964;&#951;&#957; ENSEMBL<a class="anchor-link" href="#&#928;&#961;&#959;&#963;&#960;&#949;&#955;&#945;&#973;&#957;&#959;&#957;&#964;&#945;&#962;-&#964;&#951;&#957;-ENSEMBL">&#182;</a></h2><p>Η <a href="http://www.ensembl.org/index.html">ENSEMBL</a> είναι ένα από τα πιο σημαντικά portals με διάφορες γενομικές πληροφορίες για πολλούς οργανισμούς. Η ENSEMBL έχει ένα API (<a href="https://en.wikipedia.org/wiki/Application_programming_interface">Application programming interface</a>) το οποίο είναι ένα σύνολο από οδηγίες προς προγραμματιστές για να προσπελαύνουν μία υπηρεσία. Το API της ENSEMBL περιγράφεται εδώ:  <a href="http://rest.ensembl.org/">http://rest.ensembl.org/</a></p>
<p>Παρατηρήστε ότι κάποιες υπηρεσίες είναι προσβάσιμες μέσω GET και κάποιες μέσω POST.</p>
<p>Σαν παράδειγμα θα χρησιμοποιήσουμε το API της ENSEMBL το οποίο αναφέρεται στο <a href="http://www.ensembl.org/info/docs/tools/vep/index.html">Variant Effect Predictor</a>. Το Variant Effect Predictor μας δίνει διάφορες πληροφορίες σχετικά με το downstream effect και clinical significance ενώς variant. Αλλα πριν κάνουμε αυτό ας δούμε με ποιους τρόπους κωδικοποιούμε έναν variant.</p>
<p>Γενικότερα υπάρχουν δύο τρόποι.</p>
<p>Αν ο variant είναι γνωστός τότε κοιτάμε αν έχει καταχωρηθεί στη <a href="https://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a>. Σε αυτή τη περίπτωση ο variant θα έχει εναν κωδικό με το φορμάτ: rsXXXXXX. πχ: rs56116432.</p>
<p>Αν ο variant δεν είναι γνωστός και δεν υπάρχει στη dbSNP τότε μπορούμε να τον περιγράψουμε μέσω του <a href="http://varnomen.hgvs.org/recommendations/general/">HGVS</a> φορμάτ. Η περιγραφή αυτή είναι αρκετά πολύπλοκη και ξεφεύγει λίγο από τους σκοπούς αυτής της διάλεξης. Απλά θα πούμε ότι μία από τις πολλές HGVS μορφές ενώς variant είναι το:</p>
<p>{ΧΡΩΜΟΣΩΜΑ}:g.{ΘΕΣΗ}{REFERENCE}&gt;{ALTERNATIVE}</p>
<p>π.χ.:</p>
<p>9:g.22125504G&gt;C</p>
<p>Δηλαδή στο χρωμόσωμα 9 στη θέση 22125504 αντί για G που είναι το reference υπάρχει C.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="GET-request-&#947;&#953;&#945;-dbSNP-variant">GET request &#947;&#953;&#945; dbSNP variant<a class="anchor-link" href="#GET-request-&#947;&#953;&#945;-dbSNP-variant">&#182;</a></h3><p>Για να πάρουμε πληροφορίες από το Variant Effect Predictor για ένα dbSNP variant, η ENSEMBL δίνει αυτό το API: <a href="http://rest.ensembl.org/documentation/info/vep_id_get">http://rest.ensembl.org/documentation/info/vep_id_get</a> Μπορούμε να κάνουμε ένα request σε αυτό το API ως εξής:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[1]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">import</span> <span class="nn">requests</span>

<span class="c1"># Το URL που πρέπει να χρησιμοποιήσουμε </span>
<span class="c1"># υπάρχει στη σελίδα http://rest.ensembl.org/documentation/info/vep_id_get </span>
<span class="c1"># Επίσης Αφού είναι GET Request βάζουμε τη πληροφορία που θέλουμε στο URL:</span>
<span class="n">url</span> <span class="o">=</span> <span class="s1">&#39;http://rest.ensembl.org/vep/human/id/rs56116432?&#39;</span>
<span class="n">headers</span> <span class="o">=</span> <span class="p">{</span> <span class="s2">&quot;Content-Type&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">}</span>

<span class="c1"># Κάνουμε το GET request</span>
<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">get</span><span class="p">(</span><span class="n">url</span><span class="p">,</span> <span class="n">headers</span><span class="o">=</span><span class="n">headers</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Στη συνέχεια κοιτάμαι αν όλα πήγαν οκ:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[33]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span> <span class="c1"># Στην ουσία εδώ κοιτάει αν το response έχει κωδικό 200</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Παίρνουμε τα JSON δεδομένα:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[10]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>[{&#39;transcript_consequences&#39;: [{&#39;biotype&#39;: &#39;processed_transcript&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;cdna_end&#39;: 700, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 700, &#39;variant_allele&#39;: &#39;T&#39;, &#39;transcript_id&#39;: &#39;ENST00000453660&#39;, &#39;consequence_terms&#39;: [&#39;non_coding_transcript_exon_variant&#39;, &#39;non_coding_transcript_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;strand&#39;: -1, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000538324&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000611156&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}], &#39;most_severe_consequence&#39;: &#39;missense_variant&#39;, &#39;input&#39;: &#39;rs56116432&#39;, &#39;seq_region_name&#39;: &#39;9&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;end&#39;: 133256042, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;exac_amr_maf&#39;: 0.004932, &#39;exac_sas_maf&#39;: 0.001639, &#39;exac_nfe_maf&#39;: 0.005339, &#39;end&#39;: 133256042, &#39;eas_maf&#39;: 0, &#39;exac_adj_allele&#39;: &#39;T&#39;, &#39;exac_eas_maf&#39;: 0, &#39;exac_fin_maf&#39;: 0.02601, &#39;exac_amr_allele&#39;: &#39;T&#39;, &#39;ea_maf&#39;: 0.003809, &#39;exac_oth_allele&#39;: &#39;T&#39;, &#39;minor_allele&#39;: &#39;T&#39;, &#39;sas_allele&#39;: &#39;T&#39;, &#39;amr_allele&#39;: &#39;T&#39;, &#39;exac_afr_allele&#39;: &#39;T&#39;, &#39;start&#39;: 133256042, &#39;ea_allele&#39;: &#39;T&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;exac_eas_allele&#39;: &#39;T&#39;, &#39;afr_maf&#39;: 0, &#39;amr_maf&#39;: 0.0014, &#39;sas_maf&#39;: 0.001, &#39;eur_allele&#39;: &#39;T&#39;, &#39;exac_fin_allele&#39;: &#39;T&#39;, &#39;strand&#39;: 1, &#39;afr_allele&#39;: &#39;T&#39;, &#39;exac_maf&#39;: 0.003022, &#39;minor_allele_freq&#39;: 0.0026, &#39;seq_region_name&#39;: 9, &#39;exac_nfe_allele&#39;: &#39;T&#39;, &#39;exac_adj_maf&#39;: 0.004439, &#39;exac_afr_maf&#39;: 0.0005079, &#39;aa_maf&#39;: 0.0007102, &#39;exac_sas_allele&#39;: &#39;T&#39;, &#39;eur_maf&#39;: 0.0109, &#39;aa_allele&#39;: &#39;T&#39;, &#39;eas_allele&#39;: &#39;T&#39;, &#39;id&#39;: &#39;rs56116432&#39;, &#39;exac_allele&#39;: &#39;T&#39;, &#39;exac_oth_maf&#39;: 0.004926}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;start&#39;: 133256042}, {&#39;transcript_consequences&#39;: [{&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000281879&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 689, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000626615&#39;, &#39;cds_end&#39;: 689, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 714, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 714, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 230, &#39;protein_start&#39;: 230, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}], &#39;most_severe_consequence&#39;: &#39;missense_variant&#39;, &#39;input&#39;: &#39;rs56116432&#39;, &#39;seq_region_name&#39;: &#39;CHR_HG2030_PATCH&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;end&#39;: 133256189, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;allele_string&#39;: &#39;C/T&#39;, &#39;seq_region_name&#39;: &#39;CHR_HG2030_PATCH&#39;, &#39;end&#39;: 133256189, &#39;minor_allele&#39;: &#39;T&#39;, &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;minor_allele_freq&#39;: 0.0026, &#39;start&#39;: 133256189}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;start&#39;: 133256189}]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[11]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="nb">len</span><span class="p">(</span><span class="n">data</span><span class="p">))</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>2
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>επέστρεψε 2 εγγραφές. Ας πάρουμε την πρώτη:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[12]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">])</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>{&#39;transcript_consequences&#39;: [{&#39;biotype&#39;: &#39;processed_transcript&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;cdna_end&#39;: 700, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 700, &#39;variant_allele&#39;: &#39;T&#39;, &#39;transcript_id&#39;: &#39;ENST00000453660&#39;, &#39;consequence_terms&#39;: [&#39;non_coding_transcript_exon_variant&#39;, &#39;non_coding_transcript_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;strand&#39;: -1, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000538324&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000611156&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}], &#39;most_severe_consequence&#39;: &#39;missense_variant&#39;, &#39;input&#39;: &#39;rs56116432&#39;, &#39;seq_region_name&#39;: &#39;9&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;end&#39;: 133256042, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;exac_amr_maf&#39;: 0.004932, &#39;exac_sas_maf&#39;: 0.001639, &#39;exac_nfe_maf&#39;: 0.005339, &#39;end&#39;: 133256042, &#39;eas_maf&#39;: 0, &#39;exac_adj_allele&#39;: &#39;T&#39;, &#39;exac_eas_maf&#39;: 0, &#39;exac_fin_maf&#39;: 0.02601, &#39;exac_amr_allele&#39;: &#39;T&#39;, &#39;ea_maf&#39;: 0.003809, &#39;exac_oth_allele&#39;: &#39;T&#39;, &#39;minor_allele&#39;: &#39;T&#39;, &#39;sas_allele&#39;: &#39;T&#39;, &#39;amr_allele&#39;: &#39;T&#39;, &#39;exac_afr_allele&#39;: &#39;T&#39;, &#39;start&#39;: 133256042, &#39;ea_allele&#39;: &#39;T&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;exac_eas_allele&#39;: &#39;T&#39;, &#39;afr_maf&#39;: 0, &#39;amr_maf&#39;: 0.0014, &#39;sas_maf&#39;: 0.001, &#39;eur_allele&#39;: &#39;T&#39;, &#39;exac_fin_allele&#39;: &#39;T&#39;, &#39;strand&#39;: 1, &#39;afr_allele&#39;: &#39;T&#39;, &#39;exac_maf&#39;: 0.003022, &#39;minor_allele_freq&#39;: 0.0026, &#39;seq_region_name&#39;: 9, &#39;exac_nfe_allele&#39;: &#39;T&#39;, &#39;exac_adj_maf&#39;: 0.004439, &#39;exac_afr_maf&#39;: 0.0005079, &#39;aa_maf&#39;: 0.0007102, &#39;exac_sas_allele&#39;: &#39;T&#39;, &#39;eur_maf&#39;: 0.0109, &#39;aa_allele&#39;: &#39;T&#39;, &#39;eas_allele&#39;: &#39;T&#39;, &#39;id&#39;: &#39;rs56116432&#39;, &#39;exac_allele&#39;: &#39;T&#39;, &#39;exac_oth_maf&#39;: 0.004926}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;start&#39;: 133256042}
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[13]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="nb">len</span><span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">][</span><span class="s2">&quot;transcript_consequences&quot;</span><span class="p">]))</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>3
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Η πρώτη εγγραφή έχει consequences σε 3 transcripts. Ας πάρουμε το 2ο:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[14]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">][</span><span class="s2">&quot;transcript_consequences&quot;</span><span class="p">][</span><span class="mi">1</span><span class="p">])</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>{&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000538324&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ας δούμε ποιο είναι το consequence αυτού του mutation σε αυτό το transcript σύμφωνα με το <a href="http://genetics.bwh.harvard.edu/pph2/">polyphen</a>:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[15]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">][</span><span class="s2">&quot;transcript_consequences&quot;</span><span class="p">][</span><span class="mi">1</span><span class="p">][</span><span class="s2">&quot;polyphen_prediction&quot;</span><span class="p">])</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>probably_damaging
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="POST-request-&#947;&#953;&#945;-dbSNP-variant">POST request &#947;&#953;&#945; dbSNP variant<a class="anchor-link" href="#POST-request-&#947;&#953;&#945;-dbSNP-variant">&#182;</a></h3><p>Θα κάνουμε τώρα το ίδιο αλλά θα χρησιμοποιήσουμε το API για POST request: <a href="http://rest.ensembl.org/documentation/info/vep_id_post">http://rest.ensembl.org/documentation/info/vep_id_post</a></p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[17]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">url</span> <span class="o">=</span> <span class="s1">&#39;http://rest.ensembl.org/vep/human/id&#39;</span>

