diff --git a/_images/1e427c57996ac534fd414f12e4408f8cf5e23257c82d46ec280fae036efaa032.svg b/_images/1324c46357b2edf9082347c3456ba3349d8cec29c065ab8a91a59b4798af4aad.svg
similarity index 86%
rename from _images/1e427c57996ac534fd414f12e4408f8cf5e23257c82d46ec280fae036efaa032.svg
rename to _images/1324c46357b2edf9082347c3456ba3349d8cec29c065ab8a91a59b4798af4aad.svg
index bd2417c..7d52d00 100644
--- a/_images/1e427c57996ac534fd414f12e4408f8cf5e23257c82d46ec280fae036efaa032.svg
+++ b/_images/1324c46357b2edf9082347c3456ba3349d8cec29c065ab8a91a59b4798af4aad.svg
@@ -6,7 +6,7 @@
   <rdf:RDF xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:cc="http://creativecommons.org/ns#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
    <cc:Work>
     <dc:type rdf:resource="http://purl.org/dc/dcmitype/StillImage"/>
-    <dc:date>2023-11-21T22:30:51.929271</dc:date>
+    <dc:date>2023-11-23T13:21:00.688504</dc:date>
     <dc:format>image/svg+xml</dc:format>
     <dc:creator>
      <cc:Agent>
@@ -41,12 +41,12 @@ z
     <g id="xtick_1">
      <g id="line2d_1">
       <defs>
-       <path id="ma0a46ba745" d="M 0 0 
+       <path id="m3f2beffd72" d="M 0 0 
 L 0 3.5 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#ma0a46ba745" x="145.040844" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3f2beffd72" x="145.040844" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_1">
@@ -122,7 +122,7 @@ z
     <g id="xtick_2">
      <g id="line2d_2">
       <g>
-       <use xlink:href="#ma0a46ba745" x="255.268161" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3f2beffd72" x="255.268161" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_2">
@@ -171,7 +171,7 @@ z
     <g id="xtick_3">
      <g id="line2d_3">
       <g>
-       <use xlink:href="#ma0a46ba745" x="365.495479" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3f2beffd72" x="365.495479" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_3">
@@ -207,7 +207,7 @@ z
     <g id="xtick_4">
      <g id="line2d_4">
       <g>
-       <use xlink:href="#ma0a46ba745" x="475.722796" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3f2beffd72" x="475.722796" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_4">
@@ -249,7 +249,7 @@ z
     <g id="xtick_5">
      <g id="line2d_5">
       <g>
-       <use xlink:href="#ma0a46ba745" x="585.950114" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3f2beffd72" x="585.950114" y="284.4" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_5">
@@ -296,285 +296,285 @@ z
     <g id="xtick_6">
      <g id="line2d_6">
       <defs>
-       <path id="mb8011cd71e" d="M 0 0 
+       <path id="m628127e6be" d="M 0 0 
 L 0 2 
 " style="stroke: #000000; stroke-width: 0.6"/>
       </defs>
       <g>
-       <use xlink:href="#mb8011cd71e" x="67.995256" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="67.995256" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_7">
      <g id="line2d_7">
       <g>
-       <use xlink:href="#mb8011cd71e" x="87.405323" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="87.405323" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_8">
      <g id="line2d_8">
       <g>
-       <use xlink:href="#mb8011cd71e" x="101.176984" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="101.176984" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_9">
      <g id="line2d_9">
       <g>
-       <use xlink:href="#mb8011cd71e" x="111.859115" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="111.859115" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_10">
      <g id="line2d_10">
       <g>
-       <use xlink:href="#mb8011cd71e" x="120.587052" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="120.587052" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_11">
      <g id="line2d_11">
       <g>
-       <use xlink:href="#mb8011cd71e" x="127.966417" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="127.966417" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_12">
      <g id="line2d_12">
       <g>
-       <use xlink:href="#mb8011cd71e" x="134.358713" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="134.358713" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_13">
      <g id="line2d_13">
       <g>
-       <use xlink:href="#mb8011cd71e" x="139.997119" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="139.997119" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_14">
      <g id="line2d_14">
       <g>
-       <use xlink:href="#mb8011cd71e" x="178.222573" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="178.222573" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_15">
      <g id="line2d_15">
       <g>
-       <use xlink:href="#mb8011cd71e" x="197.63264" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="197.63264" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_16">
      <g id="line2d_16">
       <g>
-       <use xlink:href="#mb8011cd71e" x="211.404302" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="211.404302" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_17">
      <g id="line2d_17">
       <g>
-       <use xlink:href="#mb8011cd71e" x="222.086433" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="222.086433" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_18">
      <g id="line2d_18">
       <g>
-       <use xlink:href="#mb8011cd71e" x="230.814369" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="230.814369" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_19">
      <g id="line2d_19">
       <g>
-       <use xlink:href="#mb8011cd71e" x="238.193734" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="238.193734" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_20">
      <g id="line2d_20">
