diff --git a/.github/workflows/build.yaml b/.github/workflows/build.yaml
index 325609c..64f23d7 100644
--- a/.github/workflows/build.yaml
+++ b/.github/workflows/build.yaml
@@ -47,7 +47,7 @@ jobs:
         run: |
           mkdir build
           cd build
-          cmake -DCMAKE_C_COMPILER=gcc-11 -DCMAKE_CXX_COMPILER=g++-11 ..
+          cmake -DCMAKE_C_COMPILER=gcc-11 -DCMAKE_CXX_COMPILER=g++-11 -DSKIP_PYTHON=1 ..
           make
           make test
 
diff --git a/.gitignore b/.gitignore
index e8b352a..b83277b 100644
--- a/.gitignore
+++ b/.gitignore
@@ -11,3 +11,4 @@ python/docs/_generated
 __pycache__
 cobs*.tar
 cobs*.tar.gz
+!tests/data/non_acgt_test/index.cobs_classic
diff --git a/cobs/util/query.cpp b/cobs/util/query.cpp
index 98dd82d..6ab9256 100644
--- a/cobs/util/query.cpp
+++ b/cobs/util/query.cpp
@@ -140,44 +140,44 @@ void destroy_mmap(MMapHandle& handle)
     close_file(handle.fd);
 }
 
-//! forward character map. A -> A, C -> C, G -> G, T -> T. rest maps to zero.
+//! forward character map. A -> A, C -> C, G -> G, T -> T. rest also maps to A to handle non-ACGT bases and not error out.
 static const char canonicalize_basepair_forward_map[256] = {
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 65, 0, 67, 0, 0, 0, 71, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 84, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 67, 65, 65, 65, 71, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 84, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
+    65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65, 65,
 };
 
-//! reverse character map. A -> T, C -> G, G -> C, T -> A. rest maps to zero.
+//! reverse character map. A -> T, C -> G, G -> C, T -> A. rest also maps to T to handle non-ACGT bases and not error out.
 static const char canonicalize_basepair_reverse_map[256] = {
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 84, 0, 71, 0, 0, 0, 67, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 65, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
-    0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 71, 84, 84, 84, 67, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 65, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
+    84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84, 84,
 };
 