<span class="c1"># δηλώνουμε ότι το αποτέλεσμα θέλουμε να είναι σε JSON φορματ (Accept)</span>
<span class="n">headers</span> <span class="o">=</span> <span class="p">{</span> <span class="s2">&quot;Content-Type&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">,</span> <span class="s2">&quot;Accept&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">}</span> 

<span class="c1"># Αφού είναι POST βάζουμε τα data ξεχωριστά:</span>
<span class="n">data</span> <span class="o">=</span> <span class="p">{</span> <span class="s2">&quot;ids&quot;</span> <span class="p">:</span> <span class="p">[</span><span class="s2">&quot;rs56116432&quot;</span><span class="p">,</span> <span class="s2">&quot;COSM476&quot;</span> <span class="p">]</span> <span class="p">}</span>

<span class="c1"># ΠΡΟΣΟΧΗ!!!</span>
<span class="c1"># Τα data είναι ένα dictionary το οποίο πρέπει να το μετατρέψουμε σε JSON!</span>
<span class="kn">import</span> <span class="nn">json</span>
<span class="n">data_json</span> <span class="o">=</span> <span class="n">json</span><span class="o">.</span><span class="n">dumps</span><span class="p">(</span><span class="n">data</span><span class="p">)</span>

<span class="c1"># Κάνουμε το POST request:</span>
<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">post</span><span class="p">(</span><span class="n">url</span><span class="p">,</span> <span class="n">headers</span><span class="o">=</span><span class="n">headers</span><span class="p">,</span> <span class="n">data</span><span class="o">=</span><span class="n">data_json</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Τσεκάρουμε ότι όλα πήγαν οκ:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[18]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>παίρνουμε τα data:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[19]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>[{&#39;transcript_consequences&#39;: [{&#39;biotype&#39;: &#39;processed_transcript&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;cdna_end&#39;: 700, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 700, &#39;variant_allele&#39;: &#39;T&#39;, &#39;transcript_id&#39;: &#39;ENST00000453660&#39;, &#39;consequence_terms&#39;: [&#39;non_coding_transcript_exon_variant&#39;, &#39;non_coding_transcript_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;strand&#39;: -1, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000538324&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}, {&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000175164&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 686, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000611156&#39;, &#39;cds_end&#39;: 686, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 711, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 711, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 229, &#39;protein_start&#39;: 229, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}], &#39;most_severe_consequence&#39;: &#39;missense_variant&#39;, &#39;input&#39;: &#39;rs56116432&#39;, &#39;seq_region_name&#39;: &#39;9&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;end&#39;: 133256042, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;exac_amr_maf&#39;: 0.004932, &#39;exac_sas_maf&#39;: 0.001639, &#39;exac_nfe_maf&#39;: 0.005339, &#39;end&#39;: 133256042, &#39;eas_maf&#39;: 0, &#39;exac_adj_allele&#39;: &#39;T&#39;, &#39;exac_eas_maf&#39;: 0, &#39;exac_fin_maf&#39;: 0.02601, &#39;exac_amr_allele&#39;: &#39;T&#39;, &#39;ea_maf&#39;: 0.003809, &#39;exac_oth_allele&#39;: &#39;T&#39;, &#39;minor_allele&#39;: &#39;T&#39;, &#39;sas_allele&#39;: &#39;T&#39;, &#39;amr_allele&#39;: &#39;T&#39;, &#39;exac_afr_allele&#39;: &#39;T&#39;, &#39;start&#39;: 133256042, &#39;ea_allele&#39;: &#39;T&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;exac_eas_allele&#39;: &#39;T&#39;, &#39;afr_maf&#39;: 0, &#39;amr_maf&#39;: 0.0014, &#39;sas_maf&#39;: 0.001, &#39;eur_allele&#39;: &#39;T&#39;, &#39;exac_fin_allele&#39;: &#39;T&#39;, &#39;strand&#39;: 1, &#39;afr_allele&#39;: &#39;T&#39;, &#39;exac_maf&#39;: 0.003022, &#39;minor_allele_freq&#39;: 0.0026, &#39;seq_region_name&#39;: 9, &#39;exac_nfe_allele&#39;: &#39;T&#39;, &#39;exac_adj_maf&#39;: 0.004439, &#39;exac_afr_maf&#39;: 0.0005079, &#39;aa_maf&#39;: 0.0007102, &#39;exac_sas_allele&#39;: &#39;T&#39;, &#39;eur_maf&#39;: 0.0109, &#39;aa_allele&#39;: &#39;T&#39;, &#39;eas_allele&#39;: &#39;T&#39;, &#39;id&#39;: &#39;rs56116432&#39;, &#39;exac_allele&#39;: &#39;T&#39;, &#39;exac_oth_maf&#39;: 0.004926}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;start&#39;: 133256042}, {&#39;transcript_consequences&#39;: [{&#39;biotype&#39;: &#39;protein_coding&#39;, &#39;gene_id&#39;: &#39;ENSG00000281879&#39;, &#39;sift_score&#39;: 0, &#39;hgnc_id&#39;: &#39;HGNC:79&#39;, &#39;polyphen_score&#39;: 0.997, &#39;sift_prediction&#39;: &#39;deleterious&#39;, &#39;variant_allele&#39;: &#39;T&#39;, &#39;cds_start&#39;: 689, &#39;codons&#39;: &#39;gGc/gAc&#39;, &#39;transcript_id&#39;: &#39;ENST00000626615&#39;, &#39;cds_end&#39;: 689, &#39;polyphen_prediction&#39;: &#39;probably_damaging&#39;, &#39;impact&#39;: &#39;MODERATE&#39;, &#39;cdna_end&#39;: 714, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;cdna_start&#39;: 714, &#39;consequence_terms&#39;: [&#39;missense_variant&#39;], &#39;protein_end&#39;: 230, &#39;protein_start&#39;: 230, &#39;strand&#39;: -1, &#39;amino_acids&#39;: &#39;G/D&#39;, &#39;gene_symbol&#39;: &#39;ABO&#39;}], &#39;most_severe_consequence&#39;: &#39;missense_variant&#39;, &#39;input&#39;: &#39;rs56116432&#39;, &#39;seq_region_name&#39;: &#39;CHR_HG2030_PATCH&#39;, &#39;allele_string&#39;: &#39;C/T&#39;, &#39;end&#39;: 133256189, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;allele_string&#39;: &#39;C/T&#39;, &#39;seq_region_name&#39;: &#39;CHR_HG2030_PATCH&#39;, &#39;end&#39;: 133256189, &#39;minor_allele&#39;: &#39;T&#39;, &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;minor_allele_freq&#39;: 0.0026, &#39;start&#39;: 133256189}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;rs56116432&#39;, &#39;start&#39;: 133256189}, {&#39;most_severe_consequence&#39;: &#39;?&#39;, &#39;allele_string&#39;: &#39;COSMIC_MUTATION&#39;, &#39;input&#39;: &#39;COSM476&#39;, &#39;seq_region_name&#39;: &#39;7&#39;, &#39;end&#39;: 140753336, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;allele_string&#39;: &#39;HGMD_MUTATION&#39;, &#39;seq_region_name&#39;: 7, &#39;phenotype_or_disease&#39;: 1, &#39;strand&#39;: 1, &#39;id&#39;: &#39;CM112509&#39;, &#39;end&#39;: 140753336, &#39;start&#39;: 140753336}, {&#39;allele_string&#39;: &#39;COSMIC_MUTATION&#39;, &#39;seq_region_name&#39;: 7, &#39;phenotype_or_disease&#39;: 1, &#39;start&#39;: 140753336, &#39;strand&#39;: 1, &#39;id&#39;: &#39;COSM18443&#39;, &#39;end&#39;: 140753336, &#39;somatic&#39;: 1}, {&#39;allele_string&#39;: &#39;COSMIC_MUTATION&#39;, &#39;seq_region_name&#39;: 7, &#39;phenotype_or_disease&#39;: 1, &#39;start&#39;: 140753336, &#39;strand&#39;: 1, &#39;id&#39;: &#39;COSM476&#39;, &#39;end&#39;: 140753336, &#39;somatic&#39;: 1}, {&#39;allele_string&#39;: &#39;COSMIC_MUTATION&#39;, &#39;seq_region_name&#39;: 7, &#39;phenotype_or_disease&#39;: 1, &#39;start&#39;: 140753336, &#39;strand&#39;: 1, &#39;id&#39;: &#39;COSM6137&#39;, &#39;end&#39;: 140753336, &#39;somatic&#39;: 1}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;COSM476&#39;, &#39;start&#39;: 140753336}]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Είναι τα ίδια με πριν:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[20]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">][</span><span class="s2">&quot;transcript_consequences&quot;</span><span class="p">][</span><span class="mi">1</span><span class="p">][</span><span class="s2">&quot;polyphen_prediction&quot;</span><span class="p">])</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>probably_damaging
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="GET-request-&#947;&#953;&#945;-HGVS-variant">GET request &#947;&#953;&#945; HGVS variant<a class="anchor-link" href="#GET-request-&#947;&#953;&#945;-HGVS-variant">&#182;</a></h3><p>H ENSEMBL μας δίνει ένα API για να πάρουμε πληροφορίες από το Variant Effect Predictor για ένα HGVS variant μέσω GET request: <a href="http://rest.ensembl.org/documentation/info/vep_hgvs_get">http://rest.ensembl.org/documentation/info/vep_hgvs_get</a></p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[21]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">url</span> <span class="o">=</span> <span class="s1">&#39;http://rest.ensembl.org/vep/human/hgvs/9:g.22125504G&gt;C?&#39;</span>
<span class="n">headers</span><span class="o">=</span><span class="p">{</span> <span class="s2">&quot;Content-Type&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">}</span>