       <g>
-       <use xlink:href="#mb8011cd71e" x="244.586031" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="244.586031" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_21">
      <g id="line2d_21">
       <g>
-       <use xlink:href="#mb8011cd71e" x="250.224436" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="250.224436" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_22">
      <g id="line2d_22">
       <g>
-       <use xlink:href="#mb8011cd71e" x="288.44989" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="288.44989" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_23">
      <g id="line2d_23">
       <g>
-       <use xlink:href="#mb8011cd71e" x="307.859957" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="307.859957" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_24">
      <g id="line2d_24">
       <g>
-       <use xlink:href="#mb8011cd71e" x="321.631619" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="321.631619" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_25">
      <g id="line2d_25">
       <g>
-       <use xlink:href="#mb8011cd71e" x="332.31375" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="332.31375" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_26">
      <g id="line2d_26">
       <g>
-       <use xlink:href="#mb8011cd71e" x="341.041686" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="341.041686" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_27">
      <g id="line2d_27">
       <g>
-       <use xlink:href="#mb8011cd71e" x="348.421051" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="348.421051" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_28">
      <g id="line2d_28">
       <g>
-       <use xlink:href="#mb8011cd71e" x="354.813348" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="354.813348" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_29">
      <g id="line2d_29">
       <g>
-       <use xlink:href="#mb8011cd71e" x="360.451753" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="360.451753" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_30">
      <g id="line2d_30">
       <g>
-       <use xlink:href="#mb8011cd71e" x="398.677208" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="398.677208" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_31">
      <g id="line2d_31">
       <g>
-       <use xlink:href="#mb8011cd71e" x="418.087275" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="418.087275" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_32">
      <g id="line2d_32">
       <g>
-       <use xlink:href="#mb8011cd71e" x="431.858937" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="431.858937" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_33">
      <g id="line2d_33">
       <g>
-       <use xlink:href="#mb8011cd71e" x="442.541067" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="442.541067" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_34">
      <g id="line2d_34">
       <g>
-       <use xlink:href="#mb8011cd71e" x="451.269004" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="451.269004" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_35">
      <g id="line2d_35">
       <g>
-       <use xlink:href="#mb8011cd71e" x="458.648369" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="458.648369" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_36">
      <g id="line2d_36">
       <g>
-       <use xlink:href="#mb8011cd71e" x="465.040665" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="465.040665" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_37">
      <g id="line2d_37">
       <g>
-       <use xlink:href="#mb8011cd71e" x="470.679071" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="470.679071" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_38">
      <g id="line2d_38">
       <g>
-       <use xlink:href="#mb8011cd71e" x="508.904525" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="508.904525" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_39">
      <g id="line2d_39">
       <g>
-       <use xlink:href="#mb8011cd71e" x="528.314592" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="528.314592" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_40">
      <g id="line2d_40">
       <g>
-       <use xlink:href="#mb8011cd71e" x="542.086254" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="542.086254" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_41">
      <g id="line2d_41">
       <g>
-       <use xlink:href="#mb8011cd71e" x="552.768385" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="552.768385" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_42">
      <g id="line2d_42">
       <g>
-       <use xlink:href="#mb8011cd71e" x="561.496321" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="561.496321" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_43">
      <g id="line2d_43">
       <g>
-       <use xlink:href="#mb8011cd71e" x="568.875686" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="568.875686" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_44">
      <g id="line2d_44">
       <g>
-       <use xlink:href="#mb8011cd71e" x="575.267983" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="575.267983" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_45">
      <g id="line2d_45">
       <g>
-       <use xlink:href="#mb8011cd71e" x="580.906388" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m628127e6be" x="580.906388" y="284.4" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -967,12 +967,12 @@ z
     <g id="ytick_1">
      <g id="line2d_46">
       <defs>
-       <path id="m36d7a527ef" d="M 0 0 
+       <path id="mf7e7e26553" d="M 0 0 
