From 7f2f5856f0e6c692b9f2f4b3e5f843779dcf023f Mon Sep 17 00:00:00 2001
From: Prashant Sinha <prashant@ducic.ac.in>
Date: Fri, 22 Apr 2016 01:48:42 +0530
Subject: [PATCH] +docs

---
 docs/index.rst        | 41 ++++++++++++++++++++++++++++++++++++++---
 docs/installation.rst | 30 ++++++++++++++++++++++++++++++
 2 files changed, 68 insertions(+), 3 deletions(-)
 create mode 100644 docs/installation.rst

diff --git a/docs/index.rst b/docs/index.rst
index 1d14110..fb25014 100644
--- a/docs/index.rst
+++ b/docs/index.rst
@@ -3,14 +3,49 @@
    You can adapt this file completely to your liking, but it should at least
    contain the root `toctree` directive.
 
-Welcome to metaRNA's documentation!
-===================================
+metaRNA, find target sites for the miRNAs
+=========================================
 
-Contents:
+metaRNA finds potential target sites for the microRNAs in genomic
+sequences.
+
+* Written in Python
+* Built on miRanda_.
+
+It is built on miRanda, an algorithm for detection and
+ranking of the targets of microRNA.
+
+.. _miRanda: http://www.microrna.org/microrna/getDownloads.do
+
+Quickstart
+----------
+
+.. code:: python
+
+    from metarna.target_scan import scan, free_energy
+
+    gene_sequence = (
+        "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC"
+        "CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC"
+        "CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG"
+    )
+
+    mirna_sequence = "UGGCGAUUUUGGAACUCAAUGGCA"
+
+    # Get free Energy value:
+    delta_g = free_energy(gene_sequence, mirna_sequence)
+
+    # Get full targets information:
+    targets = scan(gene_sequence, mirna_sequence)
+
+
+Contents
 
 .. toctree::
    :maxdepth: 2
 
+   installation
+   getting-started
 
 
 Indices and tables
diff --git a/docs/installation.rst b/docs/installation.rst
new file mode 100644
index 0000000..964f115
--- /dev/null
+++ b/docs/installation.rst
@@ -0,0 +1,30 @@
+.. _installation:
+
+Installing
+==========
+
+metaRNA can be installed very easily using `pip <http://www.pip-installer.org/en/latest/index.html>`_.
+
+.. code-block:: bash
+
+    pip install metarna
+
+
+
+Using git
+---------
+
+If you want to run the very latest, feel free to pull down the repo from github
+and install by hand.
+
+.. code-block:: bash
+
+    git clone https://github.com/PrashntS/metaRNA.git
+    cd metaRNA
+    python setup.py install
+
+You can run the tests using the test-runner::
+
+    python setup.py test
+
+Browse the source code online at https://github.com/PrashntS/metaRNA