<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">get</span><span class="p">(</span><span class="n">url</span><span class="p">,</span> <span class="n">headers</span><span class="o">=</span><span class="n">headers</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[22]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[23]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[24]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>[{&#39;transcript_consequences&#39;: [{&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4407, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000422420&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4409, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000428597&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000577551&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4858, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000580576&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000581051&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000582072&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584020&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584637&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584816&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4960, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000585267&#39;}], &#39;most_severe_consequence&#39;: &#39;downstream_gene_variant&#39;, &#39;input&#39;: &#39;9:g.22125504G&gt;C&#39;, &#39;seq_region_name&#39;: &#39;9&#39;, &#39;allele_string&#39;: &#39;G/C&#39;, &#39;end&#39;: 22125504, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;allele_string&#39;: &#39;G/C&#39;, &#39;eur_maf&#39;: 0.4722, &#39;amr_maf&#39;: 0.4553, &#39;sas_maf&#39;: 0.4908, &#39;eur_allele&#39;: &#39;C&#39;, &#39;end&#39;: 22125504, &#39;eas_maf&#39;: 0.5367, &#39;afr_allele&#39;: &#39;C&#39;, &#39;minor_allele&#39;: &#39;C&#39;, &#39;seq_region_name&#39;: 9, &#39;minor_allele_freq&#39;: 0.4181, &#39;strand&#39;: 1, &#39;pubmed&#39;: &#39;24262325,19501493,22042884,21860704,21149552,20159871,19474294,21894447,21971053,21804106,20502693,22199011,18224312,22400124,18533027,18852197,21297524,22403240,22856518,23963167,19343170,20386740,21400687,24728607,20017983,24573017,24607648,20549515,22144573,22623978,22029572,18362232,19173706,19214202,26252781,20435227,21606135,19924713,17554300,19955471,19956433,25717410,24098343,18780302,18675980,19475673,20231156,20858905,21152093,21698238,24906238,17634449,18979498,19164808,19207022,19750184,20098575,20981302,21242481,21369780,22295058,22848412,25617895,23729007,18469204,20605023,21372283,22429504,26483964,23870195,18704761,23587283,24926413,19463184,24676469,21424681,20175863,22505696,19559344,19578366,23142796,19171343,24246088,18987759,19819472,19926059,21375403,21385355,21705410,24777168,25105296,19888323,23454037,18264662,18599798,18652946,18654002,18925945,18957718,19135198,19319159,19329499,19548844,19664850,19709660,19885677,19956784,20031540,20031580,20031606,20230275,20335276,20395598,2040077&#39;, &#39;sas_allele&#39;: &#39;C&#39;, &#39;phenotype_or_disease&#39;: 1, &#39;amr_allele&#39;: &#39;C&#39;, &#39;afr_maf&#39;: 0.2133, &#39;eas_allele&#39;: &#39;C&#39;, &#39;id&#39;: &#39;rs1333049&#39;, &#39;start&#39;: 22125504}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;9:g.22125504G&gt;C&#39;, &#39;start&#39;: 22125504}]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[25]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="nb">len</span><span class="p">(</span><span class="n">data</span><span class="p">))</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>1
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Επέστρεψε μόνο μία εγγρφή.</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[26]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">]</span><span class="o">.</span><span class="n">keys</span><span class="p">()</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt output_prompt">Out[26]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>dict_keys([&#39;transcript_consequences&#39;, &#39;most_severe_consequence&#39;, &#39;input&#39;, &#39;seq_region_name&#39;, &#39;allele_string&#39;, &#39;end&#39;, &#39;assembly_name&#39;, &#39;colocated_variants&#39;, &#39;strand&#39;, &#39;id&#39;, &#39;start&#39;])</pre>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ας δούμε τα transcript consequences:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[27]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">data</span><span class="p">[</span><span class="mi">0</span><span class="p">][</span><span class="s2">&quot;transcript_consequences&quot;</span><span class="p">]</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt output_prompt">Out[27]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>[{&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4407,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000422420&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4409,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000428597&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000577551&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4858,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000580576&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000581051&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000582072&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000584020&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000584637&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4932,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000584816&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;},
 {&#39;biotype&#39;: &#39;antisense&#39;,
  &#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;],
  &#39;distance&#39;: 4960,
  &#39;gene_id&#39;: &#39;ENSG00000240498&#39;,
  &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;,
  &#39;gene_symbol_source&#39;: &#39;HGNC&#39;,
  &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;,
  &#39;impact&#39;: &#39;MODIFIER&#39;,
  &#39;strand&#39;: 1,
  &#39;transcript_id&#39;: &#39;ENST00000585267&#39;,
  &#39;variant_allele&#39;: &#39;C&#39;}]</pre>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="POST-request-&#947;&#953;&#945;-HGVS-variant">POST request &#947;&#953;&#945; HGVS variant<a class="anchor-link" href="#POST-request-&#947;&#953;&#945;-HGVS-variant">&#182;</a></h3><p>Μπορούμε να κάνουμε το ίδιο, κάνοντας ένα POST request: <a href="http://rest.ensembl.org/documentation/info/vep_hgvs_post">http://rest.ensembl.org/documentation/info/vep_hgvs_post</a></p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[28]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">url</span> <span class="o">=</span> <span class="s1">&#39;http://rest.ensembl.org/vep/human/hgvs&#39;</span>
<span class="n">headers</span> <span class="o">=</span> <span class="p">{</span> <span class="s2">&quot;Content-Type&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">,</span> <span class="s2">&quot;Accept&quot;</span> <span class="p">:</span> <span class="s2">&quot;application/json&quot;</span><span class="p">}</span>
<span class="n">data</span> <span class="o">=</span> <span class="p">{</span> <span class="s2">&quot;hgvs_notations&quot;</span> <span class="p">:</span> <span class="p">[</span><span class="s2">&quot;9:g.22125504G&gt;C&quot;</span><span class="p">]</span> <span class="p">}</span> <span class="c1"># Παρατηρείστε ότι αυτό είναι μία λίστα. </span>
                                                  <span class="c1"># Μπορούμε να βάλουμε (σχεδόν) όσα HGVS variants θέλουμε</span>
    
<span class="n">data_json</span> <span class="o">=</span> <span class="n">json</span><span class="o">.</span><span class="n">dumps</span><span class="p">(</span><span class="n">data</span><span class="p">)</span>

