From 5919c489bff18b07c40a945696b6abadcb3bf6db Mon Sep 17 00:00:00 2001 From: Liam Keegan <liam@keegan.ch> Date: Wed, 10 Jan 2024 16:33:25 +0100 Subject: [PATCH] add CUDA distance implementation (#123) - python interface changes - add `from_fasta_to_lower_triangular` - this constructs lower triangular matrix file directly from fasta file - for now only works on GPU - faster & requires less RAM than doing `from_fasta` followed by `dump_lower_triangular` - requires 1.5GB RAM per 100k genomes on gpu + 1GB buffer to store partial distances matrix - add `use_gpu` option to `from_fasta` - if True and include_x is False then the GPU is used to calcuate distances matrix - add `cuda_gpu_available()` utility function - CUDA implementation - each block of threads calculates a single element of the distances matrix - a kernel is launched running on a grid of these blocks to calculate a subset of the distances matrix - I/O is interleaved with computation: the CPU writes the previous kernel results as the next kernel is running - print basic timing info to cout - add libfmt library - migrate to using v3 of catch2 - build wheels using manylinux2014 image with CUDA 11.8 pre-installed from https://github.com/ameli/manylinux-cuda - add a couple of performance plots - bump version to 1.0.0 - resolves #111 --- .github/workflows/ci.yml | 2 +- .github/workflows/wheels.yml | 6 +- .gitmodules | 3 + CMakeLists.txt | 12 +- README.md | 35 +++- ext/CMakeLists.txt | 2 + ext/Catch2 | 2 +- ext/fmt | 1 + include/hamming/distance_avx2.hh | 5 +- include/hamming/distance_avx512.hh | 5 +- include/hamming/distance_cuda.hh | 27 +++ include/hamming/distance_sse2.hh | 5 +- include/hamming/hamming.hh | 111 ++++-------- include/hamming/hamming_impl.hh | 126 ++++++++------ include/hamming/hamming_impl_types.hh | 5 +- include/hamming/hamming_types.hh | 5 +- include/hamming/hamming_utils.hh | 112 +++++++++++++ plots/overview.plt | 10 ++ plots/overview.png | Bin 0 -> 6498 bytes plots/overview.txt | 8 + plots/speed.plt | 13 ++ plots/speed.png | Bin 0 -> 8301 bytes plots/speed.txt | 15 ++ pyproject.toml | 11 +- python/hammingdist.cc | 23 ++- python/tests/test_hammingdist.py | 47 ++++-- src/CMakeLists.txt | 42 ++++- src/bench.cc | 7 +- src/bench.hh | 27 ++- src/cuda_mem.hh | 32 ++++ src/distance_cuda.cu | 233 ++++++++++++++++++++++++++ src/distance_cuda_bench.cc | 19 +++ src/distance_cuda_t.cc | 62 +++++++ src/hamming.cc | 41 +++-- src/hamming_bench.cc | 47 +++++- src/hamming_impl.cc | 102 ++++++++++- src/hamming_t.cc | 230 +++++++++++++++++++------ src/hamming_utils.cc | 1 + src/hamming_utils_bench.cc | 78 +++++++++ src/tests.cc | 9 + src/tests.hh | 12 +- 41 files changed, 1269 insertions(+), 264 deletions(-) create mode 160000 ext/fmt create mode 100644 include/hamming/distance_cuda.hh create mode 100644 include/hamming/hamming_utils.hh create mode 100644 plots/overview.plt create mode 100644 plots/overview.png create mode 100644 plots/overview.txt create mode 100644 plots/speed.plt create mode 100644 plots/speed.png create mode 100644 plots/speed.txt create mode 100644 src/cuda_mem.hh create mode 100644 src/distance_cuda.cu create mode 100644 src/distance_cuda_bench.cc create mode 100644 src/distance_cuda_t.cc create mode 100644 src/hamming_utils.cc create mode 100644 src/hamming_utils_bench.cc diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 54c4dd0..68049b5 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -65,4 +65,4 @@ jobs: - name: run tests shell: bash working-directory: ${{runner.workspace}}/build - run: ctest + run: ctest -j2 --rerun-failed --output-on-failure diff --git a/.github/workflows/wheels.yml b/.github/workflows/wheels.yml index 58eae2b..7e3ee38 100644 --- a/.github/workflows/wheels.yml +++ b/.github/workflows/wheels.yml @@ -27,9 +27,11 @@ jobs: with: submodules: "recursive" - uses: pypa/cibuildwheel@v2.16 + env: + CIBW_MANYLINUX_X86_64_IMAGE: sameli/manylinux2014_x86_64_cuda_11.8 - uses: actions/upload-artifact@v4 with: - name: wheels-${{ matrix.os }} + name: artifacts-${{ matrix.os }} path: ./wheelhouse/*.whl upload_pypi: @@ -42,7 +44,7 @@ jobs: steps: - uses: actions/download-artifact@v4 with: - pattern: wheels-* + pattern: artifacts-* merge-multiple: true path: dist diff --git a/.gitmodules b/.gitmodules index f88f44d..0e6d3ab 100644 --- a/.gitmodules +++ b/.gitmodules @@ -13,3 +13,6 @@ [submodule "Catch2"] path = ext/Catch2 url = https://github.com/catchorg/Catch2.git +[submodule "ext/fmt"] + path = ext/fmt + url = https://github.com/fmtlib/fmt.git diff --git a/CMakeLists.txt b/CMakeLists.txt index 8919e23..69984d6 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -1,8 +1,8 @@ -cmake_minimum_required(VERSION 3.11..3.27) +cmake_minimum_required(VERSION 3.23..3.27) project( hammingdist - VERSION 0.21.0 + VERSION 1.0.0 LANGUAGES CXX) include(CTest) @@ -39,6 +39,14 @@ set(HAMMING_WITH_NEON no CACHE BOOL "Enable NEON optimized code on Arm64 CPUs") +set(HAMMING_WITH_CUDA + no + CACHE BOOL "Build with CUDA support (nvidia gpu)") + +if(HAMMING_WITH_CUDA) + enable_language(CUDA) +endif() + # Add git submodules add_subdirectory(ext) diff --git a/README.md b/README.md index 4719e67..061a51e 100644 --- a/README.md +++ b/README.md @@ -1,4 +1,4 @@ -A small C++ tool to calculate pairwise distances between gene sequences given in fasta format. +A small and fast C++ tool to calculate pairwise distances between gene sequences given in fasta format. [](https://zenodo.org/badge/latestdoi/308676358) [](https://pypi.org/project/hammingdist) @@ -117,9 +117,34 @@ distance = hammingdist.distance("ACGTX", "AAGTX", include_x=True) ## OpenMP on linux -The latest versions of hammingdist on linux are now built with OpenMP (multithreading) support. -If this causes any issues, you can install a previous version of hammingdist without OpenMP support: +On linux hammingdist is built with OpenMP (multithreading) support, and will automatically make use of all available CPU threads. -```bash -pip install hammingdist==0.11.0 +## CUDA on linux + +On linux hammingdist is also built with CUDA (Nvidia GPU) support. +To use the GPU instead of the CPU, set `use_gpu=True` when calling `from_fasta`: + +```python +import hammingdist + +data = hammingdist.from_fasta("example.fasta", use_gpu=True) +``` + +Additionally, the lower triangular matrix file can now be directly constructed from the fasta file +using the GPU with the `from_fasta_to_lower_triangular` function. +This avoids storing the entire distances matrix in memory and interleaves computation on the GPU with disk I/O on the CPU, +which means it requires less RAM and runs faster. + +```python +import hammingdist + +hammingdist.from_fasta_to_lower_triangular('input_fasta.txt', 'output_lower_triangular.txt', use_gpu=True) ``` + + + +## Performance history + +A rough measure of the impact of the different performance improvements in hammingdist: + + diff --git a/ext/CMakeLists.txt b/ext/CMakeLists.txt index 6a00470..897253e 100644 --- a/ext/CMakeLists.txt +++ b/ext/CMakeLists.txt @@ -1,3 +1,5 @@ +add_subdirectory(fmt) + if(HAMMING_BUILD_PYTHON) add_subdirectory(pybind11) endif() diff --git a/ext/Catch2 b/ext/Catch2 index 182c910..f981c9c 160000 --- a/ext/Catch2 +++ b/ext/Catch2 @@ -1 +1 @@ -Subproject commit 182c910b4b63ff587a3440e08f84f70497e49a81 +Subproject commit f981c9cbcac07a2690e5a86767eba490b5465463 diff --git a/ext/fmt b/ext/fmt new file mode 160000 index 0000000..f5e5435 --- /dev/null +++ b/ext/fmt @@ -0,0 +1 @@ +Subproject commit f5e54359df4c26b6230fc61d38aa294581393084 diff --git a/include/hamming/distance_avx2.hh b/include/hamming/distance_avx2.hh index 8fc6cdc..7823a52 100644 --- a/include/hamming/distance_avx2.hh +++ b/include/hamming/distance_avx2.hh @@ -1,5 +1,4 @@ -#ifndef _HAMMING_DISTANCE_AVX2_HH -#define _HAMMING_DISTANCE_AVX2_HH +#pragma once #include <cstdint> #include <vector> @@ -12,5 +11,3 @@ int distance_avx2(const std::vector<GeneBlock> &a, const std::vector<GeneBlock> &b); } - -#endif diff --git a/include/hamming/distance_avx512.hh b/include/hamming/distance_avx512.hh index 919fd31..a21d414 100644 --- a/include/hamming/distance_avx512.hh +++ b/include/hamming/distance_avx512.hh @@ -1,5 +1,4 @@ -#ifndef _HAMMING_DISTANCE_AVX512_HH -#define _HAMMING_DISTANCE_AVX512_HH +#pragma once #include <cstdint> #include <vector> @@ -12,5 +11,3 @@ int distance_avx512(const std::vector<GeneBlock> &a, const std::vector<GeneBlock> &b); } - -#endif diff --git a/include/hamming/distance_cuda.hh b/include/hamming/distance_cuda.hh new file mode 100644 index 0000000..c7c7e52 --- /dev/null +++ b/include/hamming/distance_cuda.hh @@ -0,0 +1,27 @@ +#pragma once + +#include <cstdint> +#include <iostream> +#include <vector> + +#include "hamming/hamming_impl_types.hh" + +namespace hamming { + +bool distance_cuda_have_device(); + +int distance_cuda(const std::vector<GeneBlock> &a, + const std::vector<GeneBlock> &b); + +// for now explicit function def for each choice of integer type +std::vector<uint8_t> +distances_cuda_8bit(const std::vector<std::vector<GeneBlock>> &data); + +std::vector<uint16_t> +distances_cuda_16bit(const std::vector<std::vector<GeneBlock>> &data); + +void distances_cuda_to_lower_triangular( + const std::vector<std::vector<GeneBlock>> &data, + const std::string &filename); + +} // namespace hamming diff --git a/include/hamming/distance_sse2.hh b/include/hamming/distance_sse2.hh index 6920226..ac5d2c7 100644 --- a/include/hamming/distance_sse2.hh +++ b/include/hamming/distance_sse2.hh @@ -1,5 +1,4 @@ -#ifndef _HAMMING_DISTANCE_SSE2_HH -#define _HAMMING_DISTANCE_SSE2_HH +#pragma once #include <cstdint> #include <vector> @@ -12,5 +11,3 @@ int distance_sse2(const std::vector<GeneBlock> &a, const std::vector<GeneBlock> &b); } - -#endif diff --git a/include/hamming/hamming.hh b/include/hamming/hamming.hh index 61af9b7..06f90a0 100644 --- a/include/hamming/hamming.hh +++ b/include/hamming/hamming.hh @@ -1,13 +1,12 @@ -#ifndef _HAMMING_HH -#define _HAMMING_HH +#pragma once #include "hamming/hamming_impl.hh" #include "hamming/hamming_types.hh" +#include "hamming/hamming_utils.hh" #include <cmath> #include <fstream> #include <sstream> #include <string> -#include <unordered_map> #include <vector> namespace hamming { @@ -19,10 +18,11 @@ inline std::size_t uint_sqrt(std::size_t x) { template <typename DistIntType> struct DataSet { explicit DataSet(std::vector<std::string> &data, bool include_x = false, bool clear_input_data = false, - std::vector<std::size_t> &&indices = {}) + std::vector<std::size_t> &&indices = {}, + bool use_gpu = false) : nsamples(data.size()), sequence_indices(std::move(indices)) { validate_data(data); - result = distances<DistIntType>(data, include_x, clear_input_data); + result = distances<DistIntType>(data, include_x, clear_input_data, use_gpu); } explicit DataSet(const std::string &filename) { @@ -67,35 +67,7 @@ template <typename DistIntType> struct DataSet { } void dump_lower_triangular(const std::string &filename) { - std::ofstream stream(filename); -#ifdef HAMMING_WITH_OPENMP - std::size_t block_size = 200; -#pragma omp parallel for ordered schedule(static, 1) - for (std::size_t i_start = 1; i_start < nsamples; i_start += block_size) { - std::stringstream line; - std::size_t i_end = i_start + block_size; - if (i_end > nsamples) { - i_end = nsamples; - } - for (std::size_t i = i_start; i < i_end; ++i) { - std::size_t offset{i * (i - 1) / 2}; - for (std::size_t j = 0; j + 1 < i; ++j) { - line << static_cast<int>(result[offset + j]) << ","; - } - line << static_cast<int>(result[offset + i - 1]) << "\n"; - } -#pragma omp ordered - stream << line.str(); - } -#else - std::size_t k = 0; - for (std::size_t i = 1; i < nsamples; ++i) { - for (std::size_t j = 0; j + 1 < i; ++j) { - stream << static_cast<int>(result[k++]) << ","; - } - stream << static_cast<int>(result[k++]) << "\n"; - } -#endif + write_lower_triangular(filename, result); } void dump_sequence_indices(const std::string &filename) { @@ -127,67 +99,52 @@ template <typename DistIntType> struct DataSet { std::vector<std::size_t> sequence_indices{}; }; -DataSet<DefaultDistIntType> from_stringlist(std::vector<std::string> &data); +DataSet<DefaultDistIntType> from_stringlist(std::vector<std::string> &data, + bool