Skip to content

spoa non-zero exit status 132  #3

@anshulbudhraja

Description

@anshulbudhraja

I was trying to generate hmm file for future use in pychopper using the command:
hp_bootstrap.py -f /home/anshul1/scratch/seq/our_primers.fas -o $outDir $inDir/${filename}.fastq
(Input reads: 74M)
when I faced the following error:

Aligning primer regions using spoa: /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
/bin/sh: line 1: 327333 Illegal instruction     (core dumped) spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
Traceback (most recent call last):
  File "/home/anshul1/virtual_envs/pychopper/bin/hp_bootstrap.py", line 95, in <module>
    spoa.spoa_align(qd[1], aln)
  File "/home/anshul1/virtual_envs/pychopper/lib/python3.10/site-packages/hammerpede/spoa.py", line 8, in spoa_align
    sp.check_call(cmd, shell=True)
  File "/cvmfs/soft.computecanada.ca/easybuild/software/2020/avx2/Core/python/3.10.2/lib/python3.10/subprocess.py", line 369, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command 'spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta' returned non-zero exit status 132.

My primers were:

$ cat /home/anshul1/scratch/seq/our_primers.fas
>REV
TCTTTCCCTACACGACGCTCTTCCGATCT
>FRW
AAGCAGTGGTATCAACGCAGAGTGAATGGG

More details:

Complete script:

$ cat pychopperHMM_script.sh
#!/bin/bash -l
#SBATCH --error=/home/anshul1/scratch/seq/%x_err_%A_%a.txt
#SBATCH --time=1-10:00:00
#SBATCH --output=/home/anshul1/scratch/seq/%x_out_%A_%a.out
#SBATCH --cpus-per-task=2
#SBATCH --job-name=HMMpychopper
#SBATCH --array=1
#SBATCH --mem-per-cpu=30G
#SBATCH --account=def-noncodo

inDir="/home/anshul1/projects/def-noncodo/anshul1/2023-12-15_seq_JURK_HEK_1"
outDir="/home/anshul1/scratch/seq/pychopper_out5_hmm"
filename="seq_run1n2"

##activating PyChopper virtualenv
module load StdEnv/2020 gcc/9.3.0 parasail python/3.10 spoa/3.4.0
source ~/virtual_envs/pychopper/bin/activate
python -c 'import parasail'
python -c 'import pychopper'
python -c 'import tqdm'
##command:
hp_bootstrap.py -f /home/anshul1/scratch/seq/our_primers.fas -o $outDir $inDir/${filename}.fastq
##pychopper -m hmm -g ${outDir}/FRW_REV.hmm -c primer_config.txt -t 46 -r $outDir/${filename}_report.pdf -S $outDir/${filename}_statistics.tsv -u $outDir/${filename}_unclassified.fastq -w $outDir/${filename}_rescued.fastq $inDir/${filename}.fastq.gz $outDir/${filename}_full_output.fastq

Complete error file:

$ cat HMMpychopper_err_29241032_1.txt

Lmod is automatically replacing "intel/2020.1.217" with "gcc/9.3.0".


Due to MODULEPATH changes, the following have been reloaded:
  1) mii/1.1.2

The following have been reloaded with a version change:
  1) StdEnv/2023 => StdEnv/2020
  2) blis/0.9.0 => blis/0.8.1
  3) flexiblas/3.3.1 => flexiblas/3.0.4
  4) gcc/12.3 => gcc/9.3.0
  5) gcccore/.12.3 => gcccore/.9.3.0
  6) gentoo/2023 => gentoo/2020
  7) libfabric/1.18.0 => libfabric/1.10.1
  8) openmpi/4.1.5 => openmpi/4.0.3
  9) ucx/1.14.1 => ucx/1.8.0

  0%|          | 0/120138152530 [00:00<?, ?it/s]Extracting primer regions from reads in /home/anshul1/projects/def-noncodo/anshul1/2023-12-15_seq_JURK_HEK_1/seq_run1n2.fastq
100%|██████████| 120138152530/120138152530 [24:13:40<00:00, 1377404.48it/s]
Aligning primer regions using spoa: /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
/bin/sh: line 1: 327333 Illegal instruction     (core dumped) spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
Traceback (most recent call last):
  File "/home/anshul1/virtual_envs/pychopper/bin/hp_bootstrap.py", line 95, in <module>
    spoa.spoa_align(qd[1], aln)
  File "/home/anshul1/virtual_envs/pychopper/lib/python3.10/site-packages/hammerpede/spoa.py", line 8, in spoa_align
    sp.check_call(cmd, shell=True)
  File "/cvmfs/soft.computecanada.ca/easybuild/software/2020/avx2/Core/python/3.10.2/lib/python3.10/subprocess.py", line 369, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command 'spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta' returned non-zero exit status 132.

Output folder:

$ ls -lh
total 2.4G
-rw-rw----. 1 anshul1 anshul1  1.9G May 22 09:54 hits_-FRW.fasta
-rw-rw----. 1 anshul1 anshul1  2.1G May 22 09:54 hits_-REV.fasta
-rw-rw----. 1 anshul1 anshul1  2.0G May 22 09:54 hits_FRW.fasta
-rw-rw----. 1 anshul1 anshul1 1019M May 22 09:54 hits_REV.fasta
-rw-rw----. 1 anshul1 anshul1     0 May 22 09:54 spoa_aln_hits_REV.fasta

My virtual env & its installed packages:

$ pip list --local
Package         Version
--------------- -------------------------
biopython       1.81+computecanada
contourpy       1.2.0+computecanada
cycler          0.12.1+computecanada
edlib           1.3.9+computecanada
exceptiongroup  1.2.1
fonttools       4.51.0+computecanada
Hammerpede      0.1.0
iniconfig       2.0.0+computecanada
kiwisolver      1.4.5+computecanada
matplotlib      3.7.2+computecanada
numpy           1.25.2+computecanada
packaging       24.0
pandas          2.1.1+computecanada
parasail        1.2.4+computecanada
Pillow          10.1.0+computecanada
pip             24.0+computecanada
pluggy          1.5.0+computecanada
pychopper       2.7.9
pyparsing       3.0.9+computecanada
pysam           0.22.0+computecanada
pytest          8.2.0+computecanada
python_dateutil 2.9.0.post0+computecanada
pytz            2024.1+computecanada
setuptools      69.2.0
six             1.16.0+computecanada
tomli           2.0.1+computecanada
tqdm            4.26.0
tzdata          2024.1+computecanada
wheel           0.43.0

Any help in resolving the same would be much appreciated

Metadata

Metadata

Assignees

No one assigned

    Labels

    No labels
    No labels

    Type

    No type

    Projects

    No projects

    Milestone

    No milestone

    Relationships

    None yet

    Development

    No branches or pull requests

    Issue actions