<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">post</span><span class="p">(</span><span class="n">url</span><span class="p">,</span> <span class="n">headers</span><span class="o">=</span><span class="n">headers</span><span class="p">,</span> <span class="n">data</span><span class="o">=</span><span class="n">data_json</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[29]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[30]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">returned_data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">returned_data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>[{&#39;transcript_consequences&#39;: [{&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4407, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000422420&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4409, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000428597&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000577551&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4858, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000580576&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000581051&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000582072&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584020&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584637&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4932, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000584816&#39;}, {&#39;consequence_terms&#39;: [&#39;downstream_gene_variant&#39;], &#39;impact&#39;: &#39;MODIFIER&#39;, &#39;biotype&#39;: &#39;antisense&#39;, &#39;gene_id&#39;: &#39;ENSG00000240498&#39;, &#39;hgnc_id&#39;: &#39;HGNC:34341&#39;, &#39;distance&#39;: 4960, &#39;gene_symbol&#39;: &#39;CDKN2B-AS1&#39;, &#39;gene_symbol_source&#39;: &#39;HGNC&#39;, &#39;strand&#39;: 1, &#39;variant_allele&#39;: &#39;C&#39;, &#39;transcript_id&#39;: &#39;ENST00000585267&#39;}], &#39;most_severe_consequence&#39;: &#39;downstream_gene_variant&#39;, &#39;input&#39;: &#39;9:g.22125504G&gt;C&#39;, &#39;seq_region_name&#39;: &#39;9&#39;, &#39;allele_string&#39;: &#39;G/C&#39;, &#39;end&#39;: 22125504, &#39;assembly_name&#39;: &#39;GRCh38&#39;, &#39;colocated_variants&#39;: [{&#39;allele_string&#39;: &#39;G/C&#39;, &#39;eur_maf&#39;: 0.4722, &#39;amr_maf&#39;: 0.4553, &#39;sas_maf&#39;: 0.4908, &#39;eur_allele&#39;: &#39;C&#39;, &#39;end&#39;: 22125504, &#39;eas_maf&#39;: 0.5367, &#39;afr_allele&#39;: &#39;C&#39;, &#39;minor_allele&#39;: &#39;C&#39;, &#39;seq_region_name&#39;: 9, &#39;minor_allele_freq&#39;: 0.4181, &#39;strand&#39;: 1, &#39;pubmed&#39;: &#39;24262325,19501493,22042884,21860704,21149552,20159871,19474294,21894447,21971053,21804106,20502693,22199011,18224312,22400124,18533027,18852197,21297524,22403240,22856518,23963167,19343170,20386740,21400687,24728607,20017983,24573017,24607648,20549515,22144573,22623978,22029572,18362232,19173706,19214202,26252781,20435227,21606135,19924713,17554300,19955471,19956433,25717410,24098343,18780302,18675980,19475673,20231156,20858905,21152093,21698238,24906238,17634449,18979498,19164808,19207022,19750184,20098575,20981302,21242481,21369780,22295058,22848412,25617895,23729007,18469204,20605023,21372283,22429504,26483964,23870195,18704761,23587283,24926413,19463184,24676469,21424681,20175863,22505696,19559344,19578366,23142796,19171343,24246088,18987759,19819472,19926059,21375403,21385355,21705410,24777168,25105296,19888323,23454037,18264662,18599798,18652946,18654002,18925945,18957718,19135198,19319159,19329499,19548844,19664850,19709660,19885677,19956784,20031540,20031580,20031606,20230275,20335276,20395598,2040077&#39;, &#39;sas_allele&#39;: &#39;C&#39;, &#39;phenotype_or_disease&#39;: 1, &#39;amr_allele&#39;: &#39;C&#39;, &#39;afr_maf&#39;: 0.2133, &#39;eas_allele&#39;: &#39;C&#39;, &#39;id&#39;: &#39;rs1333049&#39;, &#39;start&#39;: 22125504}], &#39;strand&#39;: 1, &#39;id&#39;: &#39;9:g.22125504G&gt;C&#39;, &#39;start&#39;: 22125504}]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Mutalyzer">Mutalyzer<a class="anchor-link" href="#Mutalyzer">&#182;</a></h3><p>Το <a href="https://mutalyzer.nl/">mutalyzer</a> είναι ένα service με το οποίο μπορούμε να ελέγχουμε και να κάνουμε μετατροπές σε variants οι οποίοι περιγράφονται σε HGVS. Για παράδειγμα μέσω το numberConversion μπορούμε να βρούμε το genomic location ενός variant:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[2]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">get</span><span class="p">(</span>
  <span class="s1">&#39;https://mutalyzer.nl/json/numberConversion&#39;</span><span class="p">,</span> 
  <span class="p">{</span>
  <span class="s1">&#39;build&#39;</span><span class="p">:</span> <span class="s1">&#39;hg38&#39;</span><span class="p">,</span> 
  <span class="s1">&#39;variant&#39;</span><span class="p">:</span> <span class="s1">&#39;NM_001276506.1:c.204C&gt;T&#39;</span>
  <span class="p">})</span>
<span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span> 
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>[&#39;NC_000011.10:g.112088901C&gt;T&#39;]
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Variation-Reporter">Variation Reporter<a class="anchor-link" href="#Variation-Reporter">&#182;</a></h3><p>Το <a href="https://www.ncbi.nlm.nih.gov/variation/tools/reporter">Variation Reporter</a> είναι το αντίστοιχο με το VEP service του NCBI. Μπορουμε να το χρησιμοποιήσουμε ως εξής:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[4]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">url</span><span class="o">=</span><span class="s1">&#39;https://www.ncbi.nlm.nih.gov/projects/SNP/VariantAnalyzer/var_rep.cgi&#39;</span>
<span class="n">var</span> <span class="o">=</span> <span class="s1">&#39;NM_001276506.1:c.204C&gt;T&#39;</span>
<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">post</span><span class="p">(</span><span class="n">url</span><span class="p">,</span> <span class="p">{</span><span class="s1">&#39;annot1&#39;</span><span class="p">:</span> <span class="n">var</span><span class="p">,</span> <span class="p">})</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span>
<span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">text</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
Submitted: JSID_01_1003310_130.14.18.6_9000__variant_analyzer
.
## URL: https://www.ncbi.nlm.nih.gov/variation/tools/reporter/JSID_01_1003310_130.14.18.6_9000__variant_analyzer
## Submitted time:	01/26/2018 11:29:20
## Report generated time:	01/26/2018 11:29:22
## Summary report for 
## Summary of Submitted Data
## Number of variant locations:	1
## Number of variant alleles:	1
## Summary of Data Report:
## Number of unique NCBI Ids found:	1
## Number of novel alleles at known locations:	0
## Number of novel alleles at novel locations:	0
## Total number of novel locations:	0
## Variant alleles with clinical information:	1
## Variant alleles with molecular consequence:	1
## Total number of rows in the report:	13
## Assembly:	GRCh37.p13

# Submitted ID	Submitted Loc	Cytoband	Mapped Loc	NCBI ID	Allele	GMAF	Gene ID	Gene Symbol	Hgvs_g	Origin	Hgvs_g (RefSeqGene)	Hgvs_c	Hgvs_p	Consequences	OnTestPanel	ClinVar Accession	Clinical Source ID	Clinical Significance	Clinical Evidence	Clinical Review	Phenotype ID	Phenotype Description	PMIDs	Number Of Submissions	Suspected False Positive	GWAS Association	Has Genotype?	On Genotyping Kit?	Exception	Novel allele?
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NP_002993.1:68	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NT_033899.8:15522041	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NC_000011.9:111959625	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NM_003002.3:288	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NM_001276504.1:171	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NP_001263433.1:29	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NM_001276506.1:288	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NP_001263435.1:68	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NR_077060.1:288	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NG_033145.1:2898	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	XM_005271644.1:283	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	XP_005271701.1:68	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		
NM_001276506.1:c.204C&gt;T	NM_001276506.1: 288	11q23.1	NG_012337.3:7055	rs9919552	NC_000011.9:g.111959625C&gt;T	T: 0.1134	6392	SDHD	NC_000011.9:g.111959625C&gt;T	germline	NG_012337.3:g.7055C&gt;T	NM_001276506.1:c.204C&gt;T	NP_001263435.1:p.Ser68=	SO:0001819 (synonymous_codon)		RCV000037727.5; RCV000162450.1; RCV000265027.1	Illumina Clinical Services Laboratory,Illumina:839653	Conflicting interpretations of pathogenicity; Benign; Benign	clinical testing; clinical testing; clinical testing	conf; single; single	MedGen:CN169374; MedGen:C0027672,SNOMED CT:699346009; MedGen:C0031511,OMIM:171300	not specified; Hereditary cancer-predisposing syndrome; Pheochromocytoma	24033266;25741868	34			Yes	Yes		


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Παρατηρούμε ότι τα δεδομένα που επιστρέφει δεν είναι σε JSON αλλά tabular. Μπορούμε να τα "φροτώσουμε" σε ένα pandas DataFrame!</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[6]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">import</span> <span class="nn">pandas</span> <span class="k">as</span> <span class="nn">pd</span>
<span class="kn">from</span> <span class="nn">io</span> <span class="k">import</span> <span class="n">StringIO</span>

<span class="c1"># Remove non tabular data</span>
<span class="n">data</span> <span class="o">=</span> <span class="p">[</span><span class="n">x</span> <span class="k">for</span> <span class="n">x</span> <span class="ow">in</span> <span class="n">data</span><span class="o">.</span><span class="n">split</span><span class="p">(</span><span class="s1">&#39;</span><span class="se">\n</span><span class="s1">&#39;</span><span class="p">)</span> <span class="k">if</span> <span class="n">x</span><span class="p">[:</span><span class="mi">2</span><span class="p">]</span> <span class="ow">not</span> <span class="ow">in</span> <span class="p">[</span><span class="s1">&#39;Su&#39;</span><span class="p">,</span> <span class="s1">&#39;.&#39;</span><span class="p">,</span> <span class="s1">&#39;##&#39;</span><span class="p">]]</span>
<span class="n">data</span> <span class="o">=</span> <span class="s1">&#39;</span><span class="se">\n</span><span class="s1">&#39;</span><span class="o">.</span><span class="n">join</span><span class="p">(</span><span class="n">data</span><span class="p">)</span>

<span class="c1">#Create a &quot;virtual&quot; file-like structure that contains the string.</span>
<span class="n">data_f</span> <span class="o">=</span> <span class="n">StringIO</span><span class="p">(</span><span class="n">data</span><span class="p">)</span>

<span class="c1">#data_f is a file. Yet it is not stored in the disk. </span>
<span class="c1">#Now we can pass it to pandas!</span>
<span class="n">df</span> <span class="o">=</span> <span class="n">pd</span><span class="o">.</span><span class="n">read_csv</span><span class="p">(</span><span class="n">data_f</span><span class="p">,</span> <span class="n">sep</span><span class="o">=</span><span class="s1">&#39;</span><span class="se">\t</span><span class="s1">&#39;</span><span class="p">)</span>
<span class="n">df</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt output_prompt">Out[6]:</div>