include_x = false, + bool use_gpu = false); DataSet<DefaultDistIntType> from_csv(const std::string &filename); -DataSet<DefaultDistIntType> from_lower_triangular(const std::string &filename); - template <typename DistIntType> -DataSet<DistIntType> -from_fasta(const std::string &filename, bool include_x = false, - bool remove_duplicates = false, std::size_t n = 0) { - std::vector<std::string> data; - data.reserve(n); - if (n == 0) { - n = std::numeric_limits<std::size_t>::max(); - data.reserve(65536); - } - std::unordered_map<std::string, std::size_t> map_seq_to_index; - std::vector<std::size_t> sequence_indices{}; - // Initializing the stream +DataSet<DistIntType> from_lower_triangular(const std::string &filename) { + std::vector<DistIntType> distances; std::ifstream stream(filename); - std::size_t count = 0; - std::size_t count_unique = 0; std::string line; - // skip first header - std::getline(stream, line); - while (count < n && !stream.eof()) { - std::string seq{}; - while (std::getline(stream, line) && line[0] != '>') { - seq.append(line); - } - if (remove_duplicates) { - auto result = map_seq_to_index.emplace(std::move(seq), count_unique); - if (result.second) { - ++count_unique; - } - sequence_indices.push_back(result.first->second); - } else { - data.push_back(std::move(seq)); - } - ++count; - } - if (remove_duplicates) { - // copy each unique sequence to the vector of strings - data.resize(count_unique); - for (auto &key_value_pair : map_seq_to_index) { - data[key_value_pair.second] = key_value_pair.first; + while (std::getline(stream, line)) { + std::istringstream s(line); + std::string d; + while (s.good()) { + std::getline(s, d, ','); + distances.push_back(safe_int_cast<DistIntType>(std::stoi(d))); } } + return DataSet(std::move(distances)); +} + +template <typename DistIntType> +DataSet<DistIntType> from_fasta(const std::string &filename, + bool include_x = false, + bool remove_duplicates = false, + std::size_t n = 0, bool use_gpu = false) { + auto [data, sequence_indices] = read_fasta(filename, remove_duplicates, n); return DataSet<DistIntType>(data, include_x, true, - std::move(sequence_indices)); + std::move(sequence_indices), use_gpu); } +void from_fasta_to_lower_triangular(const std::string &input_filename, + const std::string &output_filename, + bool remove_duplicates = false, + std::size_t n = 0, bool use_gpu = false); + ReferenceDistIntType distance(const std::string &seq0, const std::string &seq1, bool include_x = false); + std::vector<ReferenceDistIntType> fasta_reference_distances(const std::string &reference_sequence, const std::string &fasta_file, bool include_x = false); + std::vector<std::size_t> fasta_sequence_indices(const std::string &fasta_file, std::size_t n = 0); } // namespace hamming - -#endif diff --git a/include/hamming/hamming_impl.hh b/include/hamming/hamming_impl.hh index 4e0a97e..6f1814f 100644 --- a/include/hamming/hamming_impl.hh +++ b/include/hamming/hamming_impl.hh @@ -1,35 +1,37 @@ -#ifndef _HAMMING_IMPL_HH -#define _HAMMING_IMPL_HH +#pragma once #include <array> -#if !(defined(__aarch64__) || defined(_M_ARM64)) -#include <cpuinfo_x86.h> -#endif +#include <charconv> +#include <chrono> #include <cstdint> +#include <iostream> #include <limits> #include <string> #include <vector> #ifdef HAMMING_WITH_OPENMP #include <omp.h> #endif -#ifdef HAMMING_WITH_NEON -#include "hamming/distance_neon.hh" -#endif -#ifdef HAMMING_WITH_SSE2 -#include "hamming/distance_sse2.hh" -#endif -#ifdef HAMMING_WITH_AVX2 -#include "hamming/distance_avx2.hh" -#endif -#ifdef HAMMING_WITH_AVX512 -#include "hamming/distance_avx512.hh" +#ifdef HAMMING_WITH_CUDA +#include "hamming/distance_cuda.hh" #endif - #include "hamming/hamming_impl_types.hh" #include "hamming/hamming_types.hh" namespace hamming { +inline bool cuda_gpu_available() { +#ifdef HAMMING_WITH_CUDA + return distance_cuda_have_device(); +#else + return false; +#endif +} + +typedef int (*distance_func_ptr)(const std::vector<GeneBlock> &, + const std::vector<GeneBlock> &); + +distance_func_ptr get_fastest_supported_distance_func(); + std::array<GeneBlock, 256> lookupTable(bool include_x = false); template <typename DistIntType> DistIntType safe_int_cast(int x) { @@ -52,21 +54,53 @@ std::vector<SparseData> to_sparse_data(const std::vector<std::string> &data, std::vector<std::vector<GeneBlock>> to_dense_data(const std::vector<std::string> &data); +std::pair<std::vector<std::string>, std::vector<std::size_t>> +read_fasta(const std::string &filename, bool remove_duplicates = false, + std::size_t n = 0); + std::vector<GeneBlock> from_string(const std::string &str); template <typename DistIntType> std::vector<DistIntType> distances(std::vector<std::string> &data, - bool include_x, bool clear_input_data) { + bool include_x, bool clear_input_data, + bool use_gpu) { std::vector<DistIntType> result((data.size() - 1) * data.size() / 2, 0); + auto start_time = std::chrono::high_resolution_clock::now(); + auto print_timing = [&start_time](const std::string &event, + bool final = false) { + std::cout << "# hammingdist :: ..." << event << " completed in " + << std::chrono::duration_cast<std::chrono::milliseconds>( + std::chrono::high_resolution_clock::now() - start_time) + .count() + << " ms."; + if (!final) { + std::cout << ".."; + } + std::cout << std::endl; + start_time = std::chrono::high_resolution_clock::now(); + }; + +#ifndef HAMMING_WITH_CUDA + if (use_gpu) { + throw std::runtime_error("hammingdist was not compiled with GPU support, " + "please set use_gpu=False"); + } +#endif auto sparse = to_sparse_data(data, include_x); std::size_t nsamples{data.size()}; std::size_t sample_length{data[0].size()}; + if (include_x && use_gpu) { + throw std::runtime_error("use_gpu=True cannot be used if include_x=True, " + "please set use_gpu=False"); + } + // if X is included, we have to use the sparse distance function bool use_sparse = include_x; // otherwise, use heuristic to choose distance function: if < 0.5% of values - // differ from reference genome, use sparse distance function - if (!include_x) { + // differ from reference genome, and we're using the CPU, use sparse distance + // function + if (!include_x && !use_gpu) { constexpr double sparse_threshold{0.005}; std::size_t n_diff{0}; for (const auto &s : sparse) { @@ -77,11 +111,14 @@ std::vector<DistIntType> distances(std::vector<std::string> &data, use_sparse = frac_diff < sparse_threshold; } if (use_sparse) { + std::cout << "# hammingdist :: Using CPU with sparse distance function..." + << std::endl; if (clear_input_data) { data.clear(); } + print_timing("pre-processing"); #ifdef HAMMING_WITH_OPENMP -#pragma omp parallel for +#pragma omp parallel for default(none) shared(result, sparse, nsamples) #endif for (std::size_t i = 0; i < nsamples; ++i) { std::size_t offset{i * (i - 1) / 2}; @@ -90,52 +127,45 @@ std::vector<DistIntType> distances(std::vector<std::string> &data, safe_int_cast<DistIntType>(distance_sparse(sparse[i], sparse[j])); } } + print_timing("distance calculation", true); return result; } - // otherwise use fastest supported dense distance function + // otherwise use the fastest supported dense distance function auto dense = to_dense_data(data); if (clear_input_data) { data.clear(); } - int (*distance_func)(const std::vector<GeneBlock> &a, - const std::vector<GeneBlock> &b) = distance_cpp; -#if defined(__aarch64__) || defined(_M_ARM64) -#ifdef HAMMING_WITH_NEON - distance_func = distance_neon; -#endif -#else - const auto features = cpu_features::GetX86Info().features; -#ifdef HAMMING_WITH_SSE2 - if (features.sse2) { - distance_func = distance_sse2; - } -#endif -#ifdef HAMMING_WITH_AVX2 - if (features.avx2) { - distance_func = distance_avx2; - } -#endif -#ifdef HAMMING_WITH_AVX512 - if (features.avx512bw) { - distance_func = distance_avx512; +#ifdef HAMMING_WITH_CUDA + if (use_gpu) { + std::cout << "# hammingdist :: Using GPU..." << std::endl; + print_timing("pre-processing"); + if constexpr (sizeof(DistIntType) == 1) { + return distances_cuda_8bit(dense); + } else if constexpr (sizeof(DistIntType) == 2) { + return distances_cuda_16bit(dense); + } else { + throw std::runtime_error("No GPU implementation available"); + } } #endif -#endif + auto distance_func{get_fastest_supported_distance_func()}; + print_timing("pre-processing"); #ifdef HAMMING_WITH_OPENMP -#pragma omp parallel for schedule(static, 1) +#pragma omp parallel for schedule(static, 1) default(none) \ + shared(result, dense, nsamples, distance_func) #endif for (std::size_t i = 0; i < nsamples; ++i) { std::size_t offset{i * (i - 1) / 2}; - for (std::size_t j = 0; j < i; ++j) + for (std::size_t j = 0; j < i; ++j) { result[offset + j] = safe_int_cast<DistIntType>(distance_func(dense[i], dense[j])); + } } + print_timing("distance calculation", true); return result; } } // namespace hamming - -#endif diff --git a/include/hamming/hamming_impl_types.hh b/include/hamming/hamming_impl_types.hh index d75af12..69d4d44 100644 --- a/include/hamming/hamming_impl_types.hh +++ b/include/hamming/hamming_impl_types.hh @@ -1,5 +1,4 @@ -#ifndef _HAMMING_IMPL_TYPES_HH -#define _HAMMING_IMPL_TYPES_HH +#pragma once #include <array> #include <cstdint> @@ -14,5 +13,3 @@ constexpr GeneBlock mask_gene0{0x0f}; constexpr GeneBlock mask_gene1{0xf0}; } // namespace hamming - -#endif diff --git a/include/hamming/hamming_types.hh b/include/hamming/hamming_types.hh index 8fdf069..6d6b39c 100644 --- a/include/hamming/hamming_types.hh +++ b/include/hamming/hamming_types.hh @@ -1,5 +1,4 @@ -#ifndef _HAMMING_TYPES_HH -#define _HAMMING_TYPES_HH +#pragma once #include <algorithm> #include <array> @@ -15,5 +14,3 @@ using ReferenceDistIntType = uint32_t; using DefaultDistIntType = uint8_t; } // namespace hamming - -#endif diff --git a/include/hamming/hamming_utils.hh b/include/hamming/hamming_utils.hh new file mode 100644 index 0000000..849a296 --- /dev/null +++ b/include/hamming/hamming_utils.hh @@ -0,0 +1,112 @@ +#pragma once + +#include <fmt/core.h> +#include <fstream> +#include <iostream> +#include <string> +#include <vector> +#ifdef HAMMING_WITH_OPENMP +#include <omp.h> +#endif + +namespace hamming { + +template <typename IntDistType> +void append_int(std::string &str, IntDistType value) { + str.append(fmt::to_string(value)); +} + +template <typename DistIntType> +std::string +lower_triangular_lines(const std::vector<DistIntType> &partial_distances, + std::size_t i_start, std::size_t i_end, std::size_t i0, + std::size_t j0, std::size_t iN, std::size_t jN) { + std::string lines{}; + std::size_t k{[i_start, i0, j0]() { + if (i_start == i0) { + // first row, no offset required + return std::size_t{0}; + } + // offset for elements from first row and any previous full rows + return i0 - j0 + i_start * (i_start - 1) / 2 - (i0 + 1) * i0 / 2; + }()}; + for (std::size_t i = i_start; i < i_end; ++i) { + // first row starts at j0, other rows are full and start at 0 + std::size_t j_first{i == i0 ? j0 : 0}; + std::size_t j_last{i - 1}; + char final_char{'\n'}; + if (i == iN && j_last != jN) { + // this is an incomplete final row of partial_distances: no newline at end + j_last = jN; + final_char = ','; + } + // do all but last element for this line + for (std::size_t j = j_first; j < j_last; ++j) { + append_int(lines, partial_distances[k++]); + lines.push_back(','); + } + // do last element for this line with ',' or '\n' as appropriate + append_int(lines, partial_distances[k++]); + lines.push_back(final_char); + } + return lines; +} + +static std::size_t row_from_index(std::size_t index) { + return static_cast<std::size_t>( + floor(sqrt(2.0 * static_cast<double>(index) + 0.5) + 0.5)); +} + +static std::size_t col_from_index(std::size_t index, std::size_t row) { + return index - row * (row - 1) / 2; +} + +template <typename DistIntType> +void partial_write_lower_triangular( + const std::string &filename, + const std::vector<DistIntType> &partial_distances, + std::size_t distances_offset, std::size_t n_partial_distances) { + if (n_partial_distances == 0) { + return; + } + // infer row/col (i0, j0) of first element of