diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml
new file mode 100644
index 00000000..17a04ef2
--- /dev/null
+++ b/modules/nf-core/cat/cat/environment.yml
@@ -0,0 +1,7 @@
+name: cat_cat
+channels:
+  - conda-forge
+  - bioconda
+  - defaults
+dependencies:
+  - conda-forge::pigz=2.3.4
diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf
new file mode 100644
index 00000000..970ab760
--- /dev/null
+++ b/modules/nf-core/cat/cat/main.nf
@@ -0,0 +1,70 @@
+process CAT_CAT {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/pigz:2.3.4' :
+        'biocontainers/pigz:2.3.4' }"
+
+    input:
+    tuple val(meta), path(files_in)
+
+    output:
+    tuple val(meta), path("${prefix}"), emit: file_out
+    path "versions.yml"               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def args2 = task.ext.args2 ?: ''
+    def file_list = files_in.collect { it.toString() }
+
+    // | input     | output     | command1 | command2 |
+    // |-----------|------------|----------|----------|
+    // | gzipped   | gzipped    | cat      |          |
+    // | ungzipped | ungzipped  | cat      |          |
+    // | gzipped   | ungzipped  | zcat     |          |
+    // | ungzipped | gzipped    | cat      | pigz     |
+
+    // Use input file ending as default
+    prefix   = task.ext.prefix ?: "${meta.id}${file_list[0].substring(file_list[0].lastIndexOf('.'))}"
+    out_zip  = prefix.endsWith('.gz')
+    in_zip   = file_list[0].endsWith('.gz')
+    command1 = (in_zip && !out_zip) ? 'zcat' : 'cat'
+    command2 = (!in_zip && out_zip) ? "| pigz -c -p $task.cpus $args2" : ''
+    if(file_list.contains(prefix.trim())) {
+        error "The name of the input file can't be the same as for the output prefix in the " +
+        "module CAT_CAT (currently `$prefix`). Please choose a different one."
+    }
+    """
+    $command1 \\
+        $args \\
+        ${file_list.join(' ')} \\
+        $command2 \\
+        > ${prefix}
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
+    END_VERSIONS
+    """
+
+    stub:
+    def file_list   = files_in.collect { it.toString() }
+    prefix          = task.ext.prefix ?: "${meta.id}${file_list[0].substring(file_list[0].lastIndexOf('.'))}"
+    if(file_list.contains(prefix.trim())) {
+        error "The name of the input file can't be the same as for the output prefix in the " +
+        "module CAT_CAT (currently `$prefix`). Please choose a different one."
+    }
+    """
+    touch $prefix
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
+    END_VERSIONS
+    """
+}
diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml
new file mode 100644
index 00000000..00a8db0b
--- /dev/null
+++ b/modules/nf-core/cat/cat/meta.yml
@@ -0,0 +1,36 @@
+name: cat_cat
+description: A module for concatenation of gzipped or uncompressed files
+keywords:
+  - concatenate
+  - gzip
+  - cat
+tools:
+  - cat:
+      description: Just concatenation
+      documentation: https://man7.org/linux/man-pages/man1/cat.1.html
+      licence: ["GPL-3.0-or-later"]
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - files_in:
+      type: file
+      description: List of compressed / uncompressed files
+      pattern: "*"
+output:
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - file_out:
+      type: file
+      description: Concatenated file. Will be gzipped if file_out ends with ".gz"
+      pattern: "${file_out}"
+authors:
+  - "@erikrikarddaniel"
+  - "@FriederikeHanssen"
+maintainers:
+  - "@erikrikarddaniel"
+  - "@FriederikeHanssen"
diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test
new file mode 100644
index 00000000..ed5a4f12
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/main.nf.test
@@ -0,0 +1,179 @@
+nextflow_process {
+
+    name "Test Process CAT_CAT"
+    script "../main.nf"
+    process "CAT_CAT"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "cat"
+    tag "cat/cat"
+
+    test("test_cat_name_conflict") {
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'genome', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+        then {
+            assertAll(
+                { assert !process.success },
+                { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }
+            )
+        }
+    }
+
+    test("test_cat_unzipped_unzipped") {
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'test', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+    }
+
+
+    test("test_cat_zipped_zipped") {
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'test', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+        then {
+            def lines = path(process.out.file_out.get(0).get(1)).linesGzip
+            assertAll(
+                { assert process.success },
+                { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") },
+                { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")}
+            )
+        }
+    }
+
+    test("test_cat_zipped_unzipped") {
+        config './nextflow_zipped_unzipped.config'
+
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'test', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out).match() }
+            )
+        }
+
+    }
+
+    test("test_cat_unzipped_zipped") {
+        config './nextflow_unzipped_zipped.config'
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'test', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true),
+                            file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+        then {
+            def lines = path(process.out.file_out.get(0).get(1)).linesGzip
+            assertAll(