<div class="output_html rendered_html output_subarea output_execute_result">
<div>
<style>
    .dataframe thead tr:only-child th {
        text-align: right;
    }

    .dataframe thead th {
        text-align: left;
    }

    .dataframe tbody tr th {
        vertical-align: top;
    }
</style>
<table border="1" class="dataframe">
  <thead>
    <tr style="text-align: right;">
      <th></th>
      <th># Submitted ID</th>
      <th>Submitted Loc</th>
      <th>Cytoband</th>
      <th>Mapped Loc</th>
      <th>NCBI ID</th>
      <th>Allele</th>
      <th>GMAF</th>
      <th>Gene ID</th>
      <th>Gene Symbol</th>
      <th>Hgvs_g</th>
      <th>...</th>
      <th>Phenotype ID</th>
      <th>Phenotype Description</th>
      <th>PMIDs</th>
      <th>Number Of Submissions</th>
      <th>Suspected False Positive</th>
      <th>GWAS Association</th>
      <th>Has Genotype?</th>
      <th>On Genotyping Kit?</th>
      <th>Exception</th>
      <th>Novel allele?</th>
    </tr>
  </thead>
  <tbody>
    <tr>
      <th>0</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NP_002993.1:68</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>1</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NT_033899.8:15522041</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>2</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NC_000011.9:111959625</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>3</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NM_003002.3:288</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>4</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NM_001276504.1:171</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>5</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NP_001263433.1:29</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>6</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NM_001276506.1:288</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>7</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NP_001263435.1:68</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>8</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NR_077060.1:288</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>9</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NG_033145.1:2898</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>10</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>XM_005271644.1:283</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>11</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>XP_005271701.1:68</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
    <tr>
      <th>12</th>
      <td>NM_001276506.1:c.204C&gt;T</td>
      <td>NM_001276506.1: 288</td>
      <td>11q23.1</td>
      <td>NG_012337.3:7055</td>
      <td>rs9919552</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>T: 0.1134</td>
      <td>6392</td>
      <td>SDHD</td>
      <td>NC_000011.9:g.111959625C&gt;T</td>
      <td>...</td>
      <td>MedGen:CN169374; MedGen:C0027672,SNOMED CT:699...</td>
      <td>not specified; Hereditary cancer-predisposing ...</td>
      <td>24033266;25741868</td>
      <td>34</td>
      <td>NaN</td>
      <td>NaN</td>
      <td>Yes</td>
      <td>Yes</td>
      <td>NaN</td>
      <td>NaN</td>
    </tr>
  </tbody>
</table>
<p>13 rows × 31 columns</p>
</div>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Assembly-Converter">Assembly Converter<a class="anchor-link" href="#Assembly-Converter">&#182;</a></h3><p>Με το <a href="https://rest.ensembl.org/documentation/info/assembly_map">Assembly Converter</a> μπορούμε να μετατρέψουμε μία γενομική θέση από ένα assembly σε ένα άλλο. Για παράδειγμα έστω ότι έχουμε τη θέση 111959625 στο χρωμόσωμα 11 στο assembly GRCh37 και θέλουμε να το μετατρέψουμε στο GRCh38 assembly:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[8]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">location</span> <span class="o">=</span> <span class="mi">111959625</span>
<span class="n">chromosome</span> <span class="o">=</span> <span class="mi">11</span>

<span class="n">url</span> <span class="o">=</span> <span class="s1">&#39;https://rest.ensembl.org/map/human/GRCh37/</span><span class="si">{chr}</span><span class="s1">:</span><span class="si">{pos}</span><span class="s1">..</span><span class="si">{pos}</span><span class="s1">:1/GRCh38&#39;</span>

<span class="n">this_url</span> <span class="o">=</span> <span class="n">url</span><span class="o">.</span><span class="n">format</span><span class="p">(</span><span class="n">pos</span><span class="o">=</span><span class="n">location</span><span class="p">,</span> <span class="nb">chr</span><span class="o">=</span><span class="n">chromosome</span><span class="p">)</span>
<span class="n">headers</span> <span class="o">=</span> <span class="p">{</span><span class="s1">&#39;content-type&#39;</span><span class="p">:</span><span class="s1">&#39;application/json&#39;</span><span class="p">}</span>

<span class="n">r</span> <span class="o">=</span> <span class="n">requests</span><span class="o">.</span><span class="n">get</span><span class="p">(</span><span class="n">this_url</span><span class="p">,</span> <span class="n">headers</span><span class="o">=</span><span class="n">headers</span><span class="p">)</span>

<span class="nb">print</span> <span class="p">(</span><span class="n">r</span><span class="o">.</span><span class="n">ok</span><span class="p">)</span>

<span class="n">data</span> <span class="o">=</span> <span class="n">r</span><span class="o">.</span><span class="n">json</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>True
{&#39;mappings&#39;: [{&#39;original&#39;: {&#39;seq_region_name&#39;: &#39;11&#39;, &#39;strand&#39;: 1, &#39;coord_system&#39;: &#39;chromosome&#39;, &#39;end&#39;: 111959625, &#39;start&#39;: 111959625, &#39;assembly&#39;: &#39;GRCh37&#39;}, &#39;mapped&#39;: {&#39;seq_region_name&#39;: &#39;11&#39;, &#39;strand&#39;: 1, &#39;coord_system&#39;: &#39;chromosome&#39;, &#39;end&#39;: 112088901, &#39;start&#39;: 112088901, &#39;assembly&#39;: &#39;GRCh38&#39;}}]}
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Το νέο location είναι το:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[9]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">[</span><span class="s1">&#39;mappings&#39;</span><span class="p">][</span><span class="mi">0</span><span class="p">][</span><span class="s1">&#39;mapped&#39;</span><span class="p">][</span><span class="s1">&#39;start&#39;</span><span class="p">])</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>112088901
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h2 id="Biopython-/-Entrez">Biopython / Entrez<a class="anchor-link" href="#Biopython-/-Entrez">&#182;</a></h2><p>Η <a href="https://www.ncbi.nlm.nih.gov/gquery/">ENTREZ</a> είναι μία ομογενοποιημένη βάση δεδομένων από το NCBI (Το αμερικάνικο EMBL). Δυστυχώς το API της ENTREZ δεν είναι τόσο φιλικό όσο της ENSEMBL. Το <a href="https://www.ncbi.nlm.nih.gov/books/NBK25501/">documentation</a> είναι διάσπαρτο και δεν υπάρχουν πολλά παραδείγματα (<a href="https://www.ncbi.nlm.nih.gov/books/NBK25498/">Και για αυτά που υπάρχουν είναι σε perl</a> &#x1F631;).</p>
<p>Η <a href="http://biopython.org">biopython</a> είναι το πιο γνωστό και σημαντικό πακέτο της python για πρόσβαση σε γενετική πληροφορία αλλά και επεξεργασία. Από το <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">documentation</a> φαίνεται ότι πρόκειται στην ουσία για ένα ολοκληρωμένο περιβάλλον το οποίο δεν προλαβαίνουμε να καλύψουμε όλο. Εδώ θα δούμε πως μπορούμε να χρησιμοποιήσουμε την biopython για να έχουμε πρόσβαση στο NCBI μέσω του Entrez.</p>
<p>Για να εγκαταστήσουμε τη biopython τρέχουμε:</p>
<div class="highlight"><pre><span></span>pip install biopython
</pre></div>
<p><strong>ΠΡΟΣΟΧΗ:</strong>
Σας προτείνω να ρίξετε τουλάχιστον μία ματιά στο υπέροχο tutorial της biopython:
<a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html">http://biopython.org/DIST/docs/tutorial/Tutorial.html</a></p>
<p>Δύσκολα δεν θα βρείτε κάτι σχετικό με την έρευνα που κάνετε!</p>
<p>Αρχικά κάνουμε import τις βιβλιοθήκες:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[5]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">from</span> <span class="nn">Bio</span> <span class="k">import</span> <span class="n">Entrez</span>
<span class="kn">import</span> <span class="nn">pandas</span> <span class="k">as</span> <span class="nn">pd</span>

<span class="c1"># For some reason Entrez needs to know who are you</span>
<span class="c1"># but you don&#39;t have to be that honest..</span>
<span class="n">Entrez</span><span class="o">.</span><span class="n">email</span> <span class="o">=</span> <span class="s1">&#39;anonymous@gmail.com&#39;</span>  
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ας δούμε σε ποιες βάσεις δεδομένων παρέχει πρόσβαση η Entrez:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[6]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">handle</span> <span class="o">=</span> <span class="n">Entrez</span><span class="o">.</span><span class="n">einfo</span><span class="p">()</span>
<span class="n">record</span> <span class="o">=</span> <span class="n">Entrez</span><span class="o">.</span><span class="n">read</span><span class="p">(</span><span class="n">handle</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[7]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">pd</span><span class="o">.</span><span class="n">DataFrame</span><span class="p">(</span><span class="n">record</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt output_prompt">Out[7]:</div>


<div class="output_html rendered_html output_subarea output_execute_result">
<div>
<style scoped>
    .dataframe tbody tr th:only-of-type {
        vertical-align: middle;
    }