partial_distances + std::size_t i0{row_from_index(distances_offset)}; + std::size_t j0{col_from_index(distances_offset, i0)}; + // infer row/col (iN, jN) of last element of partial_distances + std::size_t last_element_index{distances_offset + n_partial_distances - 1}; + std::size_t iN{row_from_index(last_element_index)}; + std::size_t jN{col_from_index(last_element_index, iN)}; + auto flag = [distances_offset]() { + if (distances_offset == 0) { + // overwrite any existing data + return std::ios_base::out; + } + // append to existing data + return std::ios_base::out | std::ios_base::app | std::ios_base::ate; + }(); + std::ofstream output_file_stream(filename, flag); +#ifdef HAMMING_WITH_OPENMP + constexpr std::size_t max_lines_per_thread{200}; +#pragma omp parallel for schedule(static, 1) ordered default(none) \ + shared(partial_distances, output_file_stream, i0, j0, iN, jN) + for (std::size_t i_start = i0; i_start <= iN; + i_start += max_lines_per_thread) { + std::size_t i_end{std::min(i_start + max_lines_per_thread, iN + 1)}; + auto line = lower_triangular_lines(partial_distances, i_start, i_end, i0, + j0, iN, jN); +#pragma omp ordered + output_file_stream << line; + } +#else + output_file_stream << lower_triangular_lines(partial_distances, i0, iN + 1, + i0, j0, iN, jN); +#endif +} + +template <typename DistIntType> +void write_lower_triangular(const std::string &filename, + const std::vector<DistIntType> &distances) { + partial_write_lower_triangular(filename, distances, 0, distances.size()); +} + +} // namespace hamming diff --git a/plots/overview.plt b/plots/overview.plt new file mode 100644 index 0000000..1134bb9 --- /dev/null +++ b/plots/overview.plt @@ -0,0 +1,10 @@ +# to generate: gnuplot overview.plt +set terminal png enhanced crop +set output 'overview.png' +set title 'Hammingdist performance history (million genomes / second)' +set logscale y +set ylabel "million genomes / second" +set xrange [-0.3:4.3] +set yrange [0.005:200] +set bmargin 5 +p 'overview.txt' u (1e3/$2):xtic(1) w lp t "" ps 2 pt 7 lc 1 lt 0 diff --git a/plots/overview.png b/plots/overview.png new file mode 100644 index 0000000000000000000000000000000000000000..2ed878a773178340c57e3d378590e44ad3519378 GIT binary patch literal 6498 zcmZX22{@GB+y7%5jHQGavSrU8%`kRjiNeTM_MI`7EEOf&kO<j|iNP4zzm%A=R!C$U z#=gXtk}Z468uL!QzyI}rulIef^E~G|_qoq=FXz6``J9tzZf3**761bPz;X48fh7RY zqXB@fi-mzk8D<}ArZtq!O|36esZ<(;NF@HLS^)q{Z3U>n#zrd==;{J=eZEjzMFA|b z6-&M7icJOpBo?4zsnOJtk_#7TLy>b7+Bg9L0T>L1LZQ%TbaZrdPEHPqL~3nq?d$7X zSXiKm*t&EneIxzF#NyWVtvM=nV<whb*H*o;K^+HZ(g07|H~M_?d4*(~zwKlQB#5R8 z0FV><SAjn&Qi1+KD$i4DwD}emOT7#nVsEYB?r$wVepm0;5YP7O*EA6;N-Y64VmC5@ z;Thsgx;gT?pCXnA!1C~5k+g!vy0&6nsn|dIBdJ7MaitQ2sI9G3nmyE3ay?;-x<#xb zw^7^3t*;`eNFr7A{rmR?1qC7^BD1rzEiElBE-pGcI?2h&L-+b^X=bwqU9r0j0GuEH zymVP|oPq$rH+<DV*ZN-GdOj<zNR;Pth|rq!s_WXZVxiYh56eV`=X1?VcWm4*Q|_(8 zlG=kL4I4y!tt+(^CR|zuzkUv!%|L%!)j3AU4#?-6GJPxU!Ofy$X1L|ljB-(ed8HMf z6;z)8Q9Wx*UJh(LA)FB$E%3Q1W~Y0JnzeVQsrPN!y9em#0(aSO4jZelTxt$NeD^$y z(9uPF+q%?!ZCt@@Z`s_A+@@~CA(FBdu^TUOl=Y4p1E(7_^;K#LQcx8v+jMBYJ1J;W z9wcQb?o=b4Egw0ZY>T-7OEu&ernXH7AC8u<KWn!<M89tFj^bv^{ZX|%xc__TWV@_g zIQHn*Yi|Mq^|?W=vi(=c`1j+FR|?fO1z{pxtWRNupE_}~PKS=FulDnqpAC=Q(fi3x zS{t^R#;C&d?Dp?CJ<fPCxhl?>>&&n4>yBD2V&jsjU?vCi@XM!cA6i_`V^ko@k<R@t zMu(b$jo<3@q#iG7<5zsH1%%wrt*xpp3O+hIRjHP*c_6z3-GtuUh(%6!FC0g?lh8Zw zm40nG9dHu{By?2jt|&(;2xm*<&IS7&+G@7%(Ny^DT<K4L^lX!*Y(pWt<`?t2hvROi z6G-q(X@ls@<y<qZcduHq6vVEce4k#L#I#SHwg;bon;!7=IRA5|_vN(CjzXEM#@=TC zp4@Lb58u2z6}n_SryBV0HK>o_Zc4@HxZ$vV?<eosn)Hp8qZEX)^;7h(DEgziAHpIA zqWYT#EpOW)VCvT9Yl)MJ=fm~ESwZjZ<03r@)sE@@$xd&Nj5>Tp&E}BPJ5}>M<7N-3 zCpA9t&Z8Z(+doV{B6EK@qrDd|4R7vjfBb!_HqbPZA17@Z{chrnrKCf9jGE;r)E^}h zuG6j=xmT9;KDSg9FDqVJUS|&zZu#}|!?AJvVTUDY#bhr|ao~;V4B^7!6R#{0)X-Fv zW+_Zs1YQ)TI8+y22F_38i1w?SKwvt($+fVnvk&bfoOYHZUYK?MV>gZ0K0C0bb#x%d z8S_FJO)kDzi-ZgMug{GAe1g9JXwcL?-j38!AW!xUhKIq~R`$OoqW`#Qm|FAd0vCBX zCn6cWlhMR*TM?sL>oELDn2S7JFEegL()o_wFv+fqD9_z)kn}aYAlA#)qAKvr<q`cs z0c;T38=kRiZB3pzCz7<>@*Qmevqa1%_wi|bw4PrYim|&_b-nb(ipLlBS<+^CfJ%Oz zb!YY){DM462ySIn*<HVDx(_2b;A5{rFwY@AmhUc;eq;Qj)Zty0>e>f(B+X6Dby>0+ zdxP;5ANlN2XXniHP+$K?A%{AB)4$W$t0^2dg@2Oly-$ejX&S{XIwI!X;Z{6ce#)ds zwQ1*?kpj=?4t?+RGap=TWc<qYvBx~&d|vMk)xnQAbX-vvI}qc=hy80ewPJca*|UjX zIO>$kHB;4jx;F8HW`XJoBDeXs>N>(?mhx$BNugQgh|D?nd~}m^c5PhxJ2Gv4UZ(Zh z4Z>E%Ydf@XTU`G~k!gKc4oARxv#s2<eQRO9zQr%Z&1pRt!SJzWv#%<RXlkEdNJm?_ z{_oQuCJv~TVQzdAFVV$~d$E$!y&ggfA+=TMl5l+-Z|z%S*p>_tQVzfwc(G_AJ%!yG zz{h}*FmpN#=mJ1SGSNC)g~jjK5;8wYrtiDUOJG2^>I4hpw(;8;M@HCUz9Vj?NYV^T z|1r1Hhwm@q-%b?BEay5Is**izRimPUp%xUSBW0^?CH|F;8Ux)=YvX+h)v}o-e4oxR z2{DjcEu33)V)eMseO)-%uDFc{yk{;kZFH{w8Ya!C#Bp*Qou=PI7VV!uj=J`osOwzK zOW+89oNguCovF76Rkb2*eZ(ZTNd-Me%OS~YVsD)*HJby187NHSh9uY-racd*i-JVR zL<%ok2rTH5S=Du1VE`yp$uH!qOsgW%ZXBAg?q|C5#Gnmj>ozJ#VfS}S^I*UOu39>N zuF)}4Ksh~}!EZvSTa&{6`zz7?EX^rcDPX^6`${~mGL9L#1dv<3lVs5`=sEGr@(<8+ z`L`Z=G2&yGI)nr%LyRV7uh`{LNLd$q5D~(XSCY+yryIz@>B3yqMr-KsF*_GL8UH$3 z7?pAbt=lr`QBlHwNJdH$Ct($5X=2yHM&#tVDQj*cHhuJDLWeR=mn0pW;lTh8=Nwm4 zL6SZNRd_8EBI)_y@-T|lXB|Gd#TaycjYmo|7)c`7zNCbm`UJv^@gCf7uMhUeqO~%r z2~pC$L_4FZD1L)TqMgq4_$AEPDY=5-5LQZ+$c7&TzRL2S$^Y9(YPOGu2+VBtL`{SH zD9iC0-<28u1cn{ov<6KZ?S^JA3i}9vR~``3xQP23I%BFFakX^#H)et~Q_UGLV;AME zPqYSEbY*Zd009$6IQ`-HQ<5YYo50`p)<poXtg9ipm<|yuJ`x+}!{7gDd`k&@qGkca z_dT*`6!Co_Va#6*5oz>v+w^)qcg`N{rH_u|a=hB{(5_K#>A`s4=puZQ1D}ubz*&eF zL*xwuCO(6uoJ8m03OIFj3TqCR71T;lf(>6`(L`Oc<i_V4TV+KLD2eBxwNtNRKqql$ z@l*cmgoo%~K8l$f$x>K!Do1z`r3&>F7r9KCc)cfr!gAG9V!A$nYASX&t+s>&?jH^i z^^53lcGg~dfU3+ePBE3eGcZ<ky|<jpF&h;En<b;=(ER@NvxN`Qjfu$eoP6Yi8813$ z0Ps(`pjbTzeU%AMCUMeyk!X0)W?Wr+h8>?(cC)t@x7gM2wF&E8o=a!^Z(!%lsnl?~ z0HgUDs0b4a$ve%2p4>C^*2^xzFk34b12WcMMaRlk@Nf7x@vVnG<0|KxdIJxMF&Jb7 z;vSyL^&U9M@{fUIixSLLz8UT}K@@XkRQ05BUiwQXA&F6>c3JFuWXoja%JUzaYGt$R zC;-`IM5i~yKFFRawTd9!&4-PU19Xif7lUrJOm0gcZJ>u_o<kbRrqKUh?wGCT4RN@J zaUjmiFvu-Xbnw%4eG_i;OCl5H2gNyR&T0=ljg~8aY}(x!FvGi@KP}V$JUsL;!6${N zx;e-`L$Vq2NK}Ics#z3$%^qV(dLX#GVNg)$Z!1tZvfEJ>B?TTEdf}DB6`-u?OiVa? zjK)4WaJ6yzHjJC6<9M=89PVjJPyqK#C*AX3zfE^T65RS~4Pmv6XnsV{pL{j)m~}cN ziZ$N>$A|CP%?akg6XAB;t~_<q-z2%2<d(H?@@2|X(M<RIiIY-?_3Q)c%*v`pusZ`U zOIJ5)0h}u6Iu`xx2iAP?kzpo(PlO52?>SkVr1(dSZN?-7ZUJa^vvl{_8Y^S!l0JQ` zeaPi&iNZLmSZpz$s$C<qbSrN#0VTR7I|2lXli}aBbq!45?EzszS<^^s#SUhv(sWJq z^?4(UZnRibtIu<d2Z?%W&*8X(&NeI*Ur2*0F;Cy3{|D<}cHsxbTxAaT6t6jcsj8U6 zH>lruD#2<wt?b5$mhDwRYe3G&=F4EAf2;9S$h{^n+p9;`!qqm6ay|u}y$q9}s^UoD z>W`yFw-{bM*}eLf2q}EbrJfc;VaG3clDxCL{RE8pF?Ec1i$`1$?Ea_+J9K#Yd++8T zF`*cYq)_;i7&MzJ#A{HiSp$Np1OBiXogKiUA&MBBe#%9>#;ybdnZ*ohYuIH-7pg)B z!Wdq$Z>xn&F}fbfd9#s2d#1Fjs{;$VKY-wLoD45cuqt%Bsc7R8L&NY8kqSuCCq>GJ zom;ktpFpS0%A)JOCYd;K7c&FBr8!tO+UGiHv$dZ{PkjBG{1v2r{TpW!vk$1_MvPBN z0@iD_OWNmlM+n^j!2+T0)`;t44)5*0NORS7WDV-=-GQ&5CS@cEMZqj;*amBCDVo~{ z#E+2~tt^$Mk$b!{b<DnTq4MN;6U@(PMy!{H?Y=0l;!yBdrDu@8B0rNY+c^zDNzd2H z*K{WcyvKkOictuL{(KJ+m_4&j50_8VJ0kaJ#Wj^l0X!O}+F*0^m&w9v45-%_c|-=Y z<69)BRAl7YEZle3>J0=zNm=uGlcWTz2D(>OqRWUQMsV+kyq*2TQU|<w6}<7(z29*R z_$=nMf-a;_80Wp;jOBo^P6kp!<CJF92ZjzarnCZpw>1(kBQF=!KQBGCf_UK0+bSSH z1dDXSQ?vz!1P0kNsstuE?&$ex9eW!(Lk9)74}Wmxv5ofKrTRrRT$_)_yS@8j5>}uk z*YQPo>c|IIP2imI-HB4f3Y<zq%$UJ6bywVLHF6s=pRkE{v<>cP_=Wx|)a1TjQ0nr} z#1$XTex_Ko=u%z>N5Gg?@}(Vn!jKkQuL9`5F++?uCccc*xlbG(?#46cPI$F7B6mcm z0I*$)0q2pntSjQcSpHDvS6e*g$XT{)Vwp2>@A(L^XawCKjyuzV@#di-{bByAWHbir z*ByE9`+Do#oj-&xJe&{C?A(~Ec|oLi(yrqzTno5!FmVGDirAXCVIFf^`15_u#2Ht! zNuf3m2VEw0K_;Y3v-BW~6!TeG945qd5|wDkl3I8>NI-}eU;cacnKkCjpZ!Og7a!-I zIL27G*8kHI^P$#(G|r;Xd2uAb&U6)7$a*VujJ)3^nS6Iz*6rmedlt2sL<(30X}{SH zR24Z*Zbj@u#Aw^hPQQ&WP4(#A6nYs10!7}da4CmC{jiZmfOcxP0|q4ETEJC5NE@#* z;r%fmjG_P|EESq9dxxWp{FT!ciC4xL*#!6bZEGsSkq?z_TiO`FFk|dLaojJ8Jvss^ z!f`1I;MB(;T^_vX(lMwh<YSvuWlpp@c=DZLMxyx`XU-`+pGlpyo(mQ&ulpw@lcd0{ z?i?w<P}tE#0)w8N2So~yd$SKcOQ6r}OF*Hpo836$WpNg-b=_Pb1scpwo+{duOl?D9 zZYFxf)k>)?;ke;+Kw(W8gLvi}V-tK^E!yWQi~=QN;=^j?A4mbJ`Di@A;&pR49{s8+ zc#6UfH)FsT{+QL~z<{QfcI8oVwY!bcCfvA?wi#sxryxJF`N8Hx2S3pLFP(U?%wO%1 z$`8DRf?dc+qv_YP?1fd*0iOdw<ioF}_?Y(%MQ9eUnP4L_^6s=5EUs2KhK5b+huMF2 zy@Tt^tY+qh4#W}~uJ1wh>{@7mBSz2%bhsdecO&@EP8+}|h<Xa`hj%xK5a=pF0|RPW zx<!*7P5;afL}<N^e^)C)ysa>}wh-f$_61CKuKotO2jc6a(AK<3QiEqa2p%p>1H#1j z=xRRA@N<v;KQ1QDvRlthSpZw76@-Tw2LKrSFF^iZ=-D40n{2VQhq&*_e1>U;L}t;x z)ou9ZUQrwkBnp0he0ogk=2=?&5Fz`WQsTvIo)HnzG$4#nffO39oY({g{&z>j@((xY z-;O`{9E_qxIUW!n8v<pltFX}0yYEQQ0JfEqKST1D2rRY~xAF~qPK*xaRIwuu3C@3b zUir^M0}D_34=;pu=nk3w1L`#e*z-8Qqlw`E0rcT?tt&)U;Gh4X{XfPaxq&=RJU|57 z_=LtJcKvAjpJ#?RbXTn&&if6Vj+j>n`G04QAmM-o2DcG+lB<Z0lYq9D;_KhXx}IT2 z&=&VN{Kfe-NWC2E=%8tuy{v*kM>T_;b1c_J!bP9tm!&jdrvrMHlQf&CzTHbZrJRPt zI;-PKQ{*p?7DKp;Y7&%>U-z>LBQhT}+?=ggNajZ3#?zle?#fxAqCuUPVQs~=Y}-DC z5+ajt3(sA0nXc}vkAW(F@R6D<e#Y@Sw9URc=Qx}qbxuieI6k)P^b|vg0#N&wv89vX z6fmIfNzJiFc$|l3XkKn=C=~tn+1!oMri@P#riUx@K42Rk$~<}W%{8PKJ|C>L!3{5x z`)Vx9RB)2(lE+Z1DcdWOJ$bGzGyk-uJbv(Pf^m(Ioil^ld9<U8Vd<nJLPHlOeDd9~ zF62FjXBdY8Os$FH)yHG^^m;`}SS-4ZFXOYb!QDe>=j~9ms}b%Qa=tS9#o8eGMn@D0 z1{ZAL`jz08zVOCcpo{UE;rF2$Fjn&IPxCWCn%?J)9$VI|`Id{co4M@90n3C%yYj~> z&q~Bm0Ql7EEv+|EwKo31a>QeRM=y0(W9f^Jo`2?hSo);TB}2Jctrv0I;}K2Zq!ebw zLnb>;?GjZwnc=?Bw%cE%!w>WsI=+0+a)3J;>4=D?b`^_$2;0YgzIA77Hx}xYw8Kbr zgtc5x*JmhEnsT}_`ytq^Bh_br71?{?%(c|rX~*;ullwP*JwX5aBM3vhxO?zsSK#oL zoO9SZwb<yU<(o&2w{QE$9mGN->m(ZQk{zv65<uW~gL~GsqQkKs3l7<h_HY-8&{wvN zq9$zlz|X6&W_ck2ndIgkl^gr}U#m-r+@_OXug<Jt9M)o?@_ulW1W?i$Y5Rj}P3zZh zh|eS*ovv=wKKvA=iz8fnSlR<7A5f4MuQRxNj<2t_x%fDEpD*DVc&Vll(XH4uqz@`@ zPv?}z%PvKz!_CwA^&)g|ElrliVaprte)h53?azM4LK!^i&94kY7L}jsdD4_U(|l!S zVDN6|r&5uE_n|K$A{{R%Us~{8uiN|C71AQw%aQ|lmcDLmp{meeuLDV+Vc}79{mYuo zN@Pt}wy(*9T5j~3gASu-^J;r?X{~8GD>9U^w_0kBIk)Td$d7-e|6~+4D)?z|6uJ4- zQ`i~@f3!mHPaz#o__bBmB6iJ@--~?T%3u3&^)-_78`y6S)Y;Yxq(P2D7R*TXUO7?o z8ux}@6I3f7r8zbQH2jPe&f1>A$RaM?z-GjhvOEp;R~$t=-j?rOSt|R>Z9MdcTLyKZ z$D6N2R!_Y*1rxubi{f&snK=<3b{`3LlGILrnDsccQm;FMjK8@8=eR-f(R!(<F#TSu zr7Nvx9kzr^i8!D4rd>1W>N5*>E7nDN<0<#ol@7t}dzWFev$?3%8hk|q|K<B!sYySd zMy8^(g-6a@xSk-DlZQ}oY^?MrUtyDjtQ)<t8!`>Rmwf5%^S4hUe@v+MvAVCcUm)T0 zL~xY71g+m?3iErGbeDdDi*U#0m$d<^r1YF*nmoD6X`fr^+Gc9W%r)}<GVY2*qXqdQ z+Y7P9ud**$z8Jq!%`;G*cXvh4)s!^K<5UBG_-MI+Q6gp~mZ1ju-weyxy5-w=9NBNu zH#{L5!8E9boH^*>4&?~Z5E5!~KVBk#Z07~*McOs%30@%%Gj^tCwe`EoIQibb{HXsS z;$hx9{7OXU;OX-?*k{z!Q3jvpe@=Uby@cc|#5LJjrEg3&mdG|(k5!q%wDE4$X#6y@ zZ*-^K<>-)sONh%?($oi1O!@RoNb=L3=MWPTwNbElGVsXs&lNcilG&!KiKL{HbN;t> z(tf*glmBqG*cIi4>3dFICtILZ`f~7DWAtrRc4qJ1HTye(VQ_o*rrn(+9gVYxZKI%; z?X*o6xsx^fWo9qF{X|M}@$?(YDc`SieEk`3^Gub?Re5D_#j&4r&^{!5kG)PI?-%xn zPbo7L-e|Pn?+<$y<gq#|MQS->a9`OOr<G+%CLNY~+|vto_5-4i*-Aczu}6j8%oF>@ z%yW!E7^Akb)E+(LjUM8uRlOc-$~tu5(DpS?=&|dA>OL!<2va=Yp@rwZQs2K@PvgGw zXFSe=_kE(%$u7znPJHYb{Rr)*V4p1ppJ0Z$YIEAg$gvD3>D(zSQ2m@SLY|K2Zz@jO zG)FM#yvp~a**B@DqYjr{!j%p~`%haAR}T&`Rt9Cryxb?*E=%t|D~Tc<baRKspEhcN v*!FHus>#6GuBDp9x`Lu^zeb0wv!_ri+;<nmz637(Nw}+*%?w`ZxyJq%?5ZIW literal 0 HcmV?d00001 diff --git a/plots/overview.txt b/plots/overview.txt new file mode 100644 index 0000000..f36efe5 --- /dev/null +++ b/plots/overview.txt @@ -0,0 +1,8 @@ +# time in ns to calculate distance between two genomes of length 32k: +# note: fairly approximate numbers - see comment for origin of each one + +"Python" 54000 # (very rough guess: original dataset was I think ~40k genomes, they said it took many hours to run, so assuming 40k*20k distances in 12 hours we get (12*60*60*1e9)/(40000*20000) ns per distance calc) +"C++" 3266 # c++ (bench_distance_cpp/32768 benchmark result on hgscomp01) +"C++\nAVX512" 835 # c++/SIMD-AVX512 (bench_distance_avx512/32768 benchmark result on hgscomp01) +"C++\nAVX512\nOpenMP\n(52 cores)" 42 # c++/SIMD-AVX512/OpenMP 52-cores (here I just divided above value by 19.7x which was the relative speed-up of a full from_fasta calc using 5000 genomes from the real data with 52 vs 1 core on hgscomp01) +"C++\nCUDA\n(A100 GPU)" 11 # for 100k genomes from_fasta_to_lower_triangular took 60s, divided by 100000*(100000-1)/2 number of distance calcs, multiplied by 1e9 for s -> ns diff --git a/plots/speed.plt b/plots/speed.plt new file mode 100644 index 0000000..121b945 --- /dev/null +++ b/plots/speed.plt @@ -0,0 +1,13 @@ +# to generate: gnuplot speed.plt +set terminal png enhanced crop +set output 'speed.png' +set title 'Hammingdist lower triangular output speed' +set xrange [0:330000] +set yrange [0:100] +set ylabel "Million distance matrix coefficients per second" +set xlabel "Sample count" +a = 0.5 * 1e-6 +p \ +'speed.txt' u 1:(a*($1**2)/$4) w lp t "from-fasta-to-lower-triangular GPU (A100)", \ +'speed.txt' u 1:(a*($1**2)/$3) w lp t "from-fasta/dump-lower-triangular GPU (A100)", \ +'speed.txt' u 1:(a*($1**2)/$2) w lp t "from-fasta/dump-lower-triangular CPU (52-core Xeon)" diff --git a/plots/speed.png b/plots/speed.png new file mode 100644 index 0000000000000000000000000000000000000000..2e6df313adba320449f5c5c268ad8a89c4b3b5fd GIT binary patch literal 8301 zcmXw81zZ%*+dqyvTJnw#1!;~hDG31q0g0oJ6r@{_I$G&cQc>wf>HvYGOG@HMK}zrd zX{5aO{Jo$5es=eH=6U9s=leW6Gdr{UN?