 L -3.5 0 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#m36d7a527ef" x="53.31375" y="254.133504" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mf7e7e26553" x="53.31375" y="254.133504" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_7">
@@ -997,7 +997,7 @@ z
     <g id="ytick_2">
      <g id="line2d_47">
       <g>
-       <use xlink:href="#m36d7a527ef" x="53.31375" y="204.359743" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mf7e7e26553" x="53.31375" y="204.359743" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_8">
@@ -1013,7 +1013,7 @@ z
     <g id="ytick_3">
      <g id="line2d_48">
       <g>
-       <use xlink:href="#m36d7a527ef" x="53.31375" y="154.585981" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mf7e7e26553" x="53.31375" y="154.585981" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_9">
@@ -1028,7 +1028,7 @@ z
     <g id="ytick_4">
      <g id="line2d_49">
       <g>
-       <use xlink:href="#m36d7a527ef" x="53.31375" y="104.81222" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mf7e7e26553" x="53.31375" y="104.81222" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_10">
@@ -1043,7 +1043,7 @@ z
     <g id="ytick_5">
      <g id="line2d_50">
       <g>
-       <use xlink:href="#m36d7a527ef" x="53.31375" y="55.038459" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mf7e7e26553" x="53.31375" y="55.038459" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_11">
@@ -1058,334 +1058,334 @@ z
     <g id="ytick_6">
      <g id="line2d_51">
       <defs>
-       <path id="m3eccc8797b" d="M 0 0 
+       <path id="m1611a10dbb" d="M 0 0 
 L -2 0 
 " style="stroke: #000000; stroke-width: 0.6"/>
       </defs>
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="280.159146" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="280.159146" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_7">
      <g id="line2d_52">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="273.940475" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="273.940475" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_8">
      <g id="line2d_53">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="269.116899" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="269.116899" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_9">
      <g id="line2d_54">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="265.175751" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="265.175751" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_10">
      <g id="line2d_55">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="261.843557" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="261.843557" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_11">
      <g id="line2d_56">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="258.95708" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="258.95708" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_12">
      <g id="line2d_57">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="256.411027" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="256.411027" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_13">
      <g id="line2d_58">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="239.150109" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="239.150109" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_14">
      <g id="line2d_59">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="230.385385" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="230.385385" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_15">
      <g id="line2d_60">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="224.166714" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="224.166714" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_16">
      <g id="line2d_61">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="219.343138" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="219.343138" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_17">
      <g id="line2d_62">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="215.401989" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="215.401989" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_18">
      <g id="line2d_63">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="212.069796" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="212.069796" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_19">
      <g id="line2d_64">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="209.183319" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="209.183319" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_20">
      <g id="line2d_65">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="206.637265" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="206.637265" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_21">
      <g id="line2d_66">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="189.376348" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="189.376348" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_22">
      <g id="line2d_67">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="180.611623" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="180.611623" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_23">
      <g id="line2d_68">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="174.392952" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="174.392952" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_24">
      <g id="line2d_69">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="169.569376" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="169.569376" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_25">