    .dataframe tbody tr th {
        vertical-align: top;
    }

    .dataframe thead th {
        text-align: right;
    }
</style>
<table border="1" class="dataframe">
  <thead>
    <tr style="text-align: right;">
      <th></th>
      <th>DbList</th>
    </tr>
  </thead>
  <tbody>
    <tr>
      <th>0</th>
      <td>pubmed</td>
    </tr>
    <tr>
      <th>1</th>
      <td>protein</td>
    </tr>
    <tr>
      <th>2</th>
      <td>nuccore</td>
    </tr>
    <tr>
      <th>3</th>
      <td>ipg</td>
    </tr>
    <tr>
      <th>4</th>
      <td>nucleotide</td>
    </tr>
    <tr>
      <th>5</th>
      <td>structure</td>
    </tr>
    <tr>
      <th>6</th>
      <td>genome</td>
    </tr>
    <tr>
      <th>7</th>
      <td>annotinfo</td>
    </tr>
    <tr>
      <th>8</th>
      <td>assembly</td>
    </tr>
    <tr>
      <th>9</th>
      <td>bioproject</td>
    </tr>
    <tr>
      <th>10</th>
      <td>biosample</td>
    </tr>
    <tr>
      <th>11</th>
      <td>blastdbinfo</td>
    </tr>
    <tr>
      <th>12</th>
      <td>books</td>
    </tr>
    <tr>
      <th>13</th>
      <td>cdd</td>
    </tr>
    <tr>
      <th>14</th>
      <td>clinvar</td>
    </tr>
    <tr>
      <th>15</th>
      <td>gap</td>
    </tr>
    <tr>
      <th>16</th>
      <td>gapplus</td>
    </tr>
    <tr>
      <th>17</th>
      <td>grasp</td>
    </tr>
    <tr>
      <th>18</th>
      <td>dbvar</td>
    </tr>
    <tr>
      <th>19</th>
      <td>gene</td>
    </tr>
    <tr>
      <th>20</th>
      <td>gds</td>
    </tr>
    <tr>
      <th>21</th>
      <td>geoprofiles</td>
    </tr>
    <tr>
      <th>22</th>
      <td>homologene</td>
    </tr>
    <tr>
      <th>23</th>
      <td>medgen</td>
    </tr>
    <tr>
      <th>24</th>
      <td>mesh</td>
    </tr>
    <tr>
      <th>25</th>
      <td>ncbisearch</td>
    </tr>
    <tr>
      <th>26</th>
      <td>nlmcatalog</td>
    </tr>
    <tr>
      <th>27</th>
      <td>omim</td>
    </tr>
    <tr>
      <th>28</th>
      <td>orgtrack</td>
    </tr>
    <tr>
      <th>29</th>
      <td>pmc</td>
    </tr>
    <tr>
      <th>30</th>
      <td>popset</td>
    </tr>
    <tr>
      <th>31</th>
      <td>proteinclusters</td>
    </tr>
    <tr>
      <th>32</th>
      <td>pcassay</td>
    </tr>
    <tr>
      <th>33</th>
      <td>protfam</td>
    </tr>
    <tr>
      <th>34</th>
      <td>biosystems</td>
    </tr>
    <tr>
      <th>35</th>
      <td>pccompound</td>
    </tr>
    <tr>
      <th>36</th>
      <td>pcsubstance</td>
    </tr>
    <tr>
      <th>37</th>
      <td>seqannot</td>
    </tr>
    <tr>
      <th>38</th>
      <td>snp</td>
    </tr>
    <tr>
      <th>39</th>
      <td>sra</td>
    </tr>
    <tr>
      <th>40</th>
      <td>taxonomy</td>
    </tr>
    <tr>
      <th>41</th>
      <td>biocollections</td>
    </tr>
    <tr>
      <th>42</th>
      <td>gtr</td>
    </tr>
  </tbody>
</table>
</div>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Για να δούμε περισσότερες πληροφορίες για όλες αυτές τις βάσεις μπορούμε να πάμε στο λινκ:</p>
<p><a href="https://www.ncbi.nlm.nih.gov/{ΟΝΟΜΑ_ΒΑΣΗΣ}">https://www.ncbi.nlm.nih.gov/{ΟΝΟΜΑ_ΒΑΣΗΣ}</a></p>
<p>Π.χ:</p>
<ul>
<li><a href="https://www.ncbi.nlm.nih.gov/sra">https://www.ncbi.nlm.nih.gov/sra</a></li>
<li><a href="https://www.ncbi.nlm.nih.gov/probe">https://www.ncbi.nlm.nih.gov/probe</a> </li>
<li>κτλ...</li>
</ul>

</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Κάθε στοιχείο της βάσης αυτή έχει ένα "id". Μπορούμε να "κατεβάσουμε" μία εγγραφή της βάσης δίνοντας το ονομα της βάσης, το id του στοιχείου και σε τι φορμάτ το θέλουμε. Για παράδειγμα μπορούμε να κατεβάσουμε σε fasta φορμάτ την ακολουθία με id: "NM_000762.5" από τη nuccore βάση. Το link αυτής της εγγραφής είναι το εξής: <a href="https://www.ncbi.nlm.nih.gov/nuccore/189339232">https://www.ncbi.nlm.nih.gov/nuccore/189339232</a></p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[8]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">handle</span> <span class="o">=</span> <span class="n">Entrez</span><span class="o">.</span><span class="n">efetch</span><span class="p">(</span>
  <span class="n">db</span><span class="o">=</span><span class="s1">&#39;nuccore&#39;</span><span class="p">,</span> 
  <span class="nb">id</span><span class="o">=</span><span class="s1">&#39;NM_000762.5&#39;</span><span class="p">,</span> 
  <span class="n">retmode</span><span class="o">=</span><span class="s1">&#39;text&#39;</span><span class="p">,</span> 
  <span class="n">rettype</span><span class="o">=</span><span class="s1">&#39;fasta&#39;</span><span class="p">,</span>
  <span class="c1">#rettype=&#39;genbank&#39;,</span>
<span class="p">)</span>

<span class="n">data</span> <span class="o">=</span> <span class="n">handle</span><span class="o">.</span><span class="n">read</span><span class="p">()</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">data</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>&gt;NM_000762.5 Homo sapiens cytochrome P450 family 2 subfamily A member 6 (CYP2A6), mRNA
ATCTATCATCCCACTACCACCATGCTGGCCTCAGGGATGCTTCTGGTGGCCTTGCTGGTCTGCCTGACTG
TAATGGTCTTGATGTCTGTTTGGCAGCAGAGGAAGAGCAAGGGGAAGCTGCCTCCGGGACCCACCCCATT
GCCCTTCATTGGAAACTACCTGCAGCTGAACACAGAGCAGATGTACAACTCCCTCATGAAGATCAGTGAG
CGCTATGGCCCCGTGTTCACCATTCACTTGGGGCCCCGGCGGGTCGTGGTGCTGTGTGGACATGATGCCG
TCAGGGAGGCTCTGGTGGACCAGGCTGAGGAGTTCAGCGGGCGAGGCGAGCAAGCCACCTTCGACTGGGT
CTTCAAAGGCTATGGCGTGGTATTCAGCAACGGGGAGCGCGCCAAGCAGCTCCGGCGCTTCTCCATCGCC
ACCCTGCGGGACTTCGGGGTGGGCAAGCGAGGCATCGAGGAGCGCATCCAGGAGGAGGCGGGCTTCCTCA
TCGACGCCCTCCGGGGCACTGGCGGCGCCAATATCGATCCCACCTTCTTCCTGAGCCGCACAGTCTCCAA
TGTCATCAGCTCCATTGTCTTTGGGGACCGCTTTGACTATAAGGACAAAGAGTTCCTGTCACTGTTGCGC
ATGATGCTAGGAATCTTCCAGTTCACGTCAACCTCCACGGGGCAGCTCTATGAGATGTTCTCTTCGGTGA
TGAAACACCTGCCAGGACCACAGCAACAGGCCTTTCAGTTGCTGCAAGGGCTGGAGGACTTCATAGCCAA
GAAGGTGGAGCACAACCAGCGCACGCTGGATCCCAATTCCCCACGGGACTTCATTGACTCCTTTCTCATC
CGCATGCAGGAGGAGGAGAAGAACCCCAACACGGAGTTCTACTTGAAAAACCTGGTGATGACCACGTTGA
ACCTCTTCATTGGGGGCACCGAGACCGTCAGCACCACCCTGCGCTATGGCTTCTTGCTGCTCATGAAGCA
CCCAGAGGTGGAGGCCAAGGTCCATGAGGAGATTGACAGAGTGATCGGCAAGAACCGGCAGCCCAAGTTT
GAGGACCGGGCCAAGATGCCCTACATGGAGGCAGTGATCCACGAGATCCAAAGATTTGGAGACGTGATCC
CCATGAGTTTGGCCCGCAGAGTCAAAAAGGACACCAAGTTTCGGGATTTCTTCCTCCCTAAGGGCACCGA
AGTGTACCCTATGCTGGGCTCTGTGCTGAGAGACCCCAGTTTCTTCTCCAACCCCCAGGACTTCAATCCC
CAGCACTTCCTGAATGAGAAGGGGCAGTTTAAGAAGAGTGATGCTTTTGTGCCCTTTTCCATCGGAAAGC
GGAACTGTTTCGGAGAAGGCCTGGCCAGAATGGAGCTCTTTCTCTTCTTCACCACCGTCATGCAGAACTT
CCGCCTCAAGTCCTCCCAGTCACCTAAGGACATTGACGTGTCCCCCAAACACGTGGGCTTTGCCACGATC
CCACGAAACTACACCATGAGCTTCCTGCCCCGCTGAGCGAGGGCTGTGCCGGTGCAGGTCTGGTGGGCGG
GGCCAGGGAAAGGGCAGGGCCAAGACCGGGCTTGGGAGAGGGGCGCAGCTAAGACTGGGGGCAGGATGGC
GGAAAGGAAGGGGCGTGGTGGCTAGAGGGAAGAGAAGAAACAGAAGCGGCTCAGTTCACCTTGATAAGGT
GCTTCCGAGCTGGGATGAGAGGAAGGAAACCCTTACATTATGCTATGAAGAGTAGTAATAATAGCAGCTC
TTATTTCCTGAGCAAAAAAAAAAAA


