Shipping to ECL

[ctelmer]

To ship from a third party like IDT you need to have the address when you order:

Emerald Cloud Lab
Laboratory Operations
844 Dubuque Ave.
South San Francisco
California 94080
USA

Note that if you are at CMU we do not get tax exemption for shipments to California.

[ctelmer]

Then in Command Center you will want to Upload your molecules to get a Model that you are ordering and DropShip those models.

[ctelmer]

UploadOligomer[
{
"CFTRex10F", "CFTRex10R"
},
Molecule ->
{
Strand[DNA["ACTTCACTTCTAATGGTGATTATG"]],
Strand[DNA["CTCTTCTAGTTGGCATGC"]]
},
PolymerType -> DNA
]

[ctelmer]

If you are shipping samples directly to ECL then you Upload your molecules and ShipToECL your samples.