      <g id="line2d_70">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="165.628228" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="165.628228" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_26">
      <g id="line2d_71">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="162.296035" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="162.296035" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_27">
      <g id="line2d_72">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="159.409557" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="159.409557" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_28">
      <g id="line2d_73">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="156.863504" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="156.863504" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_29">
      <g id="line2d_74">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="139.602586" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="139.602586" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_30">
      <g id="line2d_75">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="130.837862" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="130.837862" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_31">
      <g id="line2d_76">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="124.619191" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="124.619191" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_32">
      <g id="line2d_77">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="119.795615" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="119.795615" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_33">
      <g id="line2d_78">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="115.854467" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="115.854467" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_34">
      <g id="line2d_79">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="112.522273" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="112.522273" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_35">
      <g id="line2d_80">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="109.635796" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="109.635796" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_36">
      <g id="line2d_81">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="107.089742" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="107.089742" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_37">
      <g id="line2d_82">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="89.828825" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="89.828825" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_38">
      <g id="line2d_83">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="81.0641" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="81.0641" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_39">
      <g id="line2d_84">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="74.84543" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="74.84543" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_40">
      <g id="line2d_85">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="70.021854" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="70.021854" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_41">
      <g id="line2d_86">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="66.080705" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="66.080705" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_42">
      <g id="line2d_87">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="62.748512" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="62.748512" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_43">
      <g id="line2d_88">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="59.862034" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="59.862034" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_44">
      <g id="line2d_89">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="57.315981" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="57.315981" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_45">
      <g id="line2d_90">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="40.055063" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="40.055063" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_46">
      <g id="line2d_91">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="31.290339" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="31.290339" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_47">
      <g id="line2d_92">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="25.071668" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="25.071668" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_48">
      <g id="line2d_93">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="20.248092" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="20.248092" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_49">
      <g id="line2d_94">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="16.306944" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="16.306944" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_50">
      <g id="line2d_95">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="12.97475" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="12.97475" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_51">