</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Μπορούμε τώρα να τρέξουμε <a href="https://en.wikipedia.org/wiki/BLAT_(bioinformatics%29">BLAT</a> σε αυτή την ακολουθία και να δούμε σε ποιο σημείο του ανθρώπινου γονιδιώματος ανοίκει:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[9]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">from</span> <span class="nn">Bio.Blast</span> <span class="k">import</span> <span class="n">NCBIWWW</span>
<span class="kn">from</span> <span class="nn">Bio.Blast</span> <span class="k">import</span> <span class="n">NCBIXML</span>

<span class="c1">#result_handle = NCBIWWW.qblast(&quot;blastn&quot;, &quot;refseq_genomic_human&quot;, data)</span>
<span class="n">result_handle</span> <span class="o">=</span> <span class="n">NCBIWWW</span><span class="o">.</span><span class="n">qblast</span><span class="p">(</span><span class="s2">&quot;blastn&quot;</span><span class="p">,</span> <span class="s2">&quot;nt&quot;</span><span class="p">,</span> <span class="n">data</span><span class="o">.</span><span class="n">format</span><span class="p">(</span><span class="s2">&quot;fasta&quot;</span><span class="p">))</span>
<span class="n">blast_record</span> <span class="o">=</span> <span class="n">NCBIXML</span><span class="o">.</span><span class="n">read</span><span class="p">(</span><span class="n">result_handle</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Σε πόσες ακολουθίες έγινε match;</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[10]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">len</span><span class="p">(</span><span class="n">blast_record</span><span class="o">.</span><span class="n">alignments</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt output_prompt">Out[10]:</div>


<div class="output_text output_subarea output_execute_result">
<pre>50</pre>
</div>

</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ποιες είναι αυτές;</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[11]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="k">for</span> <span class="n">x</span> <span class="ow">in</span> <span class="n">blast_record</span><span class="o">.</span><span class="n">alignments</span><span class="p">:</span>
    <span class="nb">print</span> <span class="p">(</span><span class="n">x</span><span class="o">.</span><span class="n">title</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>gi|1519246407|ref|NM_000762.6| Homo sapiens cytochrome P450 family 2 subfamily A member 6 (CYP2A6), mRNA
gi|180986|gb|M33318.1|HUMCPIIA3A Human cytochrome P450IIA3 (CYP2A3) mRNA, complete cds
gi|29546|emb|X13897.1| Human mRNA for cytochrome P-450IIA
gi|30331|emb|X13930.1| Human CYP2A4 mRNA for P-450 IIA4 protein
gi|1753053698|ref|XM_019015583.2| PREDICTED: Gorilla gorilla gorilla cytochrome P450 2A6 (LOC101146638), transcript variant X1, mRNA
gi|64654819|gb|BC096256.1| Homo sapiens cytochrome P450, family 2, subfamily A, polypeptide 6, mRNA (cDNA clone MGC:116921 IMAGE:40006068), complete cds
gi|64654814|gb|BC096255.1| Homo sapiens cytochrome P450, family 2, subfamily A, polypeptide 6, mRNA (cDNA clone MGC:116920 IMAGE:40006064), complete cds
gi|64653226|gb|BC096254.1| Homo sapiens cytochrome P450, family 2, subfamily A, polypeptide 6, mRNA (cDNA clone MGC:116919 IMAGE:40006062), complete cds
gi|109730085|gb|BC096253.3| Homo sapiens cytochrome P450, family 2, subfamily A, polypeptide 6, mRNA (cDNA clone MGC:116918 IMAGE:40006061), complete cds
gi|1351473687|ref|XM_024237332.1| PREDICTED: Pongo abelii cytochrome P450 2A6 (LOC100457048), transcript variant X1, mRNA
gi|35197|emb|X13929.1| Human CYP2A3 mRNA for P-450 IIA3 protein
gi|6470138|gb|AF182275.1|AF182275 Homo sapiens cytochrome P450-2A6 (CYP2A6) mRNA, complete cds
gi|1887789759|ref|NM_000764.3| Homo sapiens cytochrome P450 family 2 subfamily A member 7 (CYP2A7), transcript variant 1, mRNA
gi|1849054764|ref|XM_034944594.1| PREDICTED: Pan paniscus cytochrome P450 family 2 subfamily A member 7 (CYP2A7), mRNA
gi|181269|gb|M33317.1|HUMCYIIA4A Human cytochrome P450IIA4 (CYP2A4) mRNA, complete cds
gi|1367220708|ref|XM_024351394.1| PREDICTED: Pan troglodytes cytochrome P450 2A7 (LOC107966456), mRNA
gi|1008465|gb|U22029.1|HSU22029 Human cytochrome P450 (CYP2A7) mRNA, complete cds
gi|1743170194|ref|XM_003282448.4| PREDICTED: Nomascus leucogenys cytochrome P450 2A13 (LOC100579248), transcript variant X1, mRNA
gi|1800015647|ref|XM_032172847.1| PREDICTED: Hylobates moloch cytochrome P450 2A13 (LOC116480658), transcript variant X1, mRNA
gi|1751200936|ref|XM_010380822.2| PREDICTED: Rhinopithecus roxellana cytochrome P450 2A13-like (LOC104676097), transcript variant X1, mRNA
gi|795398387|ref|XM_012086802.1| PREDICTED: Cercocebus atys cytochrome P450 2A13-like (LOC105598002), transcript variant X1, mRNA
gi|1825863830|ref|XM_033224912.1| PREDICTED: Trachypithecus francoisi cytochrome P450 2A13 (LOC117091930), mRNA
gi|548960720|ref|NM_001285348.1| Macaca fascicularis cytochrome P450 family 2 subfamily A member 24 (CYP2A24), mRNA &gt;gi|71152698|gb|DQ074792.1| Macaca fascicularis cytochrome P450 2A24 (CYP2A24) mRNA, complete cds
gi|164691768|dbj|AK312964.1| Homo sapiens cDNA, FLJ93424, highly similar to Homo sapiens cytochrome P450, family 2, subfamily A, polypeptide 6 (CYP2A6), mRNA
gi|1825821225|ref|XM_033218604.1| PREDICTED: Trachypithecus francoisi cytochrome P450 2A13-like (LOC117087862), mRNA
gi|1653961540|ref|NM_000766.5| Homo sapiens cytochrome P450 family 2 subfamily A member 13 (CYP2A13), mRNA
gi|1411126738|ref|XM_025366233.1| PREDICTED: Theropithecus gelada cytochrome P450 2A13-like (LOC112612112), transcript variant X2, mRNA
gi|795398405|ref|XM_012086807.1| PREDICTED: Cercocebus atys cytochrome P450 2A13-like (LOC105598006), mRNA
gi|1351473349|ref|XM_024237225.1| PREDICTED: Pongo abelii cytochrome P450 2A13 (LOC100458875), transcript variant X1, mRNA
gi|795234893|ref|XM_011952499.1| PREDICTED: Colobus angolensis palliatus cytochrome P450 2A13-like (LOC105519195), transcript variant X1, mRNA
gi|1622890953|ref|XM_028838334.1| PREDICTED: Macaca mulatta cytochrome P450, family 2, subfamily A, polypeptide 24 (CYP2A24), transcript variant X1, mRNA
gi|1849062391|ref|XM_003812465.2| PREDICTED: Pan paniscus cytochrome P450 family 2 subfamily A member 13 (CYP2A13), mRNA
gi|1788688032|ref|XM_023229274.3| PREDICTED: Piliocolobus tephrosceles cytochrome P450 2A13 (LOC111554025), transcript variant X1, mRNA
gi|1411126736|ref|XM_025366232.1| PREDICTED: Theropithecus gelada cytochrome P450 2A13-like (LOC112612112), transcript variant X1, mRNA
gi|649118244|gb|KJ896677.1| Synthetic construct Homo sapiens clone ccsbBroadEn_06071 CYP2A6 gene, encodes complete protein
gi|1147694741|emb|LT740833.1| Human ORFeome Gateway entry vector pENTR223-CYP2A6, complete sequence
gi|823673899|gb|KR711779.1| Synthetic construct Homo sapiens clone CCSBHm_00030839 CYP2A6 (CYP2A6) mRNA, encodes complete protein
gi|823673897|gb|KR711778.1| Synthetic construct Homo sapiens clone CCSBHm_00030834 CYP2A6 (CYP2A6) mRNA, encodes complete protein
gi|823673895|gb|KR711777.1| Synthetic construct Homo sapiens clone CCSBHm_00030831 CYP2A6 (CYP2A6) mRNA, encodes complete protein
gi|823673893|gb|KR711776.1| Synthetic construct Homo sapiens clone CCSBHm_00030829 CYP2A6 (CYP2A6) mRNA, encodes complete protein
gi|795398351|ref|XM_012086792.1| PREDICTED: Cercocebus atys cytochrome P450 2A13 (LOC105597997), transcript variant X3, mRNA
gi|795398348|ref|XM_012086791.1| PREDICTED: Cercocebus atys cytochrome P450 2A13 (LOC105597997), transcript variant X2, mRNA
gi|795398345|ref|XM_012086790.1| PREDICTED: Cercocebus atys cytochrome P450 2A13 (LOC105597997), transcript variant X1, mRNA
gi|544525941|ref|XM_005595716.1| PREDICTED: Macaca fascicularis cytochrome P450 2A13-like (LOC102143277), mRNA
gi|1751208157|ref|XM_030913665.1| PREDICTED: Rhinopithecus roxellana cytochrome P450 2A13 (LOC104676180), mRNA
gi|1753052882|ref|XM_031004339.1| PREDICTED: Gorilla gorilla gorilla cytochrome P450 2A13 (LOC101127384), mRNA
gi|795137501|ref|XM_011936512.1| PREDICTED: Colobus angolensis palliatus cytochrome P450 2A13 (LOC105507828), transcript variant X1, mRNA
gi|1825820915|ref|XM_033216130.1| PREDICTED: Trachypithecus francoisi cytochrome P450 2A13-like (LOC117086673), mRNA
gi|1751201107|ref|XM_010380820.2| PREDICTED: Rhinopithecus roxellana cytochrome P450 2A13 (LOC104676095), mRNA
gi|1381460778|ref|XM_011764694.2| PREDICTED: Macaca nemestrina cytochrome P450 2A13 (LOC105495313), mRNA
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ας πάρουμε το πρώτο:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[12]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">first_alignment</span> <span class="o">=</span> <span class="n">blast_record</span><span class="o">.</span><span class="n">alignments</span><span class="p">[</span><span class="mi">0</span><span class="p">]</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Το κάθε alignment έχει πολλά "hsps". Σύμφωνα με το <a href="http://biopython.org/DIST/docs/tutorial/Tutorial.html#htoc105">documentation</a>:</p>