+                { assert process.success },
+                { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") },
+                { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")}
+            )
+        }
+    }
+
+    test("test_cat_one_file_unzipped_zipped") {
+        config './nextflow_unzipped_zipped.config'
+        when {
+            params {
+                outdir   = "${outputDir}"
+            }
+            process {
+                """
+                input[0] =
+                    [
+                        [ id:'test', single_end:true ],
+                        [
+                            file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true)
+                        ]
+                    ]
+                """
+            }
+        }
+        then {
+            def lines = path(process.out.file_out.get(0).get(1)).linesGzip
+            assertAll(
+                { assert process.success },
+                { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") },
+                { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")}
+            )
+        }
+    }
+}
+
diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap
new file mode 100644
index 00000000..423571ba
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap
@@ -0,0 +1,121 @@
+{
+    "test_cat_unzipped_zipped_size": {
+        "content": [
+            375
+        ],
+        "timestamp": "2023-10-16T14:33:08.049445686"
+    },
+    "test_cat_unzipped_unzipped": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+                ],
+                "file_out": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "test.fasta:md5,f44b33a0e441ad58b2d3700270e2dbe2"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+                ]
+            }
+        ],
+        "timestamp": "2023-10-16T14:32:18.500464399"
+    },
+    "test_cat_zipped_unzipped": {
+        "content": [
+            {
+                "0": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+                    ]
+                ],
+                "1": [
+                    "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+                ],
+                "file_out": [
+                    [
+                        {
+                            "id": "test",
+                            "single_end": true
+                        },
+                        "cat.txt:md5,c439d3b60e7bc03e8802a451a0d9a5d9"
+                    ]
+                ],
+                "versions": [
+                    "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894"
+                ]
+            }
+        ],
+        "timestamp": "2023-10-16T14:32:49.642741302"
+    },
+    "test_cat_zipped_zipped_lines": {
+        "content": [
+            [
+                "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab",
+                "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1",
+                "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
+                "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1",
+                "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1",
+                "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1"
+            ]
+        ],
+        "timestamp": "2023-10-16T14:32:33.629048645"
+    },
+    "test_cat_unzipped_zipped_lines": {
+        "content": [
+            [
+                ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
+                "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT",
+                "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG",
+                "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
+                "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
+                "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
+            ]
+        ],
+        "timestamp": "2023-10-16T14:33:08.038830506"
+    },
+    "test_cat_one_file_unzipped_zipped_lines": {
+        "content": [
+            [
+                ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome",
+                "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT",
+                "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG",
+                "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG",
+                "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT",
+                "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG"
+            ]
+        ],
+        "timestamp": "2023-10-16T14:33:21.39642399"
+    },
+    "test_cat_zipped_zipped_size": {
+        "content": [
+            78
+        ],
+        "timestamp": "2023-10-16T14:32:33.641869244"
+    },
+    "test_cat_one_file_unzipped_zipped_size": {
+        "content": [
+            374
+        ],
+        "timestamp": "2023-10-16T14:33:21.4094373"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config
new file mode 100644
index 00000000..ec26b0fd
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config
@@ -0,0 +1,6 @@
+
+process {
+    withName: CAT_CAT {
+        ext.prefix = 'cat.txt.gz'
+    }
+}
diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config
new file mode 100644
index 00000000..fbc79783
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config
@@ -0,0 +1,8 @@
+
+process {
+
+    withName: CAT_CAT {
+        ext.prefix = 'cat.txt'
+    }
+
+}
diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml
new file mode 100644
index 00000000..37b578f5
--- /dev/null
+++ b/modules/nf-core/cat/cat/tests/tags.yml
@@ -0,0 +1,2 @@