      <g id="line2d_96">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="10.088273" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="10.088273" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_52">
      <g id="line2d_97">
       <g>
-       <use xlink:href="#m3eccc8797b" x="53.31375" y="7.54222" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1611a10dbb" x="53.31375" y="7.54222" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -1607,7 +1607,7 @@ L 522.54088 50.981204
 L 543.677322 40.622719 
 L 564.813744 30.144362 
 L 585.950114 19.8 
-" clip-path="url(#pc83626295d)" style="fill: none; stroke: #d62728; stroke-width: 2; stroke-linecap: square"/>
+" clip-path="url(#pcd737df066)" style="fill: none; stroke: #d62728; stroke-width: 2; stroke-linecap: square"/>
    </g>
    <g id="line2d_99">
     <path d="M 78.677386 271.8 
@@ -1635,7 +1635,7 @@ L 522.54088 60.157119
 L 543.677322 47.726048 
 L 564.813744 37.297953 
 L 585.950114 26.861566 
-" clip-path="url(#pc83626295d)" style="fill: none; stroke: #ff7f0e; stroke-width: 2; stroke-linecap: square"/>
+" clip-path="url(#pcd737df066)" style="fill: none; stroke: #ff7f0e; stroke-width: 2; stroke-linecap: square"/>
    </g>
    <g id="line2d_100">
     <path d="M 78.677386 234.869154 
@@ -1663,7 +1663,7 @@ L 522.54088 179.213207
 L 543.677322 174.565984 
 L 564.813744 168.973472 
 L 585.950114 162.944248 
-" clip-path="url(#pc83626295d)" style="fill: none; stroke: #1f77b4; stroke-width: 2; stroke-linecap: square"/>
+" clip-path="url(#pcd737df066)" style="fill: none; stroke: #1f77b4; stroke-width: 2; stroke-linecap: square"/>
    </g>
    <g id="patch_3">
     <path d="M 53.31375 284.4 
@@ -1841,7 +1841,7 @@ L 82.31375 49.654687
   </g>
  </g>
  <defs>
-  <clipPath id="pc83626295d">
+  <clipPath id="pcd737df066">
    <rect x="53.31375" y="7.2" width="558" height="277.2"/>
   </clipPath>
  </defs>
diff --git a/_images/dd31b18d1cff85e83eacba5ebc5be4060b1d41e81847508924a3700363192b12.svg b/_images/17f4bc0031e15f516841db89056f81e68678814a7304c678002c457075111dff.svg
similarity index 97%
rename from _images/dd31b18d1cff85e83eacba5ebc5be4060b1d41e81847508924a3700363192b12.svg
rename to _images/17f4bc0031e15f516841db89056f81e68678814a7304c678002c457075111dff.svg
index ae1aa19..d759587 100644
--- a/_images/dd31b18d1cff85e83eacba5ebc5be4060b1d41e81847508924a3700363192b12.svg
+++ b/_images/17f4bc0031e15f516841db89056f81e68678814a7304c678002c457075111dff.svg
@@ -1 +1 @@
-<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">21.0% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(90 26.8)"><g class="a4 leaf node n1 sample" transform="translate(30 91.4)"><path class="edge" d="M 0 0 V -91.4 H -30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><g class="a4 c2 node n3" transform="translate(-30 45.7)"><g class="a3 leaf node n0 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a3 leaf node n2 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><path class="edge" d="M 0 0 V -45.7 H 30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab lft" transform="translate(-3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
+<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">28.4% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(90 26.8)"><g class="a4 leaf node n1 sample" transform="translate(30 91.4)"><path class="edge" d="M 0 0 V -91.4 H -30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><g class="a4 c2 node n3" transform="translate(-30 45.7)"><g class="a3 leaf node n0 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a3 leaf node n2 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><path class="edge" d="M 0 0 V -45.7 H 30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab lft" transform="translate(-3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
diff --git a/_images/7fd92d9de365279cc468b6a1314425c44830ed1b57dcf8975978c186202526d1.svg b/_images/21fd693d05896d8d3a71eb9d8c964cfbf531433d389df672bd5a526b37b35b05.svg
similarity index 97%
rename from _images/7fd92d9de365279cc468b6a1314425c44830ed1b57dcf8975978c186202526d1.svg
rename to _images/21fd693d05896d8d3a71eb9d8c964cfbf531433d389df672bd5a526b37b35b05.svg
index 378511c..42d7519 100644
--- a/_images/7fd92d9de365279cc468b6a1314425c44830ed1b57dcf8975978c186202526d1.svg
+++ b/_images/21fd693d05896d8d3a71eb9d8c964cfbf531433d389df672bd5a526b37b35b05.svg
@@ -1 +1 @@
-<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">19.6% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(90 26.8)"><g class="a4 leaf node n2 sample" transform="translate(30 91.4)"><path class="edge" d="M 0 0 V -91.4 H -30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><g class="a4 c2 node n3" transform="translate(-30 45.7)"><g class="a3 leaf node n0 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a3 leaf node n1 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><path class="edge" d="M 0 0 V -45.7 H 30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab lft" transform="translate(-3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
+<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">25.0% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(90 26.8)"><g class="a4 leaf node n2 sample" transform="translate(30 91.4)"><path class="edge" d="M 0 0 V -91.4 H -30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><g class="a4 c2 node n3" transform="translate(-30 45.7)"><g class="a3 leaf node n0 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a3 leaf node n1 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><path class="edge" d="M 0 0 V -45.7 H 30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab lft" transform="translate(-3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