<pre><code>HSP (high-scoring pair) represents region(s) in the hit sequence that contains significant alignment(s) to the query sequence. It contains the actual match between your query sequence and a database entry. As this match is determined by the sequence search tool’s algorithms, the HSP object contains the bulk of the statistics computed by the search tool. This also makes the distinction between HSP objects from different search tools more apparent compared to the differences you’ve seen in QueryResult or Hit objects.</code></pre>
<p>Ας πάρουμε το πρώτο:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[13]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">first_hsp</span> <span class="o">=</span> <span class="n">first_alignment</span><span class="o">.</span><span class="n">hsps</span><span class="p">[</span><span class="mi">0</span><span class="p">]</span>
</pre></div>

    </div>
</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Μπορούμε να τυπώσουμε το match:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[14]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="n">first_hsp</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>Score 3522 (3177 bits), expectation 0.0e+00, alignment length 1761
Query:       1 ATCTATCATCCCACTACCACCATGCTGGCCTCAGGGATGCTTCTG...TGA 1761
               |||||||||||||||||||||||||||||||||||||||||||||...|||
Sbjct:       1 ATCTATCATCCCACTACCACCATGCTGGCCTCAGGGATGCTTCTG...TGA 1761
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Επίσης μπορούμε να πάρουμε πληροφορίες για το match:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[15]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="nb">print</span> <span class="p">(</span><span class="s1">&#39;Subject start:&#39;</span><span class="p">,</span> <span class="n">first_hsp</span><span class="o">.</span><span class="n">sbjct_start</span><span class="p">)</span>
<span class="nb">print</span> <span class="p">(</span><span class="s1">&#39;Subject end:&#39;</span><span class="p">,</span> <span class="n">first_hsp</span><span class="o">.</span><span class="n">sbjct_end</span><span class="p">)</span>
<span class="nb">print</span> <span class="p">(</span><span class="s1">&#39;Query start:&#39;</span><span class="p">,</span> <span class="n">first_hsp</span><span class="o">.</span><span class="n">query_start</span><span class="p">)</span>
<span class="nb">print</span> <span class="p">(</span><span class="s1">&#39;Query end:&#39;</span><span class="p">,</span> <span class="n">first_hsp</span><span class="o">.</span><span class="n">query_end</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>Subject start: 1
Subject end: 1761
Query start: 1
Query end: 1761
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Ας δούμε πως είναι και ένα "κακό" alignment:</p>

</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[16]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="n">last_alignment</span> <span class="o">=</span> <span class="n">blast_record</span><span class="o">.</span><span class="n">alignments</span><span class="p">[</span><span class="o">-</span><span class="mi">1</span><span class="p">]</span>
<span class="n">last_hsp</span> <span class="o">=</span> <span class="n">last_alignment</span><span class="o">.</span><span class="n">hsps</span><span class="p">[</span><span class="o">-</span><span class="mi">1</span><span class="p">]</span>
<span class="nb">print</span> <span class="p">(</span><span class="n">last_hsp</span><span class="p">)</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>Score 2873 (2591 bits), expectation 0.0e+00, alignment length 1765
Query:       1 ATCTATCATCCCACTACCACCATGCTGGCCTCAGGGATGCTTCTG...CAA 1765
               ||| ||||||||||| || ||||||||||||||||| |||| |||...|||
Sbjct:     564 ATCGATCATCCCACTGCCCCCATGCTGGCCTCAGGGCTGCTCCTG...CAA 2310
</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h3 id="Paiwise-alignment-&#956;&#949;-biopython">Paiwise alignment &#956;&#949; biopython<a class="anchor-link" href="#Paiwise-alignment-&#956;&#949;-biopython">&#182;</a></h3>
</div>
</div>
</div>
<div class="cell border-box-sizing code_cell rendered">
<div class="input">
<div class="prompt input_prompt">In&nbsp;[17]:</div>
<div class="inner_cell">
    <div class="input_area">
<div class=" highlight hl-ipython3"><pre><span></span><span class="kn">from</span> <span class="nn">Bio</span> <span class="k">import</span> <span class="n">pairwise2</span>
<span class="kn">from</span> <span class="nn">Bio.pairwise2</span> <span class="k">import</span> <span class="n">format_alignment</span>

<span class="n">alignments</span> <span class="o">=</span> <span class="n">pairwise2</span><span class="o">.</span><span class="n">align</span><span class="o">.</span><span class="n">globalxx</span><span class="p">(</span><span class="s2">&quot;ACCGT&quot;</span><span class="p">,</span> <span class="s2">&quot;ACG&quot;</span><span class="p">)</span>
<span class="nb">print</span><span class="p">(</span><span class="n">format_alignment</span><span class="p">(</span><span class="o">*</span><span class="n">alignments</span><span class="p">[</span><span class="mi">0</span><span class="p">]))</span>
</pre></div>

    </div>
</div>
</div>

<div class="output_wrapper">
<div class="output">


<div class="output_area">

    <div class="prompt"></div>


<div class="output_subarea output_stream output_stdout output_text">
<pre>ACCGT
| || 
A-CG-
  Score=3

</pre>
</div>
</div>

</div>
</div>

</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<h1 id="&#902;&#955;&#955;&#949;&#962;-&#946;&#940;&#963;&#949;&#953;&#962;-&#948;&#949;&#948;&#959;&#956;&#941;&#957;&#969;&#957;">&#902;&#955;&#955;&#949;&#962; &#946;&#940;&#963;&#949;&#953;&#962; &#948;&#949;&#948;&#959;&#956;&#941;&#957;&#969;&#957;<a class="anchor-link" href="#&#902;&#955;&#955;&#949;&#962;-&#946;&#940;&#963;&#949;&#953;&#962;-&#948;&#949;&#948;&#959;&#956;&#941;&#957;&#969;&#957;">&#182;</a></h1>
</div>
</div>
</div>
<div class="cell border-box-sizing text_cell rendered"><div class="prompt input_prompt">
</div><div class="inner_cell">
<div class="text_cell_render border-box-sizing rendered_html">
<p>Γενικότερα το τοπίο με της online βάσεις γενομικών δεδομένων είναι αρκετά δυναμικό. Καινούργιες βάσεις προστίθονται, νέα APIs κτλ. Σε επίπεδα οργανισμών υπάρχουν δύο μεγάλοι το NCBI και το EMBL. Το NCBI έχει ομαδοποιήσει όλες τις βάσεις δεδομένων με το σύστημα Entrez, ενώ το EMBL έχει το <a href="https://rest.ensembl.org/">REST API</a>. Άλλες αντιστοιχίες είναι:</p>
<table>
<thead><tr>
<th>Service</th>
<th><a href="https://www.embl.de/">EMBL</a></th>
<th><a href="https://www.ncbi.nlm.nih.gov/">NCBI</a></th>
</tr>
</thead>
<tbody>
<tr>
<td>Variant Annotation</td>
<td><a href="https://www.ensembl.org/info/docs/tools/vep/index.html">VEP</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/variation/tools/reporter">Variation Reporter</a></td>
</tr>
<tr>
<td>Raw Sequencing Data</td>
<td><a href="https://www.ebi.ac.uk/ena">European Nucleotide Archive</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/sra">SRA</a></td>
</tr>
<tr>
<td>Expression Data</td>
<td><a href="https://www.ebi.ac.uk/arrayexpress/">ArrayExpress</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/geo/">Gene Expression Omnibus</a></td>
</tr>
<tr>
<td>Phenotype</td>
<td><a href="https://www.ebi.ac.uk/ega/home">EGA (European Genome-Phenome Archive)</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/gap">dbGAP</a></td>
</tr>
<tr>
<td>Mutation Database</td>
<td><a href="http://www.ensembl.org/index.html">Ensembl</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/projects/SNP/">dbSNP</a> </td>
</tr>
<tr>
<td>Genomic Browsers</td>
<td><a href="http://www.ensembl.org/Homo_sapiens/Location/View?r=17:63992802-64038237">Ensembl</a></td>
<td><a href="https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&amp;lastVirtModeType=default&amp;lastVirtModeExtraState=&amp;virtModeType=default&amp;virtMode=0&amp;nonVirtPosition=&amp;position=chr17%3A63992802%2D64038237&amp;hgsid=654038027_kzafCuBRWkvSS4Uq55z0pjldJcyS">UCSC</a></td>
</tr>
<tr>
<td>Location converters</td>
<td><a href="https://rest.ensembl.org/documentation/info/assembly_map">REST API (map)</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/genome/tools/remap">remap</a></td>
</tr>
<tr>
<td>Query services</td>
<td><a href="https://rest.ensembl.org/">REST API</a></td>
<td><a href="https://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Entrez/">Entrez</a></td>
</tr>
</tbody>
</table>
<p>Εκτός από ENSEMBL/NCBI μια άλλη πολύ καλή βάση είναι:</p>
<ul>
<li><a href="http://mygene.info/">MyGene</a>, <a href="http://myvariant.info/">MyVariant</a> . Πολύ μοντέρνο API, φιλικό και καλή οργάνωση πληροφορίας. Δοκιμάστε το: <a href="http://myvariant.info/v1/api">http://myvariant.info/v1/api</a> . Το αρνητικό του είναι ότι περιέχει ΜΟΝΟ πληροφορίες για variants (π.χ. δεν έχει transcripts, proteins, ...)</li>
</ul>

</div>
</div>
</div>
    </div>
  </div>
</body>

 
</html>