+cat/cat:
+  - modules/nf-core/cat/cat/**
diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test
new file mode 100644
index 00000000..d0438eda
--- /dev/null
+++ b/modules/nf-core/multiqc/tests/main.nf.test
@@ -0,0 +1,83 @@
+nextflow_process {
+
+    name "Test Process MULTIQC"
+    script "../main.nf"
+    process "MULTIQC"
+    tag "modules"
+    tag "modules_nfcore"
+    tag "multiqc"
+
+    test("sarscov2 single-end [fastqc]") {
+
+        when {
+            process {
+                """
+                input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)])
+                input[1] = []
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.report[0] ==~ ".*/multiqc_report.html" },
+                { assert process.out.data[0] ==~ ".*/multiqc_data" },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+
+    }
+
+    test("sarscov2 single-end [fastqc] [config]") {
+
+        when {
+            process {
+                """
+                input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)])
+                input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true))
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert process.out.report[0] ==~ ".*/multiqc_report.html" },
+                { assert process.out.data[0] ==~ ".*/multiqc_data" },
+                { assert snapshot(process.out.versions).match("versions") }
+            )
+        }
+    }
+
+    test("sarscov2 single-end [fastqc] - stub") {
+
+        options "-stub"
+
+        when {
+            process {
+                """
+                input[0] = Channel.of([file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz_fastqc_zip'], checkIfExists: true)])
+                input[1] = []
+                input[2] = []
+                input[3] = []
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert process.success },
+                { assert snapshot(process.out.report.collect { file(it).getName() } +
+                                process.out.data.collect { file(it).getName() } +
+                                process.out.plots.collect { file(it).getName() } +
+                                process.out.versions ).match() }
+            )
+        }
+
+    }
+}
diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap
new file mode 100644
index 00000000..d37e7304
--- /dev/null
+++ b/modules/nf-core/multiqc/tests/main.nf.test.snap
@@ -0,0 +1,21 @@
+{
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,14e9a2661241abd828f4f06a7b5c222d"
+            ]
+        ],
+        "timestamp": "2024-01-09T23:02:49.911994"
+    },
+    "sarscov2 single-end [fastqc] - stub": {
+        "content": [
+            [
+                "multiqc_report.html",
+                "multiqc_data",
+                "multiqc_plots",
+                "versions.yml:md5,14e9a2661241abd828f4f06a7b5c222d"
+            ]
+        ],
+        "timestamp": "2024-01-09T23:03:14.524346"
+    }
+}
\ No newline at end of file
diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml
new file mode 100644
index 00000000..bea6c0d3
--- /dev/null
+++ b/modules/nf-core/multiqc/tests/tags.yml
@@ -0,0 +1,2 @@
+multiqc:
+  - modules/nf-core/multiqc/**
diff --git a/modules/nf-core/samtools/bam2fq/main.nf b/modules/nf-core/samtools/bam2fq/main.nf
new file mode 100644
index 00000000..9301d1d3
--- /dev/null
+++ b/modules/nf-core/samtools/bam2fq/main.nf
@@ -0,0 +1,56 @@
+process SAMTOOLS_BAM2FQ {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda (params.enable_conda ? "bioconda::samtools=1.15.1" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/samtools:1.15.1--h1170115_0' :
+        'quay.io/biocontainers/samtools:1.15.1--h1170115_0' }"
+
+    input:
+    tuple val(meta), path(inputbam)
+    val split
+
+    output:
+    tuple val(meta), path("*.fq.gz"), emit: reads
+    path "versions.yml"             , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+
+    if (split){
+        """
+        samtools \\
+            bam2fq \\
+            $args \\
+            -@ $task.cpus \\
+            -1 ${prefix}_1.fq.gz \\
+            -2 ${prefix}_2.fq.gz \\
+            -0 ${prefix}_other.fq.gz \\
+            -s ${prefix}_singleton.fq.gz \\
+            $inputbam
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        END_VERSIONS
+        """
+    } else {
+        """
+        samtools \\
+            bam2fq \\
+            $args \\
+            -@ $task.cpus \\
+            $inputbam | gzip --no-name > ${prefix}_interleaved.fq.gz
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
+        END_VERSIONS
+        """
+    }
+}
diff --git a/modules/nf-core/samtools/bam2fq/meta.yml b/modules/nf-core/samtools/bam2fq/meta.yml
new file mode 100644
index 00000000..319a60cf
--- /dev/null
+++ b/modules/nf-core/samtools/bam2fq/meta.yml
@@ -0,0 +1,55 @@
+name: samtools_bam2fq
+description: |
+  The module uses bam2fq method from samtools to
+  convert a SAM, BAM or CRAM file to FASTQ format
+keywords:
+  - bam2fq
+  - samtools
+  - fastq
+tools:
+  - samtools:
+      description: Tools for dealing with SAM, BAM and CRAM files
+      homepage: None
+      documentation: http://www.htslib.org/doc/1.1/samtools.html
+      tool_dev_url: None
+      doi: ""
+      licence: ["MIT"]
+
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - inputbam:
+      type: file
+      description: BAM/CRAM/SAM file
+      pattern: "*.{bam,cram,sam}"
+  - split:
+      type: boolean
+      description: |
+        TRUE/FALSE value to indicate if reads should be separated into
+        /1, /2 and if present other, or singleton.