-301t}9L005xS(o{190Dy1+0PiaZA16_d z+WdtpsOjq%sbjHNoTRX@@E<_|01;Re01G%cKq&);h5#xqKd>kcK!h?X0t<ylBme-) z5ddriHXJ)s%+HTARbHFK*)cIOiHnQt>gqZ<IfaLZ=j7xxG&G=4sIOnYZf$MhTpWst zr5>bK&u<?ZAFg4s2P=`-=I+{q11uVV^9FFh-NU&OxP%i-|0^djGJ4^l003ig;~2m{ zh*-e*6qYUn8?JvC5rI_)Tt)coz6n0uPV8uLMaGhyoh=teaA1o82ayMvfa#UOl~jFY zV^@&~IzR*+U4%03jEI1vBH-AFfB2QLg}4)rE%d^oP*_|%Skzd{yF=_@Ve?owwtEa! z7lKtT#By|YcD{fAo}Hb2b#=9?tINj5MoCGjx3{;nv@|6p1@O+-q;WSPAwi`UWsl1O ziI=9CF91N<_wT~X5};%T0N5t9)KrXK<nI@_e5~T7iE(5-D4pw`pACA6#papiQ+q4g z%(hRQKG$@52abji=$^pn8p27qK2tv1U-rD0ce#JVr;c9mY-btP>sS_;=Y@{^46|3f zIc+hzN}}M3|0!r$`lx1q+-v;6jH7Pfjc)!yFO>}gNXO%*r@?&!@;z7q<R<?Lg>;BE zxQ(28vs0_LXxahZW}cOY7%cXB6^BoWby2rzegGMKoKos=8q*7ny&S#yp~fS>vPI|Z zF8UK`dUfIAO9Z~BVQNT0b>g(XweDRbs@9UGskrRE+Ue>SsOe@oAOD-$O;yyk@G8UP z^~qewdSX+ss(~=c@2)!Fv^+t^xzX*uSj&`{2=w-LXCvqn4HeHBo>6$U2JH;X(3zw8 z!!x}KD*g1UfuTd~_cN|~*vN8JTkppluhs*ZrEKTYuBAIntW>X($e525BHgpY`x#c% z#jaUjKC-_t{~bf0{oS^c%|kK#Hp`EB?gLEqix%O)zVu>x>~rwlF|gJr?QHpJX^mLZ z55LLAcCG5}*B#Wsd8|Enp^~lbE^QiAl)L5&R?Kepkf?><^8q3=p@$t{6ZkpC{)%oo zOLKdI!m20$$OZYlgFXjnBb)BiNp?S3c9~7Hv~0^D8q*SyVSokNg@_CsE5oaAx4c?9 z@;&`z?&X4*u>%*N<}{EFZ;66gGs^i-=SFNoeaK`w=qoFHg>$ROrTDK!m*3$%!xSGe zrE6SE^RzH5R5h?w3qcXc{P0sRXT7)WM)=VpoVfrc^Ylw3@$`<Du1+v?zqRan^nn+$ z<Ku@M>iI%hUp6<d>~N8>BI1m(d}6XB%DBFP7z#Wp6V3b3>)WFcDk<8ig_;4iep=D& z<c_aH08!5Drd_J|BrO6dXFYjja>84UIL5Zo{*5b9Sa^%<U5U1Y?uQ#UM0RzCG*lX= zteJ-VrtsT#&E2jSAAYwjTNSN))Je1^%t*QYc41Yoyna08t8kvb(|v_Yu>K;2q<1#A zwJ_T=W?E0`>-PQj(%$x=Nn{;$Ek$!$A3T$~_!crspUuehv843X#?x)n87e-K0gVm# zc8PKLr*A6;*#)1`>bbsl<a3_mdxY0<vOTzN*DNYX?sN7pFJ_)Bf-CVqBc|)HSJTk# zZSYsfxzgnV4@_<0o%8RzB`3llghJw<)NM|1G;U7&-!ZOCBR%l27e=WNL`U+4u{)C% z!ad{oXMh55u3A3&(8s=ClyTY(pid|OJ;?acMgjPx{80PF+wZ2fa$Ep50qD=qjn}W4 z-!_wc0fER_NZT~McwJQ#@!+u`h}KsI0m%>N<GX5$H#Y<o3t!cSOf%m1TDjl+P>`bW z`&v@I#~}%W=VV_ZZ3qdd^RR4($aB*#>Pg*;D4sc&9*XZnL{XOgt>q_G>=H|TpZ8vb zn#|?BYw#$k6?JK&$53Yr?QU*BzITA7Lv;sOeJ663c8Mixspr#nzK3>zew?b%`V$Ve zH-p@KZTn;~>6)C4Lu$OPTT*dA-@AYZyq-T~eT%h1ZRlVoIkCG@Jikbj1Kp|Tw|nBn z=gQxvrh7m9oQHLnmPfS8DQ3!k5K?${{%CJ23Mj6iiFr;M>oRj|7=Kjg@!8D$x=smy zEQ={|x{D%A?g9y2FBAT#wA9)Bh{06DK`UjOu!M(T+xU|sBu`$Rz<4kwR3BcGom|cb zAyYYh%sCL%MicF_-;137;9zLb)3fOG8M>}!)u+Fx)+P0f-c)1r-jORA+t*7+iz3k% zI}0kOa{WY#0?;`D$7z8W2$j#y@1T$8w&p=K;+tV;sf-xvVWhAfZ|cH5D;qOMwZ#r4 z0cf?d97DEiz-apY(1sK|^wm%}LpbxFDwKnHVx<i?H`}IHzbJ7Nl`((acxpexFGjFN zenmpI5%x7upgeJhPVLpc_X;w7U-c0X1FSiubRuj%uVVz}-JQvMTmdctif7>!)4~K* zvgZ`Z<yX9&!25ELhS8a^9Nt8kvV@)F{a@f*_WmsD(0kmL>JGl(-99!#hGqIQ(*w5k zuK{TawK8}FQje<475BT5x4~aktVnuFDnlWGZ5zRCU-z{YV1^KHeee|P5-lvqvF}dc zf^;G5clBaywA}FcYk?5W{h9?1r878oQ|zj)OR!Eww%Z%b`1npq6IFX#bn+HNP$*Hx z09-FpcRUh*Wu#=i2+lS&S+>8LS<Cqnm=`*p2&u}1r8l)F<TLz#6gN+*9`8U~{7wSX zTx|PZwZ(Ua*&f2TvZ$M~x#^8)7K(t=M=(sB%}TqWRh9E!>)`P(0bmlu*wpMz(gs{y zCG5XkB+9ck&#djqz-poExJOcEvoo=1z&J(Z^w+?kg4|b^{#wo!n}&4XaD4ktyf!IH z1@2iGz^C!Xo%HVIdmJ|qvan{hdB4p1wP;{S7*C#^_-}exaZ&!jgCpPYpEZv9`85p~ zWVv6#QSU*=u3TPFEvkZh>u|D?g%etY$#*Umo=x{z@7lUc5bIY!TWwTqZJ7K#LsFp~ z?`#Iv0x84Wl_RO8hjkROtYVNj@$Vqyae4e*fF@e&MJtN`-WDjm=KgHxL~quUuB@7q z$6><9J_uvY5f|e+(eYf80oYH%+>|2BO|D>QhZX!f!^aIIRUj!&Ghh16Kg{gvDgt%R zvxWR_*B^D+uWXZ7b2939D*43*E}!AE2Q11k6Mt2I3E9ITUtmk*-pm(u-wHF*9`VLE ze)^xPeF$BG*&Ku$_GaH2oW}Q>wX$cW`z*s?EXluw;JJNp-wn8@E_xvVywDafVoI{7 zGlF%gIZF0p-PSoW^-p`|laKnIR<p4h!8=Dn5RkbQScKu#AVeEHsvqkmI3LSr?tJI7 z5qW<>;?`}S1^Jr?{BqR%%IDi!O=|^mT0sZ?{%fnPoP*ipRs%!il#y1M^Ds{gN%&y> z{G7S>`?s;@HjJyAxmi~s5<g3<bX#}dS;pecQy{w;+g|7tL$KTU)vIHzIO|;j36iRZ zCv6h~A;A)Cz3v(s!G2dqZBnKb$E`-vtj@P?<74I{6lwe<9de?Y;pl}>>w#dm#z%K9 zcKdHTQqZ9w|IhvpQ$;LBg#{iRF68GmWipqfPgd@?iHGYS2bsynY79=y7BHP(C|RR7 zgfG&<e_$oQ*}nEkrk`)|@wgG0GxQ+;YooeUaDP4i>Ec(FGj{u^^3$^J!KJpJwFwn} z8nD$Fl#OqEt5BU;z8kQ|t@SUq7HvQ_N2M>v=R>WnK5Yy>-(tF;QvBZh5~Vb;YLna< zobq}^))Kxt(z@%ZSF-%aYMJtzL_Iex+t<+G&MDoS>RpqKzs6MOZ%22S8^0CmtjH2w z>x}D`z5giEobEFXtJh558K*g*<x#BN<Y4djzb1~eKvX9^bvuGz=%O!S<4KLO(mdUE z+*`4E)Mm_^;_~bKa%2acb=aVOT(qO0_<-xUIO)p3v^=}I6&8`Yl+9)Rt?JsMW#lG{ z9JO@}&xK;`ymO%989Vdu^9#zBMRPXdC0tL*77lq*h<zQma$7%|Yc$?E{G@e3WhL!q z?ymqZHiENGo&V?Z%+&$7{7TR;a9e8SJWS<p4$DqAPHe>FVDm+7){PXqy?YxOa_G0L z**W1XgzH;GPF`$ZQ^vca5Q|7iVpC*7^8*k9g(BBu660Ars0X4zA{1fMi6)1B`4X1o z8iD3`@aUKG`vk{F-cT<B2r+(KB#z<Tm4Q5flqIthi;K5Q>#eew;larVx=|ncyrBr3 z9w7R|%k(w%KX2a(zusFJu}f2d!-?K|@s_`L>*^&1*sm*B=J3SXlIrKlOg`79v@fKe z;W>jtoC#-1G874@{Um=t^=ONtw8-y3vTa8jCB<*iHM~>wnBO>0YN;Ax*CBuBVN3!u zhY%dXh>TdF?+xatW&u+Mu+A@BmFTS49DW`54^!&qJZ`p84#O=oIHy$-nbqGuE9RND zDGQl3iZuaI*-%Ozv4L*4R8IkHj_Do95C`b1(8iY+WtE>wW@ChD95&iDZOJTz0@HfX zz%5#pu$G4+00b|Y3TUGqy1+6O#a;Q4=y6;V^@IFWFXz8iNzr`FIM9ueAyQiSDX&o` z9@d}eAF%#gZx9es5(4q#)``qrC<FkB-uTroADgJ+vSQlFCkSaB#o_blG@*VW2RiQl zQ0NDcq06KM#6^C?ThrH<1F(>46Gy13>;k-a^R$TtEpYiZ`9c^+Q*`t@99s=1{8A9! z{BEs8=8AtBLfrmlZ1wwPCW%hH325p~trHc(_(v1)gf^NWmanF`6ZKa%Qdh{UmoBWD zi~OnO(3$zr^Q}4BDv6@@aJMOS>saGn*Y=?|<;_`gGy-F?(Wn4w%Q06%4am}4Ul4*m zBfx>`&b(8q*9-1PYFg6x!1mXwc8Aw^2&*3HKF0`@-p{)=qxgt|(b9jV@ePZb(S~BZ zzq#~vC~&{yyy5-ue$woX44kxF@9$@N=y2Tsq>v*=^wxs@{qQl;9ei&_shMG$2B6$p z8<6?eW~~_>Tf9Iw$=BIoEI2T&9f4s|UZ-+sJRn+U`c%xxoyI^{xP)hkmM~{BqS;ag zn}PZy6WSB1?6y9k{DmUpR@x(wbBE&X^sfP)L^T4$N)1cKqL2Iw+&F4<zU8dQSBDUn z3B31ny3i9?1+Z>NE%z-QkHBALQ31T&2ZXroodWI>SrFA!f&{rU2>Xml2f9rVm___I z>1IUhizIK-bBJpyfiP_+qWDTm904M0g5i8QoOeu(>oRpnElvG#gkW6`D9CM(z{tJk zpx``rFnVACzk^1Egx+JX!N4`Ak4q>rErRadK_A`mCA;j8Tk*2`c{nCavo1$*p8~u# z-4qqW<-r>z*7NNXJ4c;I6Mh*+$Fk=G?a-nO;j{FmZZU0M&uO*4gCO#CxjdQlRf)>G zm)~?IC3_j?l7=1H4(<{Vq5TPu%p4l5BZL!AeKB90eNH<F1D4kV;PgMcL&%%=x@A73 zXB&IR&=+Z54PBGCH9B+6_)~<*D)A$oP3@pH_%HR&RK^33a4HvWJ<uLgzQoPP!_hdO zm&%V1xa*eBtT^jjK}|oS@3@joFTa_ex!qv2+WZVlwv>PvIgWnfT8eq@uS;+lTd|+J zv%yhO`okd&Tc(+VAbI+GS?%h;xX!4<-Fu$2B3R0zh%=s!XGkfekp5#Zm7D|G%3-_v zrviUu^LL<VQ(ge(Q#0ysx9+M1N7A|WrpK<_oq1Od3Qtu=-=MdzTJ+Hhm)uIe^`fx) zpTDYR2(H=$x|}LI4<J!0HWynh#x{Y8-5hny$7F5_M`5CnQ-9(x{GJ0K)!edcG1U%+ z#)&}kK?PrYH%lO&GI3}@kN%UO3cmIPiRDrND?tEAJ-DK0jC4}P#viGtuX<n{L3zc$ zsTj%RQwj8YKZkw;C>4xui<YM^yl(7d@SJ-0sgyd9U-`lt!5yVT#W0h~jMIGSwB{`1 zyx>#5a150-c4y}a2Y46y`x_c0XR(GD+Y}7)LvW&&T`ncwx-d_en9g6o!_+5)SzDw_ zxVOkI#yxHBfkg$T3bxQ2cY4O^Zq{ssHmm;}m9m4eU;JD&>tFNI=rjxwYGA=&V^u0S z>o3gg9NN;USSd6b`%A9UL_4Uqv$I<0aaE1#1$p#7&Aj{>p}VY<agKGp;Sh#^$er7* zT&%;cIMsBQY>~<5QfA)ul+az*=S*f^0LP3qd>A>+&7xte6>)Zrp)f8%S7jbLAXF@5 zE#)cCVWBD(t!`yv9UhJXDKlUeG*6A?_;2s4$mV8z#1@`Az0U{KyN@_aDm2L+2~Hfa z!A5@x{z>t4xobqE(U@2|-4pW*6!2a1Z#5y2yK$ekDzAp_tAdje=@tJEgwB;x)=ZhA z&Gy^-Qiv7b0*Eu_&PUWx5U{-fKdL#oH!y8;M)+8R8q(+w6&^Ab9#XoW*MqE;2azwz zMV-X))lANLnJYH>GnG;`T5q(s^>9tjwYr%Z1`TTqo1P^#%g{9XD_XoUvi_Vt>{t(O z^r!wAkoNYnc2yvuT>&o;tmO(b`}y(DXeAkGJFvyXAn3E7onw-#hH1D~NO=EQS2A;n zz78Anrj5jD3<~43+}P9`b@O=O;6n|wmtktS$^|HB1$ZI&&HZG3aAg$O&hZi$x?#m} z6vr@cYqdE{N&c&i%A83|usp<)JfH-%_QfOS4N;bwEafk*3G$;4HF@46xhv0x$;L5Z zr$x9OM^JiaVU7IyW9LPP4y#1v4mqMbXob$^VFuqvtUM2qyo!xJ+THu^W%a_^AZX7k z6sOJc81oRnuz#DyNXY=1@%PLp-Z-D&lr&G71#kKX;@$>geDYt$kO_WK^-fIOtmZk} z%7_o1ApjF5%Y_j-#-KPMQQ)WO<2U!Hm%gBqr@=F4AUT&!!HTc1B!CT-PQ&-?<gMUd z)=#>%dNZBr88JPTbAF$e<wSDJo}0i2cgTJPQ--m8ZSbixc}tyLM<yL#l#(xh1j0d6 zAPofb5w-}jyFS3FPONTd5GqzwcdfLYD8!{5GEmPkxVVFmwxqefypp|+d2K^&z^Jx& z@foq{GoN3Sog&QTsW+bxc}boT{ybCuD7aX~v8v%x&3Yz%!aMs5s;+=*E~Q^-Z(LXb zy-n3<G7a85gE!+QB`K_d0qegYrG$q>-hC@DXRK4TS<wkE!|WmvCM6YU;-#%FO9c{{ zTCf*vHzJhv-pm<8GCymbG$87Wb&n`;NuHYKY~8w71-Mi#VssKrB25R2?<}m7_KH9S zFiazAtosc_VWN}hcF;H2DB)-W4R4^$BzhFLOiH}--N=Hx5*Z%-#X4@HB-Mzl>dXA8 zKHSk{t<yT5dARf((NZRvZo>l|!X)_><MWU22~$Is(ehdfkdDbH6>E|HL3lMs<Y(;# zx=C=nj0-Y<_qeLA0H}KL$2w9%ti=Br%-f9~vUz3~LZW+}anMLJ&jUr)nr=KMM()dr z&TE8bS<^m<d;wmNXgc6(0g)eI_KO-`^Cv~Q-@#c0=M$fZ&M&Z$Uj-|9up}CEtG_fM z-##IkQV7GlPhlGHF~oMu2+l}JF3#4a3LAbBpGcbPY9c7But{}wMS3P~-tZ8ITmWhA zV>p}lB5$`_TZHgkjKz4$aBwlck6j&m$h@i72K?naRSkh;olq59c1~gLhSk@1Pk3lT z2&5@Z>O*J=hzu*<dYXeFr)S(aW`t#snEk`K4CItB_>{n;8@DYjjGJ(-ZsxtoMHSYj z{17*<6e8{7g6?33Z(^|0YnV;6IUO72-t5f+R%&W&ujVuF1D5&r%j>1G+Qoz(5i(qG zEa9|nVrvX`LpF3_-LLV0FCkBX=69ZcARfgDhP4|^Ammr(AMZt4OSc&)SGo%(bh~*? z^oIu!Uk1*iIc==nNjp16uFO1be^@yT<$YgK7be*=#2O!N6-+p!_<ancRC%nbZ8vDP zHU2D3V79n+pM&a;l*!6q*mLPiV53CYy%F4S-aRI(rJEP;yba`i9`QJ*#;!PLpDP^w z3&VM^M!oXKDPLlb>v!XWT7My;cCYlfr*rt7Umh*TyA7_W=U(MRXO?c)5?!Kq1g@&z zh6O!A`KMJ|?R2bMmpNP8fKOAYcIdj4Uoh}JH_Cap&pGj~<UBeRbC&>-GpP26WDlL+ z_JF<5|9%LVPiKHqp(5eI#LI5~6$<uETBl&Gw$YI-U=-3r^M$s<-^_{M))=l7;u=he zQGu~v7K)?h`eClgqdy2Afj0vGRvVu2e4<va>-#;QhEyYv2NNV#n<_YSHWgh&L8%C` zW>C59uXiAB`ofvsS7Cbl+&O%Y{P;ehiK&g3)swr`R6I{;U@ji`eP_zwNaJ4m9+whG z?V?CarQO`=k$5giCiM(QEs02v%wH68jp-tF)t#XAVByY@Ml<c$&slLR>H00-$+<II zT!Po75Y<jirJ=l*=!PR&&wWF&=iJX0gGI#29(bHq>5#b1A#P*3?l&=9>BnP^`idQ# zw++RFT#^3P61(~>BzvA*M9j|noF@_}{ybvytj2{}9y`p{kSt<s*Y!yF7#U={7Sc>w z)pVlzm4Tg9a00QlOLQDe#!NVuTh!-<&`m)&9!8isaiq8dGfa%ctsIh3K4&pzPM)?I zsGG??wNy_S7;@F&Y3pb!CHD5@Q};8`2B{h*%BP70Qr}F2o_0T7_?*w4(F2v8lruKJ z5BhrXViFBrsLOxPL8*9B=DgD_N9<%Du!G4kvK;rchC}@S2-CkkVFn3$!y(eQ|M)z5 z$b<Q~@|OJ7^iHV9mDw-dt88#~D3T&3G=l^BE=Nby(@_O3FBlcKK`^&?6nCs2E(qNr zgDqR#b15(UY-#%#7}cqmM0Q-hQsN&OV(Ko;PY%46@Rsdz@{H*nk2<S(qiVA{5Cm1K zESrP&Q(Xbsz)|%kUQ-8o3k3u4N$?@k+F-F=vvpAWi4AVF+Pr^uQuR?*po2~94-~X_ zV#GZB#QsLViRB77tL>~8jk72-e%SDKf;1E{glBb+fJjagtz?4XqF#&AY@*3kMX1=I z^qWQ+d$+?lW9VU&cjl=`syGaVh%kRR3E9=2zYz_*fxZIy&HUyH&sHOls}PQL^j5e> zM<i$r?iIVa5yG+Lv+YCdjf6BDxNU6{VXPqQWR%3c56jvBO7c@E@Tt&QrUi*IypY&M z#@O8Mnm@W2mjmU<%BklP8W&re@@pvN_pqBHNv0*o{)wGfl=4G#D@m*LP>Xom2a(iu zNpADzUId|llOhhiVWI@m82$YUPP9Wt&Y|0m<q<oA-+}Dd4t6^fF2DXkOhpu%s==LU z;qvuQA61YXTzTwSTDXz}QzV`-dw{A9TvHvv31&|$-|e1MjiffVhxYw}YmNyY$61Cz zi{7C2G7h?48LxG>ly7%KM@UP`(CX`=)Y*l0<U|OB=plSf|2fIt6AXrm24A&eMV-n2 zhcFF!Ia=Kg!mguVozNGh303Dt+#Yh!=opF+_2P;uv%)l__^SLQ<il0)TyxRvIq(24 zD%+fm{2~>e{#q19|9H)D<`@oJ#@8`)zsHWN^;!&JpaEHNCk%<;a?yVn^tew?V2zAU zD=LRu#lg@S0K^y1)QqzDsh;ta6AD#*B|-4x{2BVu92n-GK;^tHu<EBpoBw<L&iua6 z_rh0q=JWoM9j;ZkBO=`@x=nnjDgwpi^xXXoT9p8vGo>s5FlJQb2mbe$ptM2!-qZ5{ zlag2lDU-CK{g&q~#-8=o@)n``77a<=Ye{*?s1E5YZBmLS<U(#$oY_7;L!xgSCC#hm z^l%@|lE%#46NxaAX$C5;Qr=Xb_6pKZUgDaXD{S=suVRyDy@tHBq|l%pc8yebbB<HX z<j7v|*@L>Sw8L^WRWfE-nCvEGw0RK>D+p+=@?cKt9?><b@Sz=rDCI7L(niiNrY3td z-gGn%i@$N7C8_d|&#GF|u&;BXjY-up@~~sv*nFJ?-QtROcDB7c_%2H|x!$evd(^Dk zv&ycl3U>)2S1E&4k;xHudrtqomd$fu<-&OLdCM~j6Zemu?P)D{V60T-)yo|TRr7i- zDP{8-IV}47pNfKFlMlEseJ`%YmKBC-(R$%eY-*D_R3e#lCDKK;J5*D<<X;YUGHTJ_ zLSXz8&({m9F@9EWF7J}6S}mm!)s(xlY>?-&vvXQqu;G@knWl7re6IU)&%}X}+{uiB z0n?PR@MH3|J2@_Q1`7z2pcKSh#}m@%ia!!P3WA~rD%H<ertGQ%NDW()3c8=ObH9}i zHX``nf1UrQUaaSr3FhH51B<h&00?g9XIXX@*UAn2^tniDO*gw$a$BS=0R9SfkKjD0 z?Gh%{AMuMq!y?0#V_)Fgua)$dh$a_1l^4`b_31KG3BRmfFX<%VPg|mB3r!S=ijku) z?W$&(U;AhwLv6pIt5N0;Whr)#(n&mg@K#pc`RlxrBZ={Omb5gK?2C)s-W84BNQhV- zKg&$T7%_`Tcm(F&l|%4#;UVynoat@5lY(p<x9q=7nPuC5l#YJ#<brQsFKcC74_+f3 zgHn!gEwvvIaC1rHLy+9B%dTSLp&;zYxyu2CCODYehm1rqCi$@?GVd`S!a48{epc~0 zDbTRLtg|N97<?8Wnyrwc0_RZAl~sSZyQKQj^ET5^6>)aJ#W*`S<W<sMoEVtqq<T(R z@}(VrHHJT&x!m)9)}3ey`??