Identify phage regions in bacterial genomes for masking purposes
% head -n 4 contigs.fna
>AE004092.2 Streptococcus pyogenes M1 GAS, complete genome
TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATAGCGGTGTCCC
CTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTAATTTATTTTCCACAGGTTGT
GGAAAAACTAACTATTATCCATCGTTCTGTGGAAAACTAGAATAGTTTATGGTAGAATAGTTCTAGAATT
% phastaf --outdir out contigs.fna
% cat out/phage.bed
AE004092.2 529586 570503 370.1
AE004092.2 778519 821003 370.2
AE004092.2 1189119 1222648 370.3
AE004092.2 1773338 1786887 370.4brew install brewsci/bio/phastaf # COMING SOON
phastaf --check
Using Homebrew will install all the dependencies for you: Linux or MacOS
conda install -c bioconda phastaf # COMING SOON
phastaf --check
Learn more about Bioconda.
git clone https://github.com/tseemann/phastaf.git
./phastaf/bin/phastaf --help
./phastaf/bin/phastaf --check
You will need to install all the dependencies manually:
- diamond >= 0.9
- bedtools >= 2.0
- any2fasta >= 0.4
- sort (GNU or BSD)
Please file questions, bugs or ideas to the Issue Tracker
Not published yet.
- Torsten Seemann
- Jake Lacey
- Sharif Shaaban
- Federica Palma
- Rebecca Ji Bengtsson
- Nabil-Fareed Alikhan
- Carlus Deneke