+        Note: choosing TRUE will generate 4 different files.
+        Choosing FALSE will produce a single file, which will be interleaved in case
+        the input contains paired reads.
+
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+  - reads:
+      type: file
+      description: |
+        FASTQ files, which will be either a group of 4 files (read_1, read_2, other and singleton)
+        or a single interleaved .fq.gz file if the user chooses not to split the reads.
+      pattern: "*.fq.gz"
+
+authors:
+  - "@lescai"
diff --git a/modules/nf-core/umitools/dedup/main.nf b/modules/nf-core/umitools/dedup/main.nf
new file mode 100644
index 00000000..dfcbcf2f
--- /dev/null
+++ b/modules/nf-core/umitools/dedup/main.nf
@@ -0,0 +1,41 @@
+process UMITOOLS_DEDUP {
+    tag "$meta.id"
+    label "process_medium"
+
+    conda (params.enable_conda ? "bioconda::umi_tools=1.1.2" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/umi_tools:1.1.2--py38h4a8c8d9_0' :
+        'quay.io/biocontainers/umi_tools:1.1.2--py38h4a8c8d9_0' }"
+
+    input:
+    tuple val(meta), path(bam), path(bai)
+
+    output:
+    tuple val(meta), path("*.bam")             , emit: bam
+    tuple val(meta), path("*edit_distance.tsv"), emit: tsv_edit_distance
+    tuple val(meta), path("*per_umi.tsv")      , emit: tsv_per_umi
+    tuple val(meta), path("*per_position.tsv") , emit: tsv_umi_per_position
+    path  "versions.yml"                       , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    def paired = meta.single_end ? "" : "--paired"
+    """
+    umi_tools \\
+        dedup \\
+        -I $bam \\
+        -S ${prefix}.bam \\
+        --output-stats $prefix \\
+        $paired \\
+        $args
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
+    END_VERSIONS
+    """
+}
diff --git a/modules/nf-core/umitools/dedup/meta.yml b/modules/nf-core/umitools/dedup/meta.yml
new file mode 100644
index 00000000..eee8952f
--- /dev/null
+++ b/modules/nf-core/umitools/dedup/meta.yml
@@ -0,0 +1,59 @@
+name: umitools_dedup
+description: Deduplicate reads based on the mapping co-ordinate and the UMI attached to the read.
+keywords:
+  - umitools
+  - deduplication
+tools:
+  - umi_tools:
+    description: >
+      UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs)
+      and single cell RNA-Seq cell barcodes
+    documentation: https://umi-tools.readthedocs.io/en/latest/
+    license: ["MIT"]
+input:
+  - meta:
+    type: map
+    description: |
+      Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - bam:
+    type: file
+    description: |
+      BAM file containing reads to be deduplicated via UMIs.
+    pattern: "*.{bam}"
+  - bai:
+    type: file
+    description: |
+      BAM index files corresponding to the input BAM file.
+    pattern: "*.{bai}"
+output:
+  - meta:
+    type: map
+    description: |
+      Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - bam:
+    type: file
+    description: BAM file with deduplicated UMIs.