diff --git a/_images/095acb303c5e6009d1cbdff6b8bac5aa81ac3381e17e5d1d175408fb7bdef0ac.svg b/_images/26c997c8903e9db9ec71f105e08e00ad5fc59d8472dc82b5c2884baa32c9b360.svg
similarity index 97%
rename from _images/095acb303c5e6009d1cbdff6b8bac5aa81ac3381e17e5d1d175408fb7bdef0ac.svg
rename to _images/26c997c8903e9db9ec71f105e08e00ad5fc59d8472dc82b5c2884baa32c9b360.svg
index 07a8629..982cc65 100644
--- a/_images/095acb303c5e6009d1cbdff6b8bac5aa81ac3381e17e5d1d175408fb7bdef0ac.svg
+++ b/_images/26c997c8903e9db9ec71f105e08e00ad5fc59d8472dc82b5c2884baa32c9b360.svg
@@ -6,7 +6,7 @@
   <rdf:RDF xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:cc="http://creativecommons.org/ns#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
    <cc:Work>
     <dc:type rdf:resource="http://purl.org/dc/dcmitype/StillImage"/>
-    <dc:date>2023-11-21T22:30:48.114466</dc:date>
+    <dc:date>2023-11-23T13:20:57.138740</dc:date>
     <dc:format>image/svg+xml</dc:format>
     <dc:creator>
      <cc:Agent>
@@ -378,7 +378,7 @@ L 486.906823 189.755396
 L 487.906823 189.7624 
 L 488.906823 189.771769 
 L 490.168651 189.795167 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 81.681948 
 L 150.906823 81.713385 
 L 151.906823 81.750325 
@@ -720,7 +720,7 @@ L 486.906823 80.683755
 L 487.906823 80.690759 
 L 488.906823 80.700128 
 L 490.168651 80.723526 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 282.175506 
 L 150.906823 282.206943 
 L 151.906823 282.243883 
@@ -1049,7 +1049,7 @@ L 473.906823 281.497452
 L 474.906823 281.458069 
 L 475.906823 281.435586 
 L 477.226218 281.379773 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 82.133075 
 L 150.906823 82.164512 
 L 151.906823 82.201452 
@@ -1391,7 +1391,7 @@ L 486.906823 81.134882
 L 487.906823 81.141885 
 L 488.906823 81.151255 
 L 490.168651 81.174653 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 240.482646 
 L 150.906823 240.514082 
 L 151.906823 240.551022 
@@ -1737,7 +1737,7 @@ L 490.906823 239.549307
 L 491.906823 239.561705 
 L 492.906823 239.594798 
 L 494.520494 239.611166 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 212.758579 
 L 150.906823 212.790015 
 L 151.906823 212.826955 
@@ -2088,7 +2088,7 @@ L 495.906823 211.954641
 L 496.906823 211.998454 
 L 497.906823 212.041539 
 L 499.079172 212.064479 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 112.207417 
 L 150.906823 112.238854 
 L 151.906823 112.275794 
@@ -2430,7 +2430,7 @@ L 486.906823 111.209224
 L 487.906823 111.216227 
 L 488.906823 111.225597 
 L 490.168651 111.248995 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 216.271441 
 L 150.906823 216.302877 
 L 151.906823 216.339817 
@@ -2780,7 +2780,7 @@ L 494.906823 215.418366
 L 495.906823 215.467503 
 L 496.906823 215.511316 
 L 498.665748 215.554401 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 181.361283 
 L 150.906823 181.392719 
 L 151.906823 181.429659 
@@ -3122,7 +3122,7 @@ L 486.906823 180.363089
 L 487.906823 180.370093 
 L 488.906823 180.379463 
 L 490.168651 180.40286 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 149.906823 311.169095 
 L 150.906823 311.200531 
 L 151.906823 311.237472 
@@ -3422,18 +3422,18 @@ L 444.906823 312.164645
 L 445.906823 312.152306 
 L 446.906823 312.137893 
 L 447.930525 312.12182 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <g id="patch_3">
     <path d="M 276.966619 7.2 
 L 276.966619 69.364375 
 M 343.229877 7.2 
 L 343.229877 69.364375 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
     <path d="M 276.966619 7.2 
 L 276.966619 69.364375 
 M 343.229877 7.2 
 L 343.229877 69.364375 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #1f77b4; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #1f77b4; stroke-linejoin: miter"/>
     <g id="PolyCollection_1">
      <path d="M 343.229877 7.2 
 L 276.966619 7.2 
@@ -3442,19 +3442,19 @@ L 343.229877 69.364375
 L 343.229877 69.364375 
 L 343.229877 7.2 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #1f77b4; fill-opacity: 0.5"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #1f77b4; fill-opacity: 0.5"/>
     </g>
     <g id="patch_4">
      <path d="M 78.176847 69.364375 
 L 78.176847 318.021875 
 M 144.440104 69.364375 
 L 144.440104 318.021875 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
      <path d="M 78.176847 69.364375 
 L 78.176847 318.021875 
 M 144.440104 69.364375 
 L 144.440104 318.021875 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ff7f0e; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ff7f0e; stroke-linejoin: miter"/>
      <g id="PolyCollection_2">
       <path d="M 144.440104 69.364375 
 L 78.176847 69.364375 
@@ -3463,7 +3463,7 @@ L 144.440104 318.021875
 L 144.440104 318.021875 
 L 144.440104 69.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5"/>
      </g>
      <g id="patch_5">
       <path d="M 495.635369 69.364375 
@@ -3521,7 +3521,7 @@ L 563.40718 310.486799
 L 568.993071 314.254337 
 L 575.151278 318.021875 
 L 575.151278 318.021875 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
       <path d="M 495.635369 69.364375 
 L 495.635369 193.693125 
 L 506.237491 193.693125 
@@ -3577,7 +3577,7 @@ L 563.40718 310.486799
 L 568.993071 314.254337 
 L 575.151278 318.021875 
 L 575.151278 318.021875 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #2ca02c; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #2ca02c; stroke-linejoin: miter"/>
       <g id="PolyCollection_3">
        <path d="M 522.140672 69.364375 
 L 495.635369 69.364375 
@@ -3786,7 +3786,7 @@ L 511.538551 193.693125
 L 522.140672 193.693125 
 L 522.140672 69.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #2ca02c; fill-opacity: 0.5"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #2ca02c; fill-opacity: 0.5"/>
       </g>
