- rust lcp arrays. kasai algorithm says that use a inverse suffix tree but that is cost consuming. Instead, i implemented a string compression way so that it estimates the proportion of the match based on the ith offset for the i+1 offset. Also dropped two offset, as the string lower than the pre-string will not have a suffix match thus enabling faster search.
- general note: Incase of Golang and RUST, please see the last commit message and if it says compiled binary then it is completed or else still in development version.
cargo build
➜ gauravsablok rust-suffix-lcp git:(main) ✗ ./target/debug/rust-lcp-arrays -h
Usage: rust-lcp-arrays <LCPARRAY_ARG>
Arguments:
<LCPARRAY_ARG> please provide the path to the fastq file
Options:
-h, --help Print help
-V, --version Print version
- to run the binary
./rust-lcp-arrays ./sample-files/sample.fasta
{[28, 19, 24, 15, 11, 7, 21, 4, 0, 20, 3, 25, 16, 12, 8, 27, 18, 23, 14, 10, 6, 2, 26, 17, 22, 13, 9, 5, 1]: LCPArray { suffixindex: [28, 19, 24, 15, 11, 7, 21, 4, 0, 20, 3, 25, 16, 12, 8, 27, 18, 23, 14, 10, 6, 2, 26, 17, 22, 13, 9, 5, 1], suffixarray: ["A", "ACATGACTGA", "ACTGA", "ACTGACATGACTGA", "ACTGACTGACATGACTGA", "ACTGACTGACTGACATGACTGA", "ATGACTGA", "ATGACTGACTGACTGACATGACTGA", "ATGCATGACTGACTGACTGACATGACTGA", "CATGACTGA", "CATGACTGACTGACTGACATGACTGA", "CTGA", "CTGACATGACTGA", "CTGACTGACATGACTGA", "CTGACTGACTGACATGACTGA", "GA", "GACATGACTGA", "GACTGA", "GACTGACATGACTGA", "GACTGACTGACATGACTGA", "GACTGACTGACTGACATGACTGA", "GCATGACTGACTGACTGACATGACTGA", "TGA", "TGACATGACTGA", "TGACTGA", "TGACTGACATGACTGA", "TGACTGACTGACATGACTGA", "TGACTGACTGACTGACATGACTGA", "TGCATGACTGACTGACTGACATGACTGA"], lcparray: [1, 0, 5, 0, 0, 0, 8, 0, 0, 9, 0, 4, 0, 0, 0, 2, 0, 6, 0, 0, 0, 0, 3, 0, 7, 0, 0, 0, 0] }}
Gaurav Sablok