+    pattern: "*.{bam}"
+  - tsv_edit_distance:
+    type: file
+    description: Reports the (binned) average edit distance between the UMIs at each position.
+    pattern: "*edit_distance.tsv"
+  - tsv_per_umi:
+    type: file
+    description: UMI-level summary statistics.
+    pattern: "*per_umi.tsv"
+  - tsv_umi_per_position:
+    type: file
+    description: Tabulates the counts for unique combinations of UMI and position.
+    pattern: "*per_position.tsv"
+  - versions:
+    type: file
+    description: File containing software versions
+    pattern: "versions.yml"
+
+authors:
+  - "@drpatelh"
+  - "@grst"
+  - "@klkeys"
diff --git a/modules/nf-core/umitools/extract/main.nf b/modules/nf-core/umitools/extract/main.nf
new file mode 100644
index 00000000..22a405b9
--- /dev/null
+++ b/modules/nf-core/umitools/extract/main.nf
@@ -0,0 +1,55 @@
+process UMITOOLS_EXTRACT {
+    tag "$meta.id"
+    label "process_low"
+
+    conda (params.enable_conda ? "bioconda::umi_tools=1.1.2" : null)
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/umi_tools:1.1.2--py38h4a8c8d9_0' :
+        'quay.io/biocontainers/umi_tools:1.1.2--py38h4a8c8d9_0' }"
+
+    input:
+    tuple val(meta), path(reads)
+
+    output:
+    tuple val(meta), path("*.fastq.gz"), emit: reads
+    tuple val(meta), path("*.log")     , emit: log
+    path  "versions.yml"               , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    if (meta.single_end) {
+        """
+        umi_tools \\
+            extract \\
+            -I $reads \\
+            -S ${prefix}.umi_extract.fastq.gz \\
+            $args \\
+            > ${prefix}.umi_extract.log
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
+        END_VERSIONS
+        """
+    }  else {
+        """
+        umi_tools \\
+            extract \\
+            -I ${reads[0]} \\
+            --read2-in=${reads[1]} \\
+            -S ${prefix}.umi_extract_1.fastq.gz \\
+            --read2-out=${prefix}.umi_extract_2.fastq.gz \\
+            $args \\
+            > ${prefix}.umi_extract.log
+
+        cat <<-END_VERSIONS > versions.yml
+        "${task.process}":
+            umitools: \$(umi_tools --version 2>&1 | sed 's/^.*UMI-tools version://; s/ *\$//')
+        END_VERSIONS
+        """
+    }
+}
diff --git a/modules/nf-core/umitools/extract/meta.yml b/modules/nf-core/umitools/extract/meta.yml
new file mode 100644
index 00000000..7fc23f72
--- /dev/null
+++ b/modules/nf-core/umitools/extract/meta.yml
@@ -0,0 +1,47 @@
+name: umitools_extract
+description: Extracts UMI barcode from a read and add it to the read name, leaving any sample barcode in place
+keywords:
+  - umitools
+  - extract
+tools:
+  - umi_tools:
+    description: >
+      UMI-tools contains tools for dealing with Unique Molecular Identifiers (UMIs)/Random Molecular Tags (RMTs)
+      and single cell RNA-Seq cell barcodes
+    documentation: https://umi-tools.readthedocs.io/en/latest/
+    license: ["MIT"]
+input:
+  - meta:
+    type: map
+    description: |
+      Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+    type: list
+    description: |
+      List of input FASTQ files whose UMIs will be extracted.