       <g id="matplotlib.axis_1">
        <g id="xtick_1">
@@ -3864,12 +3864,12 @@ z
        <g id="ytick_1">
         <g id="line2d_3">
          <defs>
-          <path id="m8f5d31c8d8" d="M 0 0 
+          <path id="mda7b8187e1" d="M 0 0 
 L -3.5 0 
 " style="stroke: #000000; stroke-width: 0.8"/>
          </defs>
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="318.021875" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="318.021875" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_3">
@@ -3905,7 +3905,7 @@ z
        <g id="ytick_2">
         <g id="line2d_4">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="268.290375" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="268.290375" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_4">
@@ -3946,7 +3946,7 @@ z
        <g id="ytick_3">
         <g id="line2d_5">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="218.558875" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="218.558875" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_5">
@@ -3982,7 +3982,7 @@ z
        <g id="ytick_4">
         <g id="line2d_6">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="168.827375" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="168.827375" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_6">
@@ -4029,7 +4029,7 @@ z
        <g id="ytick_5">
         <g id="line2d_7">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="119.095875" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="119.095875" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_7">
@@ -4085,7 +4085,7 @@ z
        <g id="ytick_6">
         <g id="line2d_8">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="69.364375" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="69.364375" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_8">
@@ -4117,7 +4117,7 @@ z
        <g id="ytick_7">
         <g id="line2d_9">
          <g>
-          <use xlink:href="#m8f5d31c8d8" x="53.328125" y="19.632875" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mda7b8187e1" x="53.328125" y="19.632875" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_9">
@@ -4560,7 +4560,7 @@ L 150.964647 68.501282
 L 149.964647 68.523604 
 L 148.964647 68.592364 
 L 147.561735 68.666899 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
        <path d="M 274.964647 69.364375 
 L 273.964647 69.332939 
 L 272.964647 69.295998 
@@ -4689,7 +4689,7 @@ L 150.964647 68.501282
 L 149.964647 68.523604 
 L 148.964647 68.592364 
 L 147.561735 68.666899 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
        <path d="M 151.561735 71.364375 
 L 150.681366 70.889044 
 L 149.803459 70.40879 
@@ -4703,7 +4703,7 @@ L 151.08746 68.364375
 L 151.035496 69.364375 
 L 150.976406 71.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
        <path d="M 151.561735 71.364375 
 L 150.681366 70.889044 
 L 149.803459 70.40879 
@@ -4717,7 +4717,7 @@ L 151.08746 68.364375
 L 151.035496 69.364375 
 L 150.976406 71.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
        <g id="patch_7">
         <path d="M 345.234478 69.364375 
 L 346.234478 69.395811 
@@ -4867,7 +4867,7 @@ L 489.234478 69.063795
 L 490.234478 69.011544 
 L 491.234478 68.972126 
 L 492.520741 68.925025 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
         <path d="M 345.234478 69.364375 
 L 346.234478 69.395811 
 L 347.234478 69.432752 
@@ -5016,7 +5016,7 @@ L 489.234478 69.063795
 L 490.234478 69.011544 
 L 491.234478 68.972126 
 L 492.520741 68.925025 
-" clip-path="url(#p3e2517c47e)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
         <path d="M 488.520741 67.364375 
 L 489.40111 67.839706 
 L 490.279017 68.31996 
@@ -5030,7 +5030,7 @@ L 488.995016 70.364375
 L 489.04698 69.364375 
 L 489.10607 67.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
         <path d="M 488.520741 67.364375 
 L 489.40111 67.839706 
 L 490.279017 68.31996 
@@ -5044,57 +5044,57 @@ L 488.995016 70.364375
 L 489.04698 69.364375 
 L 489.10607 67.364375 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
         <path d="M 491.168651 190.753589 
 L 489.168651 189.753589 
 L 489.168651 191.753589 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 491.168651 81.681948 
 L 489.168651 80.681948 
 L 489.168651 82.681948 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 478.226218 282.175506 
 L 476.226218 281.175506 
 L 476.226218 283.175506 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 491.168651 82.133075 
 L 489.168651 81.133075 
 L 489.168651 83.133075 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 495.520494 240.482646 
 L 493.520494 239.482646 
 L 493.520494 241.482646 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 500.079172 212.758579 
 L 498.079172 211.758579 
 L 498.079172 213.758579 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 491.168651 112.207417 
 L 489.168651 111.207417 
 L 489.168651 113.207417 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 499.665748 216.271441 
 L 497.665748 215.271441 
 L 497.665748 217.271441 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 491.168651 181.361283 
 L 489.168651 180.361283 
 L 489.168651 182.361283 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 448.930525 311.169095 
 L 446.930525 310.169095 
 L 446.930525 312.169095 
 z
-" clip-path="url(#p3e2517c47e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#p020ecfb9c7)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <g id="patch_8">
          <path d="M 53.328125 318.021875 
 L 53.328125 7.2 
@@ -5226,7 +5226,7 @@ z
        </g>
       </g>
       <defs>
-       <clipPath id="p3e2517c47e">
+       <clipPath id="p020ecfb9c7">