=8Fvwi|hRqL85ABRTei<iKXskE14#cJsi5oGf56bX_ Z8+O`cXpa1%hR(m7YpLt0)jWhp{vW%5w;%uj literal 0 HcmV?d00001 diff --git a/plots/speed.txt b/plots/speed.txt new file mode 100644 index 0000000..4ccaf80 --- /dev/null +++ b/plots/speed.txt @@ -0,0 +1,15 @@ +# Time in seconds to go from n 32k-length random genomes to a lower-triangular distances matrix file +# CPU: 52 core Xeon: from-fasta / dump-lower-triangular +# GPU: A100: from-fasta / dump-lower-triangular +# GPU-stream: A100: from-fasta-to-lower-triangular (interleaves I/O and computation) +# n CPU GPU GPU-stream +2000 0.653878 0.5127140621189028 0.13557552301790565 +3000 0.964759 0.7554650978418067 0.23105294106062502 +5000 1.63097 1.3445364689687267 0.46112991601694375 +10000 3.88273 3.1115588791435584 1.34703719697427 +20000 10.779 7.625964550068602 4.461474176961929 +30000 20.7542 13.989239579997957 9.265670311986469 +50000 59.7482 32.871332183945924 20.969019818934612 +100000 185.941 107.00290298496839 81.37370045098942 +200000 735.223 361.97915480996016 271.80367124499753 +300000 1575.75 780.524687159108 610.4017879960593 diff --git a/pyproject.toml b/pyproject.toml index a1c2119..6bcd607 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -4,7 +4,7 @@ build-backend = "scikit_build_core.build" [project] name = "hammingdist" -version = "0.21.0" +version = "1.0.0" description = "A fast tool to calculate Hamming distances" readme = "README.md" license = {text = "MIT"} @@ -37,21 +37,24 @@ Issues = "https://github.com/ssciwr/hammingdist/issues" [project.optional-dependencies] test = ["pytest", "numpy"] +[tool.scikit-build] +cmake.verbose = true + [tool.scikit-build.cmake.define] BUILD_TESTING = "OFF" HAMMING_BUILD_BENCHMARKS = "OFF" HAMMING_BUILD_PYTHON = "ON" [tool.cibuildwheel] -skip = "*-manylinux_i686" -test-skip = "pp* *-musllinux*" +skip = "*-manylinux_i686 *-musllinux*" +test-skip = "pp*" test-extras = "test" test-command = "pytest {project}/python/tests -v" environment = { BLAS="None", LAPACK="None", ATLAS="None" } build-verbosity = 3 [tool.cibuildwheel.linux] -environment = { CMAKE_ARGS="-DHAMMING_WITH_OPENMP=ON" } +environment = { CMAKE_ARGS="-DHAMMING_WITH_OPENMP=ON -DHAMMING_WITH_CUDA=ON" } [[tool.cibuildwheel.overrides]] select = "*-macosx_arm64*" diff --git a/python/hammingdist.cc b/python/hammingdist.cc index 6c82f19..b78205f 100644 --- a/python/hammingdist.cc +++ b/python/hammingdist.cc @@ -59,7 +59,7 @@ PYBIND11_MODULE(hammingdist, m) { "(full matrix expected)"); m.def("from_fasta", &from_fasta<uint8_t>, py::arg("filename"), py::arg("include_x") = false, py::arg("remove_duplicates") = false, - py::arg("n") = 0, + py::arg("n") = 0, py::arg("use_gpu") = false, "Creates a dataset by reading from a fasta file (assuming all " "sequences have equal length). Maximum value of an element in the " "distances matrix: 255. Distances that would have been larger than " @@ -67,13 +67,26 @@ PYBIND11_MODULE(hammingdist, m) { "than this see `from_fasta_large` instead."); m.def("from_fasta_large", &from_fasta<uint16_t>, py::arg("filename"), py::arg("include_x") = false, py::arg("remove_duplicates") = false, - py::arg("n") = 0, + py::arg("n") = 0, py::arg("use_gpu") = false, "Creates a dataset by reading from a fasta file (assuming all " "sequences have equal length). Maximum value of an element in the " "distances matrix: 65535"); - m.def("from_lower_triangular", &from_lower_triangular, + m.def("from_fasta_to_lower_triangular", &from_fasta_to_lower_triangular, + py::arg("fasta_filename"), py::arg("output_filename"), + py::arg("remove_duplicates") = false, py::arg("n") = 0, + py::arg("use_gpu") = true, + "Construct lower triangular distances matrix output file from the " + "fasta file," + "requires an NVIDIA GPU. Maximum value of an element in " + "the distances matrix: 65535"); + m.def("from_lower_triangular", &from_lower_triangular<uint8_t>, "Creates a dataset by reading already computed distances from lower " - "triangular format"); + "triangular format. Maximum value of an element in the distances " + "matrix: 255."); + m.def("from_lower_triangular_large", &from_lower_triangular<uint16_t>, + "Creates a dataset by reading already computed distances from lower " + "triangular format. Maximum value of an element in the distances " + "matrix: 65535."); m.def("distance", &distance, py::arg("seq0"), py::arg("seq1"), py::arg("include_x") = false, "Calculate the distance between seq0 and seq1"); @@ -98,6 +111,8 @@ PYBIND11_MODULE(hammingdist, m) { "constructing the distances matrix." "For each genome in the input fasta file it gives the index of the " "corresponding row in the distances matrix which excludes duplicates"); + m.def("cuda_gpu_available", &cuda_gpu_available, + "True if a GPU that supports CUDA is available"); } } // namespace hamming diff --git a/python/tests/test_hammingdist.py b/python/tests/test_hammingdist.py index 2f3dfd9..581ba1f 100644 --- a/python/tests/test_hammingdist.py +++ b/python/tests/test_hammingdist.py @@ -3,6 +3,8 @@ import random import pytest +gpu_options = [False, True] if hammingdist.cuda_gpu_available() else [False] + def write_fasta_file(filename, sequences): with open(filename, "w") as f: @@ -35,7 +37,8 @@ def check_output_sizes(dat, n_in, n_out, tmp_out_file, fasta_sequence_indices=No @pytest.mark.parametrize( "from_fasta_func", [hammingdist.from_fasta, hammingdist.from_fasta_large] ) -def test_from_fasta(from_fasta_func, tmp_path): +@pytest.mark.parametrize("use_gpu", gpu_options) +def test_from_fasta(from_fasta_func, use_gpu, tmp_path): sequences = [ "ACGTGTCGTGTCGACGTGTCG", "ACGTGTCGTTTCGACGAGTCG", @@ -48,34 +51,36 @@ def test_from_fasta(from_fasta_func, tmp_path): output_file = str(tmp_path / "out.txt") write_fasta_file(fasta_file, sequences) - data = hammingdist.from_fasta(fasta_file) + data = from_fasta_func(fasta_file, use_gpu=use_gpu) check_output_sizes(data, 6, 6, output_file) - data = hammingdist.from_fasta(fasta_file, n=5) + data = from_fasta_func(fasta_file, n=5, use_gpu=use_gpu) check_output_sizes(data, 5, 5, output_file) - data = hammingdist.from_fasta(fasta_file, include_x=True) + data = from_fasta_func(fasta_file, include_x=True, use_gpu=False) check_output_sizes(data, 6, 6, output_file) fasta_sequence_indices = hammingdist.fasta_sequence_indices(fasta_file) - data = hammingdist.from_fasta(fasta_file, remove_duplicates=True) + data = from_fasta_func(fasta_file, remove_duplicates=True, use_gpu=use_gpu) check_output_sizes(data, 6, 4, output_file, fasta_sequence_indices) fasta_sequence_indices = hammingdist.fasta_sequence_indices(fasta_file) - data = hammingdist.from_fasta(fasta_file, remove_duplicates=True, include_x=True) + data = from_fasta_func( + fasta_file, remove_duplicates=True, include_x=True, use_gpu=False + ) check_output_sizes(data, 6, 4, output_file, fasta_sequence_indices) fasta_sequence_indices = hammingdist.fasta_sequence_indices(fasta_file, n=2) - data = hammingdist.from_fasta(fasta_file, include_x=True, n=2) + data = from_fasta_func(fasta_file, include_x=True, n=2, use_gpu=False) check_output_sizes(data, 2, 2, output_file, fasta_sequence_indices) fasta_sequence_indices = hammingdist.fasta_sequence_indices(fasta_file, n=3) - data = hammingdist.from_fasta(fasta_file, remove_duplicates=True, n=3) + data = from_fasta_func(fasta_file, remove_duplicates=True, n=3, use_gpu=use_gpu) check_output_sizes(data, 3, 2, output_file, fasta_sequence_indices) fasta_sequence_indices = hammingdist.fasta_sequence_indices(fasta_file, n=5) - data = hammingdist.from_fasta( - fasta_file, remove_duplicates=True, n=5, include_x=True + data = from_fasta_func( + fasta_file, remove_duplicates=True, n=5, include_x=True, use_gpu=False ) check_output_sizes(data, 5, 3, output_file, fasta_sequence_indices) @@ -125,3 +130,25 @@ def test_distance(): assert hammingdist.distance("ACGTX", "ACCTX", include_x=True) == 1 with pytest.raises(RuntimeError): hammingdist.distance("ACGT", "ACC") + + +@pytest.mark.skipif( + not hammingdist.cuda_gpu_available(), + reason="No CUDA GPU available or hammingdist was compiled without CUDA support", +) +def test_from_fasta_to_lower_triangular(tmp_path): + sequences = [ + "ACGTGTCGTGTCGACGTGTCGCAGGTGTCGACGTGTCGCAGGTGTCGACGTGTCGCAG", + "CCGTGTCGTGTCGACGTGTCGC-GGTGTCGACGTGTCGCAGGTGTCGACGTGTCGCAG", + "CAGTGT-GTGTCGACGTGTCGCAGGTGTCGACGTGTCGCAGGTGTCGACGTG--GCAG", + ] + lower_triangular_dist = [[1], [2, 1]] + fasta_file = str(tmp_path / "fasta.txt") + output_file = str(tmp_path / "out.txt") + write_fasta_file(fasta_file, sequences) + hammingdist.from_fasta_to_lower_triangular(fasta_file, output_file) + with open(output_file) as f: + data = f.read().splitlines() + assert len(data) == 2 + assert np.allclose(np.fromstring(data[0], sep=","), lower_triangular_dist[0]) + assert np.allclose(np.fromstring(data[1], sep=","), lower_triangular_dist[1]) diff --git a/src/CMakeLists.txt b/src/CMakeLists.txt index 6f2d66c..5215b04 100644 --- a/src/CMakeLists.txt +++ b/src/CMakeLists.txt @@ -1,15 +1,17 @@ # Build hamming library -add_library(hamming STATIC hamming.cc hamming_impl.cc) +add_library(hamming STATIC hamming.cc hamming_impl.cc hamming_utils.cc) target_include_directories(hamming PUBLIC ../include) +target_include_directories(hamming PRIVATE .) target_link_libraries(hamming PUBLIC CpuFeatures::cpu_features) +target_link_libraries(hamming PUBLIC fmt::fmt-header-only) if(HAMMING_WITH_OPENMP) find_package(OpenMP REQUIRED) target_compile_definitions(hamming PUBLIC HAMMING_WITH_OPENMP) target_link_libraries(hamming PUBLIC OpenMP::OpenMP_CXX) endif() -# compile optional SIMD code as separate libraries which can be used at runtime -# if there is CPU support +# compile optional SIMD/CUDA code as separate libraries which can be used at +# runtime if there is hardware support if(HAMMING_WITH_SSE2) target_compile_definitions(hamming PUBLIC HAMMING_WITH_SSE2) add_library(distance_sse2 STATIC distance_sse2.cc) @@ -41,9 +43,27 @@ if(HAMMING_WITH_NEON) target_link_libraries(hamming PRIVATE distance_neon) endif() +if(HAMMING_WITH_CUDA) + target_compile_definitions(hamming PUBLIC HAMMING_WITH_CUDA) + add_library(distance_cuda STATIC distance_cuda.cu) + target_link_libraries(distance_cuda PUBLIC fmt::fmt-header-only) + target_include_directories(distance_cuda PRIVATE .) + target_include_directories(distance_cuda PUBLIC ../include) + target_link_libraries(hamming PRIVATE distance_cuda) + set_target_properties(distance_cuda PROPERTIES CUDA_ARCHITECTURES "all") + if(HAMMING_WITH_OPENMP) + target_compile_definitions(distance_cuda PUBLIC HAMMING_WITH_OPENMP) + target_link_libraries(distance_cuda PUBLIC OpenMP::OpenMP_CXX) + # This is required to make nvcc pass the -fopenmp option to gcc: + target_compile_options(distance_cuda PRIVATE $<$<COMPILE_LANGUAGE:CUDA>: + -Xcompiler=-fopenmp>) + endif() +endif() + # Build library benchmarks if(HAMMING_BUILD_BENCHMARKS) - add_executable(bench bench.cc hamming_bench.cc hamming_impl_bench.cc) + add_executable(bench bench.cc hamming_bench.cc hamming_impl_bench.cc + hamming_utils_bench.cc) if(HAMMING_WITH_SSE2) target_sources(bench PRIVATE distance_sse2_bench.cc) target_link_libraries(bench PRIVATE distance_sse2) @@ -60,13 +80,17 @@ if(HAMMING_BUILD_BENCHMARKS) target_sources(bench PRIVATE distance_neon_bench.cc) target_link_libraries(bench PRIVATE distance_neon) endif() + if(HAMMING_WITH_CUDA) + target_sources(bench PRIVATE distance_cuda_bench.cc) + target_link_libraries(bench PRIVATE distance_cuda) + endif() target_link_libraries(bench PRIVATE hamming benchmark::benchmark CpuFeatures::cpu_features) endif() # Build tests if(BUILD_TESTING) - include(../ext/Catch2/contrib/Catch.cmake) + include(../ext/Catch2/extras/Catch.cmake) add_executable(tests tests.cc hamming_t.cc hamming_impl_t.cc) if(HAMMING_WITH_SSE2) target_sources(tests PRIVATE distance_sse2_t.cc) @@ -84,7 +108,11 @@ if(BUILD_TESTING) target_sources(tests PRIVATE distance_neon_t.cc) target_link_libraries(tests PRIVATE distance_neon) endif() - target_link_libraries(tests PRIVATE hamming Catch2::Catch2 + if(HAMMING_WITH_CUDA) + target_sources(tests PRIVATE distance_cuda_t.cc) + target_link_libraries(tests PRIVATE distance_cuda) + endif() + target_link_libraries(tests PRIVATE hamming Catch2::Catch2WithMain CpuFeatures::cpu_features) - catch_discover_tests(tests) + catch_discover_tests(tests EXTRA_ARGS "--allow-running-no-tests") endif() diff --git a/src/bench.cc b/src/bench.cc index f3fede7..c35a30c 100644 --- a/src/bench.cc +++ b/src/bench.cc @@ -29,10 +29,11 @@ void randomize_n(std::string &str, std::size_t n, std::mt19937 &gen) { } } -std::vector<std::string> make_stringlist(int64_t n, std::mt19937 &gen) { +std::vector<std::string> make_stringlist(int64_t n, int64_t n_samples, + std::mt19937 &gen) { std::vector<std::string> v; - v.reserve(n); - for (int64_t row = 0; row < n; ++row) { + v.reserve(n_samples); + for (int64_t row = 0; row < n_samples; ++row) { v.push_back(make_string(n, gen)); } return v; diff --git a/src/bench.hh b/src/bench.hh index 510ec42..52498cb 100644 --- a/src/bench.hh +++ b/src/bench.hh @@ -1,5 +1,4 @@ -#ifndef HAMMING_BENCH_HH -#define HAMMING_BENCH_HH +#pragma once #include <benchmark/benchmark.h> #include <random> @@ -9,11 +8,29 @@ namespace hamming { std::string make_string(int64_t n, std::mt19937 &gen, bool include_dash = true); + void randomize_n(std::string &str, std::size_t n, std::mt19937 &gen); -std::vector<std::string> make_stringlist(int64_t n, std::mt19937 &gen); + +std::vector<std::string> make_stringlist(int64_t n, int64_t n_samples, + std::mt19937 &gen); + void write_fasta(const std::string &filename, const std::string &seq, std::size_t n_seq, std::mt19937 &gen); -} // namespace hamming +template <typename DistIntType> +std::vector<DistIntType> make_distances(int64_t n, std::mt19937 &gen) { + std::vector<DistIntType> v{}; + auto n_elements{n * (n - 1) / 2}; + v.reserve(n_elements); + std::uniform_int_distribution<> distrib( + 0, std::numeric_limits<DistIntType>::max()); + for (int64_t i = 0; i < n_elements; ++i) { + v.push_back(distrib(gen)); + } + return v; +} + +const char *const benchmark_tmp_output_file{"tmp.bench.output"}; +const char *const benchmark_tmp_input_file{"tmp.bench.input"}; -#endif +} // namespace hamming diff --git a/src/cuda_mem.hh b/src/cuda_mem.hh new file mode 100644 index 0000000..7f25cf5 --- /dev/null +++ b/src/cuda_mem.hh @@ -0,0 +1,32 @@ +#pragma once + +#include <stdexcept> +#include <vector> + +template <typename T> T *CheckedCudaMalloc(std::size_t n) { + T *a{nullptr}; + std::size_t sz{sizeof(T) * n}; + if (cudaError err{cudaMalloc(&a, sz)}; err != cudaSuccess) { + throw std::runtime_error(cudaGetErrorString(err)); + } + return a; +} + +template <typename T> +void CheckedCopyToDevice(T *dest, const std::vector<T> &src) { + std::size_t count{sizeof(T) * src.size()}; // count in bytes + if (cudaError err{ + cudaMemcpy(dest, src.data(), count, cudaMemcpyHostToDevice)}; + err != cudaSuccess) { + throw std::runtime_error(cudaGetErrorString(err)); + } +} + +template <typename T> +void CheckedCopyToHost(T *dest, const T *src, std::size_t n_elements) { + std::size_t count{sizeof(T) * n_elements}; // count in bytes + if (cudaError err{cudaMemcpy(dest, src, count, cudaMemcpyDeviceToHost)}; + err != cudaSuccess) { + throw std::runtime_error(cudaGetErrorString(err)); + } +} diff --git a/src/distance_cuda.cu b/src/distance_cuda.cu new file mode 100644 index 0000000..9ddfcb5 --- /dev/null +++ b/src/distance_cuda.cu @@ -0,0 +1,233 @@ +#include "cuda_mem.hh" +#include "hamming/distance_cuda.hh" +#include "hamming/hamming_utils.hh" +#include <chrono> +#include <cuda/std/limits> + +namespace hamming { + +template <typename DistIntType> +__global__ void Dist(DistIntType *partial_distances, const std::uint8_t *genes, + std::uint64_t distances_offset, + unsigned int geneBlocksPerSample) { + // Calculates all gridDim.x entries of the partial_distances array. + // + // The full distances array is a flat nsamples * (nsamples - 1) / 2 element + // array that contains the lower-triangular elements of the nSamples x + // nSamples partial_distances matrix. + // + // This kernel is provided with partial_distances, which should have + // gridDim.x entries, and which is filled with values corresponding to + // entries in the full distances array with an offset of distances_offset. + // + + // this array is shared between the threads in this block + // and must be large enough to store one int per thread + extern __shared__ int s[]; + + // index in the partial_distances array where we'll put the result from this + // block of threads + uint64_t distancesIndex{static_cast<uint64_t>(blockIdx.x)}; + // index of this value in the full distances array + uint64_t trueDistancesIndex{distancesIndex + distances_offset}; + // infer indices of the two genes corresponding to this distances index + uint64_t distancesRowIndex{static_cast<std::size_t>( + floor(sqrt(2.0 * static_cast<double>(trueDistancesIndex) + 0.5) + 0.5))}; + uint64_t distancesColIndex{trueDistancesIndex - + distancesRowIndex * (distancesRowIndex - 1) / 2}; + uint64_t uint32sPerSample{geneBlocksPerSample / 4}; + uint64_t geneAIndex{distancesRowIndex * uint32sPerSample}; + uint64_t geneBIndex{distancesColIndex * uint32sPerSample}; + + unsigned int threadIndex{threadIdx.x}; + // calculate partial sum for each thread and store in shared memory s + int r0{0}; + int r1{0}; + int r2{0}; + int r3{0}; + // NOTE: this cast is only safe if genes is 32-bit aligned AND we each sample + // in genes is padded such that the first element of each sample is also + // 32-bit aligned! + const uint32_t *genes_as_uint32{reinterpret_cast<const uint32_t *>(genes)}; + uint mask_lower{0x0f0f0f0f}; + uint mask_upper{0xf0f0f0f0}; + // NOTE: this loop is also only correct if the length of each sample in genes + // is a multiple of 8, which we do by padding the samples with '-'. + for (int j = 2 * threadIndex; j < uint32sPerSample; j += 2 * blockDim.x) { + auto c0{genes_as_uint32[geneAIndex + j] & genes_as_uint32[geneBIndex + j]}; + auto c1{genes_as_uint32[geneAIndex + j + 1] & + genes_as_uint32[geneBIndex + j + 1]}; + r0 += __popc(__vseteq4(c0 & mask_lower, 0u)); + r1 += __popc(__vseteq4(c0 & mask_upper, 0u)); + r2 += __popc(__vseteq4(c1 & mask_lower, 0u)); + r3 += __popc(__vseteq4(c1 & mask_upper, 0u)); + } + s[threadIndex] = r0 + r1 + r2 + r3; + // synchronise shared memory s between all threads in this block + __syncthreads(); + // sum elements of s using reduction until partial sums are stored in + // the first 64 elements of s + for (int offset = blockDim.x / 2; offset > 32; offset >>= 1) { + if (threadIndex < offset) { + s[threadIndex] += s[threadIndex + offset]; + } + __syncthreads(); + } + if (threadIndex < 32) { + // one more reduction in each of the 32 threads in this warp + int sum{s[threadIndex] + s[threadIndex + 32]}; + // now sum the values of sum within this warp + constexpr unsigned int FULL_MASK{0xffffffff}; + for (int offset = 16; offset > 0; offset /= 2) { + sum += __shfl_down_sync(FULL_MASK, sum, offset); + } + if (threadIndex == 0) { + auto maxDist{cuda::std::numeric_limits<DistIntType>::max()}; + partial_distances[distancesIndex] = sum > maxDist ? maxDist : sum; + } + } +} + +template <typename DistIntType> +std::vector<DistIntType> +distances_cuda(const std::vector<std::vector<GeneBlock>> &data, + const std::string &filename = {}) { + std::vector<DistIntType> distances{}; + std::size_t timing_gpu_ms = 0; + std::size_t timing_io_ms = 0; + auto timing0{std::chrono::high_resolution_clock::now()}; + bool output_to_vector{false}; + if (filename.empty()) { + output_to_vector = true; + } + std::size_t nSamples{data.size()}; + std::size_t nDistances{nSamples * (nSamples - 1) / 2}; + std::size_t geneBlocksPerSample{data[0].size()}; + // 2^31-1 is limit on number of CUDA blocks in x-dim, which corresponds to + // 0.5/1GB of distances data for each chunk. For large datasets I/O becomes + // the bottleneck and the larger the chunk the faster the I/O tends to be. + std::size_t nPartialDistances{std::min(nDistances, 2147483647ul)}; + + if (output_to_vector) { + // need to store all distances on host + distances.resize(nDistances); + } else { + // only need to store a single block of partial distances on host + distances.resize(nPartialDistances); + } + // allocate memory for genes on device + // one gene is 30k chars -> 15k bytes in dense format + // so 1 million samples -> 15GB + auto *genes{CheckedCudaMalloc<GeneBlock>(nSamples * geneBlocksPerSample)}; + // copy genes to device + for (std::size_t i = 0; i < data.size(); ++i) { + CheckedCopyToDevice(genes + i * geneBlocksPerSample, data[i]); + } + + // allocate memory for partial distances matrix on device + auto *partial_distances{CheckedCudaMalloc<DistIntType>(nPartialDistances)}; + // keep track of how many distance elements are available to write to disk + std::size_t available_distance_elements{0}; + // keep track of where in the full distances array these elements should go + std::size_t distances_offset{0}; + // GPU timing + cudaEvent_t start, stop; + cudaEventCreate(&start); + cudaEventCreate(&stop); + // I/O timing + auto timing_io = std::chrono::high_resolution_clock::now(); + while (distances_offset + available_distance_elements < nDistances) { + // use nThreadsPerBlock in x dim of block + uint nThreadsPerBlock{128}; + dim3 threadsPerBlock{nThreadsPerBlock, 1, 1}; + // use up to nPartialDistances blocks, one block per distance element + dim3 numBlocks{static_cast<uint>(std::min(nPartialDistances, + nDistances - distances_offset)), + 1, 1}; + cudaEventRecord(start); + timing_io = std::chrono::high_resolution_clock::now(); + // launch a kernel with shared memory of size int[nThreadsPerBlock] - + // this call returns immediately and the kernel runs asynchronously on the + // GPU + Dist<<<numBlocks, threadsPerBlock, nThreadsPerBlock * sizeof(int)>>>( + partial_distances, genes, distances_offset, geneBlocksPerSample); + cudaEventRecord(stop); + if (auto err = cudaGetLastError(); err != cudaSuccess) { + throw std::runtime_error(cudaGetErrorString(err)); + } + + if (!output_to_vector) { + // write previous kernel's output (if any) to disk using CPU while the new + // kernel is running on the GPU to interleave I/O with computation + partial_write_lower_triangular(filename, distances, distances_offset, + available_distance_elements); + } + timing_io_ms += std::chrono::duration_cast<std::chrono::milliseconds>( + std::chrono::high_resolution_clock::now() - timing_io) + .count(); + // copy partial_distances from GPU to distances vector on HOST - this call + // waits until the kernel has completed before copying the memory. + CheckedCopyToHost(distances.data() + + (output_to_vector ? distances_offset : 0), + partial_distances, numBlocks.x); + cudaEventSynchronize(stop); + float milliseconds = 0; + cudaEventElapsedTime(&milliseconds, start, stop); + timing_gpu_ms += static_cast<std::size_t>(milliseconds); + distances_offset += available_distance_elements; + available_distance_elements = numBlocks.x; + } + if (!output_to_vector) { + // write final kernel's output to disk + timing_io = std::chrono::high_resolution_clock::now(); + partial_write_lower_triangular(filename, distances, distances_offset, + available_distance_elements); + timing_io_ms += std::chrono::duration_cast<std::chrono::milliseconds>( + std::chrono::high_resolution_clock::now() - timing_io) + .count(); + distances.clear(); + } + // free data on gpu + cudaFree(genes); + cudaFree(partial_distances); + std::cout << "# hammingdist :: ...distance calculation completed in " + << std::chrono::duration_cast<std::chrono::milliseconds>( + std::chrono::high_resolution_clock::now() - timing0) + .count() + << " ms (GPU: " << timing_gpu_ms << " / IO: " << timing_io_ms + << ")." << std::endl; + return distances; +} + +std::vector<uint8_t> +distances_cuda_8bit(const std::vector<std::vector<GeneBlock>> &data) { + return distances_cuda<uint8_t>(data, {}); +} + +std::vector<uint16_t> +distances_cuda_16bit(const std::vector<std::vector<GeneBlock>> &data) { + return distances_cuda<uint16_t>(data, {}); +} + +void distances_cuda_to_lower_triangular( + const std::vector<std::vector<GeneBlock>> &data, + const std::string &filename) { + distances_cuda<uint16_t>(data, filename); +} + +int distance_cuda(const std::vector<GeneBlock> &a, + const std::vector<GeneBlock> &b) { + // wrapper for testing cuda kernel with existing distance API + std::vector<std::vector<GeneBlock>> data{a, b}; + return distances_cuda<int>(data, {})[0]; +} + +bool distance_cuda_have_device() { + int nDevices = 0; + if (cudaError_t err{cudaGetDeviceCount(&nDevices)}; err != cudaSuccess) { + return false; + } + return nDevices > 0; +} + +} // namespace hamming diff --git a/src/distance_cuda_bench.cc b/src/distance_cuda_bench.cc new file mode 100644 index 0000000..ae6ab5c --- /dev/null +++ b/src/distance_cuda_bench.cc @@ -0,0 +1,19 @@ +#include "bench.hh" +#include "hamming/distance_cuda.hh" +#include "hamming/hamming.hh" + +using namespace hamming; + +static void bench_distance_cuda(benchmark::State &state) { + std::mt19937 gen(12345); + int64_t n{state.range(0)}; + auto s1{from_string(make_string(n, gen))}; + auto s2{from_string(make_string(n, gen))}; + int d{0}; + for (auto _ : state) { + d += distance_cuda(s1, s2); + } + state.SetComplexityN(n); +} + +BENCHMARK(bench_distance_cuda)->Range(4096, 4194304)->Complexity(); diff --git a/src/distance_cuda_t.cc b/src/distance_cuda_t.cc new file mode 100644 index 0000000..dbb5b55 --- /dev/null +++ b/src/distance_cuda_t.cc @@ -0,0 +1,62 @@ +#include "hamming/distance_cuda.hh" +#include "tests.hh" + +using namespace hamming; + +TEST_CASE("distance_cuda() returns all return zero for identical vectors", + "[impl][distance][gpu]") { + std::mt19937 gen(12345); + for (int n : + {1, 2, 3, 4, 5, 6, 7, 8, + 9, 10, 11, 12, 13, 14, 15, 16, + 17, 18, 19, 20, 31, 32, 33, 63, + 64, 65, 127, 128, 129, 254, 255, 256, + 256, 511, 512, 513, 1023, 1024, 1025, 2047, + 2048, 2049, 4095, 4096, 4097, 8191, 8192, 8193, + 32767, 32768, 32769, 65535, 65536, 65537, 131071, 131072, + 131073, 262143, 262144, 262145, 524287, 524288, 524289, 1048575, + 1048576, 1048577}) { + CAPTURE(n); + auto g1{make_gene_vector(n, gen)}; + REQUIRE(distance_cuda(g1, g1) == 0); + } +} + +TEST_CASE("distance_cuda() all return n for n A's and n G's", + "[impl][distance][gpu]") { + for (int n : + {1, 2, 3, 4, 5, 6, 7, 8, + 9, 10, 11, 12, 13, 14, 15, 16, + 17, 18, 19, 20, 31, 32, 33, 63, + 64, 65, 127, 128, 129, 254, 255, 256, + 256, 511, 512, 513, 1023, 1024, 1025, 2047, + 2048, 2049, 4095, 4096, 4097, 8191, 8192, 8193, + 32767, 32768, 32769, 65535, 65536, 65537, 131071, 131072, + 131073, 262143, 262144, 262145, 524287, 524288, 524289, 1048575, + 1048576, 1048577}) { + CAPTURE(n); + auto g1 = from_string(std::string(n, 'A')); + auto g2 = from_string(std::string(n, 'G')); + REQUIRE(distance_cuda(g1, g2) == n); + } +} + +TEST_CASE("distance_cuda() returns same as distance_cpp() for random vectors", + "[impl][distance][gpu]") { + std::mt19937 gen(123451); + for (int n : + {1, 2, 3, 4, 5, 6, 7, 8, + 9, 10, 11, 12, 13, 14, 15, 16, + 17, 18, 19, 20, 31, 32, 33, 63, + 64, 65, 127, 128, 129, 254, 255, 256, + 256, 511, 512, 513, 1023, 1024, 1025, 2047, + 2048, 2049, 4095, 4096, 4097, 8191, 8192, 8193, + 32767, 32768, 32769, 65535, 65536, 65537, 131071, 131072, + 131073, 262143, 262144, 262145, 524287, 524288, 524289, 1048575, + 1048576, 1048577}) { + CAPTURE(n); + auto g1{make_gene_vector(n, gen)}; + auto g2{make_gene_vector(n, gen)}; + REQUIRE(distance_cuda(g1, g2) == distance_cpp(g1, g2)); + } +} diff --git a/src/hamming.cc b/src/hamming.cc index ff3c6aa..75b26a7 100644 --- a/src/hamming.cc +++ b/src/hamming.cc @@ -7,34 +7,45 @@ #include <fstream> #include <iostream> #include <limits> -#include <sstream> #include <string> #include <unordered_map> #include <vector> namespace hamming { -DataSet<DefaultDistIntType> from_stringlist(std::vector<std::string> &data) { - return DataSet<DefaultDistIntType>(data); +DataSet<DefaultDistIntType> from_stringlist(std::vector<std::string> &data, + bool include_x, bool use_gpu) { + return DataSet<DefaultDistIntType>(data, include_x, false, {}, use_gpu); } DataSet<DefaultDistIntType> from_csv(const std::string &filename) { return DataSet<DefaultDistIntType>(filename); } -DataSet<DefaultDistIntType> from_lower_triangular(const std::string &filename) { - std::vector<DefaultDistIntType> distances; - std::ifstream stream(filename); - std::string line; - while (std::getline(stream, line)) { - std::istringstream s(line); - std::string d; - while (s.good()) { - std::getline(s, d, ','); - distances.push_back(safe_int_cast<DefaultDistIntType>(std::stoi(d))); - } +void from_fasta_to_lower_triangular(const std::string &input_filename, + const std::string &output_filename, + bool remove_duplicates, std::size_t n, + bool use_gpu) { + if (use_gpu) { + std::cout << "# hammingdist :: Using GPU..." << std::endl; + } + auto start_time = std::chrono::high_resolution_clock::now(); + auto [data, sequence_indices] = + read_fasta(input_filename, remove_duplicates, n); + auto dense_data = to_dense_data(data); + std::cout << "# hammingdist :: ...pre-processing completed in " + << std::chrono::duration_cast<std::chrono::milliseconds>( + std::chrono::high_resolution_clock::now() - start_time) + .count() + << " ms..." << std::endl; +#ifdef HAMMING_WITH_CUDA + if (use_gpu) { + distances_cuda_to_lower_triangular(dense_data, output_filename); + return; } - return DataSet(std::move(distances)); +#endif + throw std::runtime_error( + "from_fasta_to_lower_triangular is currently only available on GPU"); } ReferenceDistIntType distance(const std::string &seq0, const std::string &seq1, diff --git a/src/hamming_bench.cc b/src/hamming_bench.cc index 2f4ff28..148b845 100644 --- a/src/hamming_bench.cc +++ b/src/hamming_bench.cc @@ -7,13 +7,15 @@ using namespace hamming; +constexpr int64_t sampleLength{30000}; + static void bench_from_stringlist(benchmark::State &state) { #ifdef HAMMING_WITH_OPENMP omp_set_num_threads(1); #endif std::mt19937 gen(12345); int64_t n{state.range(0)}; - auto v{make_stringlist(n, gen)}; + auto v{make_stringlist(sampleLength, n, gen)}; for (auto _ : state) { from_stringlist(v); } @@ -24,17 +26,40 @@ static void bench_from_stringlist(benchmark::State &state) { static void bench_from_stringlist_omp(benchmark::State &state) { omp_set_num_threads(state.range(0)); std::mt19937 gen(12345); - auto v{make_stringlist(8192, gen)}; + auto v{make_stringlist(sampleLength, 1024, gen)}; for (auto _ : state) { from_stringlist(v); } } #endif +static void bench_from_stringlist_gpu(benchmark::State &state) { + std::mt19937 gen(12345); + int64_t n{state.range(0)}; + auto v{make_stringlist(sampleLength, n, gen)}; + for (auto _ : state) { + from_stringlist(v, false, true); + } + state.SetComplexityN(n); +} + +static void bench_from_fasta_to_lower_triangular_gpu(benchmark::State &state) { + std::mt19937 gen(12345); + int64_t n{state.range(0)}; + std::string fasta_file{benchmark_tmp_input_file}; + std::string lt_file{benchmark_tmp_output_file}; + auto reference_seq{make_string(sampleLength, gen, true)}; + write_fasta(fasta_file, reference_seq, state.range(0), gen); + for (auto _ : state) { + from_fasta_to_lower_triangular(fasta_file, lt_file, false); + } + state.SetComplexityN(n); +} + static void bench_fasta_reference_distances(benchmark::State &state) { std::mt19937 gen(12345); - std::string fasta_file{"fasta.txt"}; - auto reference_seq{make_string(30000, gen, true)}; + std::string fasta_file{benchmark_tmp_input_file}; + auto reference_seq{make_string(sampleLength, gen, true)}; write_fasta(fasta_file, reference_seq, state.range(0), gen); std::vector<ReferenceDistIntType> distances; for (auto _ : state) { @@ -44,7 +69,7 @@ static void bench_fasta_reference_distances(benchmark::State &state) { BENCHMARK(bench_from_stringlist) ->RangeMultiplier(2) - ->Range(128, 8192) + ->Range(16, 1024) ->Complexity(); #ifdef HAMMING_WITH_OPENMP BENCHMARK(bench_from_stringlist_omp) @@ -55,7 +80,17 @@ BENCHMARK(bench_from_stringlist_omp) ->Arg(12) ->Arg(24); #endif +#ifdef HAMMING_WITH_CUDA +BENCHMARK(bench_from_stringlist_gpu) + ->RangeMultiplier(2) + ->Range(16, 8192) + ->Complexity(); +BENCHMARK(bench_from_fasta_to_lower_triangular_gpu) + ->RangeMultiplier(2) + ->Range(16, 16384) + ->Complexity(); +#endif BENCHMARK(bench_fasta_reference_distances) ->RangeMultiplier(2) - ->Range(16, 32384) + ->Range(16, 1024) ->Complexity(); diff --git a/src/hamming_impl.cc b/src/hamming_impl.cc index 2ba768f..e2109c9 100644 --- a/src/hamming_impl.cc +++ b/src/hamming_impl.cc @@ -1,6 +1,23 @@ #include "hamming/hamming_impl.hh" #include <algorithm> +#if !(defined(__aarch64__) || defined(_M_ARM64)) +#include <cpuinfo_x86.h> +#endif #include <stdexcept> +#include <unordered_map> +#ifdef HAMMING_WITH_SSE2 +#include "hamming/distance_sse2.hh" +#endif +#ifdef HAMMING_WITH_AVX2 +#include "hamming/distance_avx2.hh" +#endif +#ifdef HAMMING_WITH_AVX512 +#include "hamming/distance_avx512.hh" +#endif +#ifdef HAMMING_WITH_NEON +#include "hamming/distance_neon.hh" +#endif + namespace hamming { // bit meaning: @@ -26,6 +43,40 @@ std::array<GeneBlock, 256> lookupTable(bool include_x) { return lookup; } +distance_func_ptr get_fastest_supported_distance_func() { + std::string simd_str = "no"; + distance_func_ptr distance_func{distance_cpp}; +#if defined(__aarch64__) || defined(_M_ARM64) +#ifdef HAMMING_WITH_NEON + distance_func = distance_neon; + simd_str = "NEON"; +#endif +#else + const auto features = cpu_features::GetX86Info().features; +#ifdef HAMMING_WITH_SSE2 + if (features.sse2) { + distance_func = distance_sse2; + simd_str = "SSE2"; + } +#endif +#ifdef HAMMING_WITH_AVX2 + if (features.avx2) { + distance_func = distance_avx2; + simd_str = "AVX2"; + } +#endif +#ifdef HAMMING_WITH_AVX512 + if (features.avx512bw) { + distance_func = distance_avx512; + simd_str = "AVX512"; + } +#endif +#endif + std::cout << "# hammingdist :: Using CPU with " << simd_str + << " SIMD extensions..." << std::endl; + return distance_func; +} + void validate_data(const std::vector<std::string> &data) { if (data.empty() || data[0].empty()) { throw std::runtime_error("Error: Empty sequence"); @@ -143,11 +194,55 @@ to_dense_data(const std::vector<std::string> &data) { return dense; } +std::pair<std::vector<std::string>, std::vector<std::size_t>> +read_fasta(const std::string &filename, bool remove_duplicates, std::size_t n) { + std::pair<std::vector<std::string>, std::vector<std::size_t>> + data_and_sequence_indices; + auto &[data, sequence_indices] = data_and_sequence_indices; + data.reserve(n); + if (n == 0) { + n = std::numeric_limits<std::size_t>::max(); + data.reserve(65536); + } + std::unordered_map<std::string, std::size_t> map_seq_to_index; + // Initializing the stream + std::ifstream stream(filename); + std::size_t count = 0; + std::size_t count_unique = 0; + std::string line; + // skip first header + std::getline(stream, line); + while (count < n && !stream.eof()) { + std::string seq{}; + while (std::getline(stream, line) && line[0] != '>') { + seq.append(line); + } + if (remove_duplicates) { + auto result = map_seq_to_index.emplace(std::move(seq), count_unique); + if (result.second) { + ++count_unique; + } + sequence_indices.push_back(result.first->second); + } else { + data.push_back(std::move(seq)); + } + ++count; + } + if (remove_duplicates) { + // copy each unique sequence to the vector of strings + data.resize(count_unique); + for (auto &key_value_pair : map_seq_to_index) { + data[key_value_pair.second] = key_value_pair.first; + } + } + return data_and_sequence_indices; +} + std::vector<GeneBlock> from_string(const std::string &str) { alignas(16) std::vector<GeneBlock> r; auto lookup = lookupTable(); std::size_t n_full_blocks{str.size() / 2}; - r.reserve(1 + n_full_blocks); + r.reserve(1 + n_full_blocks + 3); auto iter_str = str.cbegin(); for (std::size_t i_block = 0; i_block < n_full_blocks; ++i_block) { r.push_back(lookup[*iter_str] & mask_gene0); @@ -160,6 +255,11 @@ std::vector<GeneBlock> from_string(const std::string &str) { r.push_back(lookup[*iter_str] & mask_gene0); r.back() |= (lookup['-'] & mask_gene1); } + // pad to ensure 64-bit alignment + while (8 * (r.size() / 8) != r.size()) { + r.push_back(lookup['-']); + } + return r; } diff --git a/src/hamming_t.cc b/src/hamming_t.cc index a88d6d9..0b94e61 100644 --- a/src/hamming_t.cc +++ b/src/hamming_t.cc @@ -9,6 +9,12 @@ using namespace hamming; static constexpr std::array<char, 4> valid_chars{'A', 'C', 'G', 'T'}; static constexpr std::array<char, 6> invalid_chars{' ', 'N', '*', '?', 'a', '.'