+output:
+  - meta:
+    type: map
+    description: |
+      Groovy Map containing sample information
+        e.g. [ id:'test', single_end:false ]
+  - reads:
+    type: file
+    description: >
+      Extracted FASTQ files. |
+      For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
+        For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
+    pattern: "*.{fastq.gz}"
+  - log:
+    type: file
+    description: Logfile for umi_tools
+    pattern: "*.{log}"
+  - versions:
+    type: file
+    description: File containing software versions
+    pattern: "versions.yml"
+
+authors:
+  - "@drpatelh"
+  - "@grst"
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf
new file mode 100644
index 00000000..3dbb27ea
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/main.nf
@@ -0,0 +1,140 @@
+//
+// Read QC, UMI extraction and trimming
+//
+
+include { FASTQC as FASTQC_RAW  } from '../../../modules/nf-core/fastqc/main'
+include { FASTQC as FASTQC_TRIM } from '../../../modules/nf-core/fastqc/main'
+include { UMITOOLS_EXTRACT      } from '../../../modules/nf-core/umitools/extract/main'
+include { FASTP                 } from '../../../modules/nf-core/fastp/main'
+
+//
+// Function that parses fastp json output file to get total number of reads after trimming
+//
+import groovy.json.JsonSlurper
+
+def getFastpReadsAfterFiltering(json_file) {
+    def Map json = (Map) new JsonSlurper().parseText(json_file.text).get('summary')
+    return json['after_filtering']['total_reads'].toLong()
+}
+
+workflow FASTQ_FASTQC_UMITOOLS_FASTP {
+    take:
+    reads             // channel: [ val(meta), [ reads ] ]
+    skip_fastqc       // boolean: true/false
+    with_umi          // boolean: true/false
+    skip_umi_extract  // boolean: true/false
+    umi_discard_read  // integer: 0, 1 or 2
+    skip_trimming     // boolean: true/false
+    adapter_fasta     //    file: adapter.fasta
+    save_trimmed_fail // boolean: true/false
+    save_merged       // boolean: true/false
+    min_trimmed_reads // integer: > 0
+
+    main:
+    ch_versions = Channel.empty()
+    fastqc_raw_html = Channel.empty()
+    fastqc_raw_zip  = Channel.empty()
+    if (!skip_fastqc) {
+        FASTQC_RAW (
+            reads
+        )
+        fastqc_raw_html = FASTQC_RAW.out.html
+        fastqc_raw_zip  = FASTQC_RAW.out.zip
+        ch_versions     = ch_versions.mix(FASTQC_RAW.out.versions.first())
+    }
+
+    umi_reads = reads
+    umi_log   = Channel.empty()
+    if (with_umi && !skip_umi_extract) {
+        UMITOOLS_EXTRACT (
+            reads
+        )
+        umi_reads   = UMITOOLS_EXTRACT.out.reads
+        umi_log     = UMITOOLS_EXTRACT.out.log
+        ch_versions = ch_versions.mix(UMITOOLS_EXTRACT.out.versions.first())
+
+        // Discard R1 / R2 if required
+        if (umi_discard_read in [1,2]) {
+            UMITOOLS_EXTRACT
+                .out
+                .reads
+                .map {
+                    meta, reads ->
+                        meta.single_end ? [ meta, reads ] : [ meta + [single_end: true], reads[umi_discard_read % 2] ]
+                }
+                .set { umi_reads }
+        }
+    }
+
+    trim_reads        = umi_reads
+    trim_json         = Channel.empty()
+    trim_html         = Channel.empty()
+    trim_log          = Channel.empty()
+    trim_reads_fail   = Channel.empty()
+    trim_reads_merged = Channel.empty()
+    fastqc_trim_html  = Channel.empty()
+    fastqc_trim_zip   = Channel.empty()
+    trim_read_count   = Channel.empty()
+    if (!skip_trimming) {
+        FASTP (
+            umi_reads,
+            adapter_fasta,
+            save_trimmed_fail,
+            save_merged
+        )
+        trim_json         = FASTP.out.json
+        trim_html         = FASTP.out.html
+        trim_log          = FASTP.out.log
+        trim_reads_fail   = FASTP.out.reads_fail
+        trim_reads_merged = FASTP.out.reads_merged