 bool canonicalize_kmer(const char* input, char* output, uint64_t size)
diff --git a/tests/data/non_acgt_test/index.cobs_classic b/tests/data/non_acgt_test/index.cobs_classic
new file mode 100644
index 0000000..2caef36
Binary files /dev/null and b/tests/data/non_acgt_test/index.cobs_classic differ
diff --git a/tests/data/non_acgt_test/test_1.fastq.gz b/tests/data/non_acgt_test/test_1.fastq.gz
new file mode 100644
index 0000000..b4bdd21
Binary files /dev/null and b/tests/data/non_acgt_test/test_1.fastq.gz differ
diff --git a/tests/data/non_acgt_test/truth.out b/tests/data/non_acgt_test/truth.out
new file mode 100644
index 0000000..f0544c7
--- /dev/null
+++ b/tests/data/non_acgt_test/truth.out
@@ -0,0 +1,184 @@
+*ERR5069949.2151832	1
+genome	120
+*ERR5069949.576388	1
+genome	47
+*ERR5069949.501486	1
+genome	116
+*ERR5069949.1331889	1
+genome	102
+*ERR5069949.2161340	1
+genome	50
+*ERR5069949.973930	0
+*ERR5069949.2417063	1
+genome	120
+*ERR5069949.376959	1
+genome	121
+*ERR5069949.1088785	0
+*ERR5069949.1066259	1
+genome	117
+*ERR5069949.2832676	1
+genome	109
+*ERR5069949.2953930	1
+genome	121
+*ERR5069949.324865	0
+*ERR5069949.2185111	1
+genome	104
+*ERR5069949.937422	1
+genome	100
+*ERR5069949.2431709	0
+*ERR5069949.1246538	1
+genome	118
+*ERR5069949.1189252	1
+genome	68
+*ERR5069949.2216307	1
+genome	98
+*ERR5069949.3273002	1
+genome	97
+*ERR5069949.3277445	1
+genome	121
+*ERR5069949.3022231	1
+genome	117
+*ERR5069949.184542	0
+*ERR5069949.540529	1
+genome	119
+*ERR5069949.686090	1
+genome	114
+*ERR5069949.2787556	1
+genome	63
+*ERR5069949.2650879	1
+genome	120
+*ERR5069949.2064910	1
+genome	102
+*ERR5069949.2328704	1
+genome	120
+*ERR5069949.1067032	1
+genome	99
+*ERR5069949.3338256	1
+genome	121
+*ERR5069949.1412839	1
+genome	117
+*ERR5069949.1538968	1
+genome	120
+*ERR5069949.147998	1
+genome	64
+*ERR5069949.366975	1
+genome	76
+*ERR5069949.1372331	1
+genome	121
+*ERR5069949.1709367	1
+genome	94
+*ERR5069949.2388984	1
+genome	120
+*ERR5069949.1132353	1
+genome	120
+*ERR5069949.1151736	1
+genome	121
+*ERR5069949.479807	1
+genome	120
+*ERR5069949.2176303	1
+genome	121
+*ERR5069949.2772897	1
+genome	117
+*ERR5069949.1020777	1
+genome	92
+*ERR5069949.465452	1
+genome	98
+*ERR5069949.1704586	1
+genome	119
+*ERR5069949.1258508	1
+genome	121
+*ERR5069949.986441	0
+*ERR5069949.2674295	1
+genome	118
+*ERR5069949.885966	0
+*ERR5069949.2342766	1
+genome	121
+*ERR5069949.3122970	1
+genome	97
+*ERR5069949.3279513	0
+*ERR5069949.309410	1
+genome	121
+*ERR5069949.532979	1
+genome	119
+*ERR5069949.2888794	1
+genome	121
+*ERR5069949.2205229	1
+genome	112
+*ERR5069949.786562	1
+genome	121
+*ERR5069949.919671	1
+genome	121
+*ERR5069949.1328186	1
+genome	121
+*ERR5069949.870926	1
+genome	119
+*ERR5069949.2257580	1
+genome	121
+*ERR5069949.3249622	0
+*ERR5069949.611123	1
+genome	95
+*ERR5069949.651338	0
+*ERR5069949.169513	1
+genome	62
+*ERR5069949.155944	0
+*ERR5069949.2033605	1
+genome	120
+*ERR5069949.2730382	1
+genome	112
+*ERR5069949.2125592	1
+genome	120
+*ERR5069949.1062611	1
+genome	121
+*ERR5069949.1778133	1
+genome	117
+*ERR5069949.3057020	1
+genome	60
+*ERR5069949.2972968	0
+*ERR5069949.2734474	1
+genome	119
+*ERR5069949.856527	1
+genome	100
+*ERR5069949.2098070	1
+genome	121
+*ERR5069949.1552198	1
+genome	120
+*ERR5069949.2385514	1
+genome	120
+*ERR5069949.2270078	1
+genome	121
+*ERR5069949.114870	1
+genome	120
+*ERR5069949.2668880	1
+genome	117
+*ERR5069949.257821	1
+genome	109
+*ERR5069949.2243023	1
+genome	120
+*ERR5069949.2605155	1
+genome	116
+*ERR5069949.1340552	1
+genome	121
+*ERR5069949.1561137	1
+genome	120
+*ERR5069949.2361683	1
+genome	119
+*ERR5069949.2521353	0
+*ERR5069949.1261808	0
+*ERR5069949.2734873	1
+genome	68
+*ERR5069949.3017828	1
+genome	77
+*ERR5069949.573706	1
+genome	97
+*ERR5069949.1980512	1
+genome	121
+*ERR5069949.1014693	1
+genome	120
+*ERR5069949.3184655	1
+genome	120
+*ERR5069949.29668	0
+*ERR5069949.3258358	0
+*ERR5069949.1476386	1
+genome	121
+*ERR5069949.2415814	1
+genome	120
diff --git a/tests/non_acgt_test.cpp b/tests/non_acgt_test.cpp
new file mode 100644
index 0000000..b0186af
--- /dev/null
+++ b/tests/non_acgt_test.cpp
@@ -0,0 +1,35 @@
+#include "test_util.hpp"
+#include <cobs/util/fs.hpp>
+#include <gtest/gtest.h>
+
+namespace fs = cobs::fs;
+
+static fs::path base_dir = "data/non_acgt_test";
+static fs::path work_dir = base_dir / "work";
+
+class non_acgt_test : public ::testing::Test
+{
+protected:
+  static void SetUpTestSuite() {
+    cobs::error_code ec;
+    fs::create_directories(work_dir, ec);
+  }
+  static void TearDownTestSuite() {
+    cobs::error_code ec;
+    fs::remove_all(work_dir, ec);
+  }
+};
+
+
+TEST_F(non_acgt_test, non_acgt_test_main_test) {
+    fs::path index_file{base_dir / "index.cobs_classic"};
+    cobs::ClassicSearch s(index_file.string());
+    fs::path query_file{base_dir / "test_1.fastq.gz"};
+    auto query_out_filepath = work_dir / "query.out";
+    std::ofstream query_out_fh(query_out_filepath.string());
+    cobs::process_query(s, 0.80000000000000004, 0, "", query_file.string(), query_out_fh);
+    query_out_fh.close();
+    assert_equals_files_with_paths(
+      base_dir / "truth.out",
+      query_out_filepath);
+}
diff --git a/tests/util.cpp b/tests/util.cpp
index 046a17c..4c09875 100644
--- a/tests/util.cpp
+++ b/tests/util.cpp
@@ -50,13 +50,13 @@ TEST(util, kmer_canonicalize) {
 
     // one kmer already canonical but containing invalid letters
     test_kmer("AGGAAAGTCTTTTACGCTGGGXXXAGAGTGA",
-              "AGGAAAGTCTTTTACGCTGGG\0\0\0AGAGTGA", false);
+              "AGGAAAGTCTTTTACGCTGGGAAAAGAGTGA", true);
     // one k-mer needing flipping containing invalid letters
     test_kmer("TGGAAAGTCTTTTACGCTGGGXXXAGAGTGA",
-              "TCACTCT\0\0\0CCCAGCGTAAAAGACTTTCCA", false);
+              "TCACTCTTTTCCCAGCGTAAAAGACTTTCCA", true);
     // one kmer containing the invalid letter at the center
     test_kmer("AAAAAAAAAAAAAAAXTTTTTTTTTTTTTTT",
-              "AAAAAAAAAAAAAAA\0TTTTTTTTTTTTTTT", false);
+              "AAAAAAAAAAAAAAAATTTTTTTTTTTTTTT", true);
 }
 
 /******************************************************************************/