}; +static std::vector<bool> valid_use_gpu_values() { + if (cuda_gpu_available()) { + return {false, true}; + } + return {false}; +} static int dist1(char c1, char c2) { std::vector<std::string> v{std::string{c1}, std::string{c2}}; @@ -16,7 +22,7 @@ static int dist1(char c1, char c2) { } static int dist2(char c1, char c2) { - return distance(std::string{c1}, std::string{c2}); + return static_cast<int>(distance(std::string{c1}, std::string{c2})); } TEST_CASE("distance between two equal valid characters is 0", "[distance]") { @@ -130,17 +136,26 @@ TEST_CASE("from_fasta single line sequences", "[hamming]") { of << ">seq1\n"; of << "ACGTGTCGTTTCGACGAGTCG\n"; of.close(); - for (bool remove_duplicates : {false, true}) { - for (bool include_x : {false, true}) { - CAPTURE(include_x); - CAPTURE(remove_duplicates); - for (int n : {0, 2, 3, 8}) { - auto d = - from_fasta<uint8_t>(tmp_file_name, include_x, remove_duplicates, n); - REQUIRE(d[{0, 0}] == 0); - REQUIRE(d[{0, 1}] == 2); - REQUIRE(d[{1, 0}] == 2); - REQUIRE(d[{1, 1}] == 0); + for (auto use_gpu : valid_use_gpu_values()) { + for (bool remove_duplicates : {false, true}) { + for (bool include_x : {false, true}) { + CAPTURE(include_x); + CAPTURE(remove_duplicates); + CAPTURE(use_gpu); + if (use_gpu && include_x) { + // include_x cannot be used with use_gpu + REQUIRE_THROWS(from_fasta<uint8_t>(tmp_file_name, include_x, + remove_duplicates, 1, use_gpu)); + } else { + for (int n : {0, 2, 3, 8}) { + auto d = from_fasta<uint8_t>(tmp_file_name, include_x, + remove_duplicates, n, use_gpu); + REQUIRE(d[{0, 0}] == 0); + REQUIRE(d[{0, 1}] == 2); + REQUIRE(d[{1, 0}] == 2); + REQUIRE(d[{1, 1}] == 0); + } + } } } } @@ -166,21 +181,31 @@ TEST_CASE("from_fasta single line sequences with duplicates", "[hamming]") { of << "ACGTGTCGTATCGACGTGTCG\n"; of.close(); std::vector<std::size_t> sequence_indices{0, 1, 1, 1, 0, 2}; - for (int n : {0, 6, 22}) { - for (bool include_x : {false, true}) { - CAPTURE(include_x); - auto d = from_fasta<uint8_t>(tmp_file_name, include_x, true, n); - REQUIRE(d.nsamples == 3); - REQUIRE(d.sequence_indices == sequence_indices); - REQUIRE(d[{0, 0}] == 0); - REQUIRE(d[{0, 1}] == 2); - REQUIRE(d[{0, 2}] == 1); - REQUIRE(d[{1, 0}] == 2); - REQUIRE(d[{1, 1}] == 0); - REQUIRE(d[{1, 2}] == 2); - REQUIRE(d[{2, 0}] == 1); - REQUIRE(d[{2, 1}] == 2); - REQUIRE(d[{2, 2}] == 0); + for (auto use_gpu : valid_use_gpu_values()) { + for (int n : {0, 6, 22}) { + for (bool include_x : {false, true}) { + CAPTURE(include_x); + CAPTURE(use_gpu); + if (use_gpu && include_x) { + // include_x cannot be used with use_gpu + REQUIRE_THROWS( + from_fasta<uint8_t>(tmp_file_name, include_x, true, n, use_gpu)); + } else { + auto d = + from_fasta<uint8_t>(tmp_file_name, include_x, true, n, use_gpu); + REQUIRE(d.nsamples == 3); + REQUIRE(d.sequence_indices == sequence_indices); + REQUIRE(d[{0, 0}] == 0); + REQUIRE(d[{0, 1}] == 2); + REQUIRE(d[{0, 2}] == 1); + REQUIRE(d[{1, 0}] == 2); + REQUIRE(d[{1, 1}] == 0); + REQUIRE(d[{1, 2}] == 2); + REQUIRE(d[{2, 0}] == 1); + REQUIRE(d[{2, 1}] == 2); + REQUIRE(d[{2, 2}] == 0); + } + } } } std::remove(tmp_file_name); @@ -200,16 +225,23 @@ TEST_CASE("from_fasta multi-line sequences", "[hamming]") { of << "ACGTGTCGTGTCGACGTGTCG\n"; of << "ACGTGTCGTGTCG\n"; of.close(); - for (bool remove_duplicates : {false, true}) { - for (bool include_x : {false, true}) { - CAPTURE(include_x); - for (int n : {0, 2, 3, 8}) { - auto d = - from_fasta<uint8_t>(tmp_file_name, include_x, remove_duplicates, 2); - REQUIRE(d[{0, 0}] == 0); - REQUIRE(d[{0, 1}] == 2); - REQUIRE(d[{1, 0}] == 2); - REQUIRE(d[{1, 1}] == 0); + for (auto use_gpu : valid_use_gpu_values()) { + for (bool remove_duplicates : {false, true}) { + for (bool include_x : {false, true}) { + CAPTURE(include_x); + CAPTURE(use_gpu); + if (use_gpu && include_x) { + // include_x cannot be used with use_gpu + REQUIRE_THROWS(from_fasta<uint8_t>(tmp_file_name, include_x, + remove_duplicates, 2, use_gpu)); + } else { + auto d = from_fasta<uint8_t>(tmp_file_name, include_x, + remove_duplicates, 2, use_gpu); + REQUIRE(d[{0, 0}] == 0); + REQUIRE(d[{0, 1}] == 2); + REQUIRE(d[{1, 0}] == 2); + REQUIRE(d[{1, 1}] == 0); + } } } } @@ -242,7 +274,7 @@ TEST_CASE("invalid input data: inconsistent sequence lengths", "[invalid]") { TEST_CASE("from_csv reproduces correct data", "[hamming]") { std::mt19937 gen(12345); - std::vector<std::string> data(10); + std::vector<std::string> data(107); for (auto &d : data) d = make_test_string(201, gen); @@ -266,17 +298,21 @@ TEMPLATE_TEST_CASE("distance integer saturates instead of overflowing", auto n_max{static_cast<std::size_t>(std::numeric_limits<TestType>::max())}; std::mt19937 gen(12345); std::vector<std::string> data(2); - for (auto n : {n_max, n_max + 1, n_max + 99}) { - CAPTURE(n); - data[0] = std::string(n, 'A'); - data[1] = std::string(n, 'T'); - DataSet<TestType> dataSet(data); - REQUIRE(dataSet[{0, 1}] == n_max); - REQUIRE(dataSet[{1, 0}] == n_max); + for (auto use_gpu : valid_use_gpu_values()) { + for (auto n : {n_max, n_max + 1, n_max + 99}) { + CAPTURE(use_gpu); + CAPTURE(n); + data[0] = std::string(n, 'A'); + data[1] = std::string(n, 'T'); + DataSet<TestType> dataSet(data, false, false, {}, use_gpu); + REQUIRE(dataSet[{0, 1}] == n_max); + REQUIRE(dataSet[{1, 0}] == n_max); + } } } -TEST_CASE("from_lower_triangular reproduces correct data", "[hamming]") { +TEMPLATE_TEST_CASE("from_lower_triangular reproduces correct data", "[hamming]", + uint8_t, uint16_t) { std::mt19937 gen(12345); char tmp_file_name[L_tmpnam]; REQUIRE(std::tmpnam(tmp_file_name) != nullptr); @@ -286,11 +322,11 @@ TEST_CASE("from_lower_triangular reproduces correct data", "[hamming]") { for (auto &d : data) d = make_test_string(24, gen); - DataSet<uint8_t> ref(data); + DataSet<TestType> ref(data); REQUIRE(ref.nsamples == n); ref.dump_lower_triangular(std::string(tmp_file_name)); - auto restore = from_lower_triangular(std::string(tmp_file_name)); + auto restore = from_lower_triangular<TestType>(std::string(tmp_file_name)); REQUIRE(ref.nsamples == restore.nsamples); for (std::size_t i = 0; i < ref.nsamples; ++i) { for (std::size_t j = 0; j < ref.nsamples; ++j) { @@ -300,3 +336,101 @@ TEST_CASE("from_lower_triangular reproduces correct data", "[hamming]") { } std::remove(tmp_file_name); } + +TEST_CASE("from_stringlist GPU and CPU implementations give consistent results", + "[hamming][gpu]") { + if (!cuda_gpu_available()) { + SKIP("No CUDA gpu available"); + } + std::mt19937 gen(12345); + for (bool include_x : {false}) { + for (int n : {1, 5, 13, 32, 89, 185, 497, 1092}) { + for (int n_samples : {2, 3, 4, 7, 11, 32, 33, 257, 689}) { + std::vector<std::string> stringlist; + stringlist.reserve(n_samples); + for (std::size_t i = 0; i < n_samples; ++i) { + stringlist.push_back(make_test_string(n, gen, include_x)); + } + CAPTURE(include_x); + auto d_cpu{from_stringlist(stringlist, include_x, false)}; + auto d_gpu{from_stringlist(stringlist, include_x, true)}; + for (std::size_t i = 0; i < n_samples; ++i) { + for (std::size_t j = 0; j < n_samples; ++j) { + REQUIRE(d_cpu[{i, j}] == d_gpu[{i, j}]); + } + } + } + } + } +} + +TEMPLATE_TEST_CASE( + "from_fasta GPU and CPU implementations give consistent results", + "[hamming][gpu]", uint8_t, uint16_t) { + if (!cuda_gpu_available()) { + SKIP("No CUDA gpu available"); + } + char tmp_file_name[L_tmpnam]; + std::mt19937 gen(12345); + REQUIRE(std::tmpnam(tmp_file_name) != nullptr); + CAPTURE(tmp_file_name); + for (bool remove_duplicates : {false, true}) { + for (bool include_x : {false}) { + for (int n : {17, 88, 381, 1023}) { + for (int n_samples : {2, 3, 4, 7, 11, 127, 128, 255, 256, 257, 703}) { + write_test_fasta(tmp_file_name, n, n_samples, gen, include_x); + CAPTURE(include_x); + auto d_cpu{from_fasta<TestType>(tmp_file_name, include_x, + remove_duplicates, 0, false)}; + auto d_gpu{from_fasta<TestType>(tmp_file_name, include_x, + remove_duplicates, 0, true)}; + for (std::size_t i = 0; i < n_samples; ++i) { + for (std::size_t j = 0; j < n_samples; ++j) { + REQUIRE(d_cpu[{i, j}] == d_gpu[{i, j}]); + } + } + } + } + } + } + std::remove(tmp_file_name); +} + +TEST_CASE("from_fasta_to_lower_triangular GPU consistent with CPU from_fasta", + "[hamming][gpu]") { + if (!cuda_gpu_available()) { + SKIP("No CUDA gpu available"); + } + std::mt19937 gen(12345); + char tmp_fasta_file_name[L_tmpnam]; + REQUIRE(std::tmpnam(tmp_fasta_file_name) != nullptr); + CAPTURE(tmp_fasta_file_name); + char tmp_lt_file_name[L_tmpnam]; + REQUIRE(std::tmpnam(tmp_lt_file_name) != nullptr); + CAPTURE(tmp_lt_file_name); + for (bool remove_duplicates : {false, true}) { + for (int n : {17, 88, 381, 1023}) { + for (int n_samples : + {2, 3, 4, 7, 11, 127, 128, 255, 256, 257, 703, 1012}) { + CAPTURE(remove_duplicates); + CAPTURE(n); + CAPTURE(n_samples); + write_test_fasta(tmp_fasta_file_name, n, n_samples, gen, false); + auto d_cpu{from_fasta<uint16_t>(tmp_fasta_file_name, false, + remove_duplicates, 0, false)}; + from_fasta_to_lower_triangular(tmp_fasta_file_name, tmp_lt_file_name, + remove_duplicates, 0, true); + auto d_gpu{from_lower_triangular<uint16_t>(tmp_lt_file_name)}; + for (std::size_t i = 0; i < n_samples; ++i) { + for (std::size_t j = 0; j < n_samples; ++j) { + CAPTURE(i); + CAPTURE(j); + REQUIRE(d_cpu[{i, j}] == d_gpu[{i, j}]); + } + } + } + } + } + std::remove(tmp_fasta_file_name); + std::remove(tmp_lt_file_name); +} diff --git a/src/hamming_utils.cc b/src/hamming_utils.cc new file mode 100644 index 0000000..312c032 --- /dev/null +++ b/src/hamming_utils.cc @@ -0,0 +1 @@ +#include "hamming/hamming_utils.hh" diff --git a/src/hamming_utils_bench.cc b/src/hamming_utils_bench.cc new file mode 100644 index 0000000..7fae605 --- /dev/null +++ b/src/hamming_utils_bench.cc @@ -0,0 +1,78 @@ +#include "bench.hh" +#include "hamming/hamming.hh" +#include "hamming/hamming_utils.hh" +#ifdef HAMMING_WITH_OPENMP +#include <omp.h> +#endif + +using namespace hamming; + +static void bench_distance_cpp(benchmark::State &state) { +#ifdef HAMMING_WITH_OPENMP + omp_set_num_threads(1); +#endif + std::mt19937 gen(12345); + int64_t n{state.range(0)}; + auto s1{from_string(make_string(n, gen))}; + auto s2{from_string(make_string(n, gen))}; + int d{0}; + for (auto _ : state) { + d += distance_cpp(s1, s2); + } + state.SetComplexityN(n); +} + +static void bench_distance_sparse(benchmark::State &state) { +#ifdef HAMMING_WITH_OPENMP + omp_set_num_threads(1); +#endif + std::mt19937 gen(12345); + int64_t n{state.range(0)}; + auto s1{make_string(n, gen, false)}; + auto s2{s1}; + // make ~0.5% of s2 elements differ from s1 + randomize_n(s2, n / 200, gen); + auto sparse = to_sparse_data({s1, s2}, false); + int d{0}; + for (auto _ : state) { + d += distance_sparse(sparse[0], sparse[1]); + } + state.SetComplexityN(n); +} + +static void bench_partial_write_lower_triangular(benchmark::State &state) { + int64_t n{state.range(0)}; + std::mt19937 gen(12345); + auto v{make_distances<uint16_t>(n, gen)}; + for (auto _ : state) { + partial_write_lower_triangular(benchmark_tmp_output_file, v, 0, v.size()); + } + state.SetComplexityN(n); +} + +#ifdef HAMMING_WITH_OPENMP +static void bench_partial_write_lower_triangular_omp(benchmark::State &state) { + omp_set_num_threads(state.range(0)); + std::mt19937 gen(12345); + auto v{make_distances<uint16_t>(16384, gen)}; + for (auto _ : state) { + partial_write_lower_triangular(benchmark_tmp_output_file, v, 0, v.size()); + } +} +#endif + +BENCHMARK(bench_distance_sparse)->Range(4096, 4194304)->Complexity(); + +BENCHMARK(bench_distance_cpp)->Range(4096, 4194304)->Complexity(); + +BENCHMARK(bench_partial_write_lower_triangular)->Range(2, 32768)->Complexity(); + +#ifdef HAMMING_WITH_OPENMP +BENCHMARK(bench_partial_write_lower_triangular_omp) + ->Arg(1) + ->Arg(2) + ->Arg(4) + ->Arg(8) + ->Arg(12) + ->Arg(24); +#endif diff --git a/src/tests.cc b/src/tests.cc index 66022f4..f933e6e 100644 --- a/src/tests.cc +++ b/src/tests.cc @@ -24,4 +24,13 @@ std::vector<GeneBlock> make_gene_vector(int n, std::mt19937 &gen, return from_string(make_test_string(n, gen, include_x)); } +void write_test_fasta(const std::string &filename, int n, std::size_t n_seq, + std::mt19937 &gen, bool include_x) { + std::ofstream fs; + fs.open(filename); + for (std::size_t i = 0; i < n_seq; ++i) { + fs << ">seq" << i << "\n" << make_test_string(n, gen, include_x) << "\n"; + } + fs.close(); +} } // namespace hamming diff --git a/src/tests.hh b/src/tests.hh index 9999496..88284c9 100644 --- a/src/tests.hh +++ b/src/tests.hh @@ -1,9 +1,10 @@ -#ifndef HAMMING_TESTS_HH -#define HAMMING_TESTS_HH +#pragma once #include "hamming/hamming.hh" #include "hamming/hamming_impl.hh" -#include <catch2/catch.hpp> +#include <catch2/catch_template_test_macros.hpp> +#include <catch2/catch_test_macros.hpp> +#include <catch2/matchers/catch_matchers.hpp> #include <random> #include <vector> @@ -14,6 +15,7 @@ std::string make_test_string(int n, std::mt19937 &gen, bool include_x = false); std::vector<GeneBlock> make_gene_vector(int n, std::mt19937 &gen, bool include_x = false); -} // namespace hamming +void write_test_fasta(const std::string &filename, int n, std::size_t n_seq, + std::mt19937 &gen, bool include_x = false); -#endif +} // namespace hamming