+        ch_versions       = ch_versions.mix(FASTP.out.versions.first())
+
+        //
+        // Filter FastQ files based on minimum trimmed read count after adapter trimming
+        //
+        FASTP
+            .out
+            .reads
+            .join(trim_json)
+            .map { meta, reads, json -> [ meta, reads, getFastpReadsAfterFiltering(json) ] }
+            .set { ch_num_trimmed_reads }
+
+        ch_num_trimmed_reads
+            .filter { meta, reads, num_reads -> num_reads >= min_trimmed_reads.toLong() }
+            .map { meta, reads, num_reads -> [ meta, reads ] }
+            .set { trim_reads }
+
+        ch_num_trimmed_reads
+            .map { meta, reads, num_reads -> [ meta, num_reads ] }
+            .set { trim_read_count }
+
+        if (!skip_fastqc) {
+            FASTQC_TRIM (
+                trim_reads
+            )
+            fastqc_trim_html = FASTQC_TRIM.out.html
+            fastqc_trim_zip  = FASTQC_TRIM.out.zip
+            ch_versions      = ch_versions.mix(FASTQC_TRIM.out.versions.first())
+        }
+    }
+
+    emit:
+    reads = trim_reads // channel: [ val(meta), [ reads ] ]
+
+    fastqc_raw_html    // channel: [ val(meta), [ html ] ]
+    fastqc_raw_zip     // channel: [ val(meta), [ zip ] ]
+
+    umi_log            // channel: [ val(meta), [ log ] ]
+
+    trim_json          // channel: [ val(meta), [ json ] ]
+    trim_html          // channel: [ val(meta), [ html ] ]
+    trim_log           // channel: [ val(meta), [ log ] ]
+    trim_reads_fail    // channel: [ val(meta), [ fastq.gz ] ]
+    trim_reads_merged  // channel: [ val(meta), [ fastq.gz ] ]
+    trim_read_count    // channel: [ val(meta), val(count) ]
+
+    fastqc_trim_html   // channel: [ val(meta), [ html ] ]
+    fastqc_trim_zip    // channel: [ val(meta), [ zip ] ]
+
+    versions = ch_versions.ifEmpty(null) // channel: [ versions.yml ]
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
new file mode 100644
index 00000000..220e8db1
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/meta.yml
@@ -0,0 +1,128 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json
+# yaml-language-server: $schema=yaml-schema.json
+name: "fastq_fastqc_umitools_fastp"
+description: Read QC, UMI extraction and trimming
+keywords:
+  - fastq
+  - fastqc
+  - qc
+  - UMI
+  - trimming
+  - fastp
+components:
+  - fastqc
+  - umitools/extract
+  - fastp
+input:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test' ]
+  - reads:
+      type: file
+      description: |
+        List of input FastQ files of size 1 and 2 for single-end and paired-end data,
+        respectively.
+  - skip_fastqc:
+      type: boolean
+      description: |
+        Skip fastqc process
+  - with_umi:
+      type: boolean
+      description: |
+        With or without umi detection
+  - skip_umi_extract:
+      type: boolean
+      description: |
+        With or without umi extrection
+  - umi_discard_read:
+      type: integer
+      description: |
+        Discard R1 / R2 if required
+  - skip_trimming:
+      type: boolean
+      description: |
+        Allows to skip trimgalore execution
+  - adapter_fasta:
+      type: file
+      description: |
+        Fasta file of adapter sequences
+  - save_trimmed_fail:
+      type: boolean
+      description: |
+        Save trimmed fastqs of failed samples
+  - save_merged:
+      type: boolean
+      description: |
+        Save merged fastqs
+  - min_trimmed_reads:
+      type: integer
+      description: |
+        Inputs with fewer than this reads will be filtered out of the "reads" output channel
+output:
+  - meta:
+      type: map
+      description: |
+        Groovy Map containing sample information
+        e.g. [ id:'test' ]
+  - reads:
+      type: file
+      description: >
+        Extracted FASTQ files. | For single-end reads, pattern is \${prefix}.umi_extract.fastq.gz. |
+
+
+
+          For paired-end reads, pattern is \${prefix}.umi_extract_{1,2}.fastq.gz.
+      pattern: "*.{fastq.gz}"
+  - fastqc_html:
+      type: file
+      description: FastQC report
+      pattern: "*_{fastqc.html}"
+  - fastqc_zip:
+      type: file
+      description: FastQC report archive
+      pattern: "*_{fastqc.zip}"
+  - log:
+      type: file
+      description: Logfile for umi_tools
+      pattern: "*.{log}"
+  - trim_json:
+      type: file
+      description: FastP Trimming report
+      pattern: "*.{fastp.json}"
+  - trim_html:
+      type: file
+      description: FastP Trimming report
+      pattern: "*.{fastp.html}"
+  - log:
+      type: file
+      description: Logfile FastP
+      pattern: "*.{fastp.log}"
+  - trim_reads_fail:
+      type: file
+      description: Trimmed fastq files failing QC
+      pattern: "*.{fastq.gz}"
+  - trim_reads_merged:
+      type: file
+      description: Trimmed and merged fastq files
+      pattern: "*.{fastq.gz}"
+  - trim_read_count:
+      type: integer
+      description: Number of reads after trimming
+  - fastqc_trim_html:
+      type: file
+      description: FastQC report
+      pattern: "*_{fastqc.html}"
+  - fastqc_trim_zip:
+      type: file
+      description: FastQC report archive
+      pattern: "*_{fastqc.zip}"
+  - versions:
+      type: file
+      description: File containing software versions
+      pattern: "versions.yml"
+authors:
+  - "@robsyme"
+maintainers:
+  - "@robsyme"
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
new file mode 100644
index 00000000..cdd73984
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
@@ -0,0 +1,60 @@
+nextflow_workflow {
+
+    name "Test Workflow FASTQ_FASTQC_UMITOOLS_FASTP"
+    script "../main.nf"
+    workflow "FASTQ_FASTQC_UMITOOLS_FASTP"
+    tag "subworkflows"
+    tag "subworkflows_nfcore"
+    tag "subworkflows/fastq_fastqc_umitools_fastp"
+    tag "fastq_fastqc_umitools_fastp"
+    tag "fastqc"
+    tag "umitools/extract"
+    tag "fastp"
+
+
+    test("sarscov2 paired-end [fastq]") {
+
+        when {
+            workflow {
+                """
+                input[0] = [
+                            [ id:'test', single_end:false ], // meta map
+                            [
+                             file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+                             file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+                            ]
+                ]
+                input[1] = false // skip_fastqc
+                input[2] = false // with_umi
+                input[3] = false // skip_umi_extract
+                input[4] = 1     // umi_discard_read
+                input[5] = false // skip_trimming
+                input[6] = []    // adapter_fasta
+                input[7] = false // save_trimmed_fail
+                input[8] = false // save_merged
+                input[9] = 1     // min_trimmed_reads
+                """
+            }
+        }
+
+        then {
+            assertAll(
+                { assert workflow.success },
+                { assert snapshot(workflow.out.reads).match("reads") },
+                { assert snapshot(workflow.out.umi_log).match("umi_log") },
+                { assert snapshot(workflow.out.trim_json).match("trim_json") },
+                { assert snapshot(workflow.out.trim_reads_fail).match("trim_reads_fail") },
+                { assert snapshot(workflow.out.trim_reads_merged).match("trim_reads_merged") },
+                { assert snapshot(workflow.out.trim_read_count).match("trim_read_count") },
+                { assert snapshot(workflow.out.versions).match("versions") },
+
+                { assert workflow.out.fastqc_raw_html },
+                { assert workflow.out.fastqc_raw_zip },
+                { assert workflow.out.trim_html },
+                { assert workflow.out.trim_log },
+                { assert workflow.out.fastqc_trim_html },
+                { assert workflow.out.fastqc_trim_zip }
+            )
+        }
+    }
+}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
new file mode 100644
index 00000000..38a65aeb
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
@@ -0,0 +1,81 @@
+{
+    "trim_reads_merged": {
+        "content": [
+            [
+                
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.26920982"
+    },
+    "trim_reads_fail": {
+        "content": [
+            [
+                
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.25861515"
+    },
+    "versions": {
+        "content": [
+            [
+                "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+                "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+                "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.30891403"
+    },
+    "trim_json": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.24768259"
+    },
+    "reads": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    [
+                        "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+                        "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+                    ]
+                ]
+            ]
+        ],
+        "timestamp": "2023-12-04T11:30:32.061644815"
+    },
+    "umi_log": {
+        "content": [
+            [
+                
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.238536"
+    },
+    "trim_read_count": {
+        "content": [
+            [
+                [
+                    {
+                        "id": "test",
+                        "single_end": false
+                    },
+                    198
+                ]
+            ]
+        ],
+        "timestamp": "2023-11-26T02:28:26.27984169"
+    }
+}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
new file mode 100644
index 00000000..84a4b567
--- /dev/null
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/tags.yml
@@ -0,0 +1,2 @@
+subworkflows/fastq_fastqc_umitools_fastp:
+  - subworkflows/nf-core/fastq_fastqc_umitools_fastp/**