         <rect x="53.328125" y="7.2" width="546.671875" height="310.821875"/>
        </clipPath>
       </defs>
diff --git a/_images/ad7b78c682857fa573641fef3ce2c9f0b6c0d2a174bb18f8c734ba48c26a3a26.svg b/_images/28112c9a2b8621830393ff556580b2730dd9d8cafe05774d5b45a95aec5addc8.svg
similarity index 97%
rename from _images/ad7b78c682857fa573641fef3ce2c9f0b6c0d2a174bb18f8c734ba48c26a3a26.svg
rename to _images/28112c9a2b8621830393ff556580b2730dd9d8cafe05774d5b45a95aec5addc8.svg
index 050a9ef..dc29f33 100644
--- a/_images/ad7b78c682857fa573641fef3ce2c9f0b6c0d2a174bb18f8c734ba48c26a3a26.svg
+++ b/_images/28112c9a2b8621830393ff556580b2730dd9d8cafe05774d5b45a95aec5addc8.svg
@@ -1 +1 @@
-<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">59.4% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(70 26.8)"><g class="a4 leaf node n0 sample" transform="translate(-30 91.4)"><path class="edge" d="M 0 0 V -91.4 H 30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a4 c2 node n3" transform="translate(30 45.7)"><g class="a3 leaf node n1 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><g class="a3 leaf node n2 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><path class="edge" d="M 0 0 V -45.7 H -30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab rgt" transform="translate(3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
+<svg baseProfile="full" height="150" version="1.1" width="160" xmlns="http://www.w3.org/2000/svg" xmlns:ev="http://www.w3.org/2001/xml-events" xmlns:xlink="http://www.w3.org/1999/xlink"><defs><style type="text/css"><![CDATA[.background path {fill: #808080; fill-opacity: 0}.background path:nth-child(odd) {fill-opacity: .1}.axes {font-size: 14px}.x-axis .tick .lab {font-weight: bold; dominant-baseline: hanging}.axes, .tree {font-size: 14px; text-anchor: middle}.axes line, .edge {stroke: black; fill: none}.axes .ax-skip {stroke-dasharray: 4}.y-axis .grid {stroke: #FAFAFA}.node > .sym {fill: black; stroke: none}.site > .sym {stroke: black}.mut text {fill: red; font-style: italic}.mut.extra text {fill: hotpink}.mut line {fill: none; stroke: none}.mut .sym {fill: none; stroke: red}.mut.extra .sym {stroke: hotpink}.node .mut .sym {stroke-width: 1.5px}.tree text, .tree-sequence text {dominant-baseline: central}.plotbox .lab.lft {text-anchor: end}.plotbox .lab.rgt {text-anchor: start}.sample text.lab {baseline-shift: super; font-size: 0.7em;}.n0>.sym {fill: yellow }.n1>.sym {fill: green }.n2>.sym {fill: blue }]]></style></defs><g class="tree t0"><g class="axes"><g class="x-axis"><g class="title" transform="translate(80 150)"><text class="lab" text-anchor="middle" transform="translate(0 -11)">46.6% of genome</text></g></g></g><g class="plotbox"><g class="c2 node n4 root" transform="translate(70 26.8)"><g class="a4 leaf node n0 sample" transform="translate(-30 91.4)"><path class="edge" d="M 0 0 V -91.4 H 30" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">African</text></g><g class="a4 c2 node n3" transform="translate(30 45.7)"><g class="a3 leaf node n1 sample" transform="translate(-20 45.7)"><path class="edge" d="M 0 0 V -45.7 H 20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">European</text></g><g class="a3 leaf node n2 sample" transform="translate(20 45.7)"><path class="edge" d="M 0 0 V -45.7 H -20" /><rect class="sym" height="6" width="6" x="-3" y="-3" /><text class="lab" transform="translate(0 11)">Chinese</text></g><path class="edge" d="M 0 0 V -45.7 H -30" /><circle class="sym" cx="0" cy="0" r="3" /><text class="lab rgt" transform="translate(3 -7.0)" /></g><circle class="sym" cx="0" cy="0" r="3" /><text class="lab" transform="translate(0 -11)" /></g></g></g></svg>
\ No newline at end of file
diff --git a/_images/1d3f4a6ee25ec7c943da4f5e776f802489a0c8952031423d66debc6b99d74613.svg b/_images/465817323bc87e4d4ee8c4ba961d4fd0a4efc5e1363f04f6046dc1fbb52b8d7d.svg
similarity index 97%
rename from _images/1d3f4a6ee25ec7c943da4f5e776f802489a0c8952031423d66debc6b99d74613.svg
rename to _images/465817323bc87e4d4ee8c4ba961d4fd0a4efc5e1363f04f6046dc1fbb52b8d7d.svg
index a498768..47f9463 100644
--- a/_images/1d3f4a6ee25ec7c943da4f5e776f802489a0c8952031423d66debc6b99d74613.svg
+++ b/_images/465817323bc87e4d4ee8c4ba961d4fd0a4efc5e1363f04f6046dc1fbb52b8d7d.svg
@@ -6,7 +6,7 @@
   <rdf:RDF xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:cc="http://creativecommons.org/ns#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
    <cc:Work>
     <dc:type rdf:resource="http://purl.org/dc/dcmitype/StillImage"/>
-    <dc:date>2023-11-21T22:30:51.160175</dc:date>
+    <dc:date>2023-11-23T13:20:59.961579</dc:date>
     <dc:format>image/svg+xml</dc:format>
     <dc:creator>
      <cc:Agent>
@@ -41,12 +41,12 @@ z
     <g id="xtick_1">
      <g id="line2d_1">
       <defs>
-       <path id="m2d705bb441" d="M 0 0 
+       <path id="mee8e838b44" d="M 0 0 
 L 0 3.5 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#m2d705bb441" x="135.041023" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mee8e838b44" x="135.041023" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_1">
@@ -122,7 +122,7 @@ z
     <g id="xtick_2">
      <g id="line2d_2">
       <g>
-       <use xlink:href="#m2d705bb441" x="247.768295" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mee8e838b44" x="247.768295" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_2">
@@ -158,7 +158,7 @@ z
     <g id="xtick_3">
      <g id="line2d_3">
       <g>
-       <use xlink:href="#m2d705bb441" x="360.495568" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mee8e838b44" x="360.495568" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_3">
@@ -205,7 +205,7 @@ z
     <g id="xtick_4">
      <g id="line2d_4">
       <g>
-       <use xlink:href="#m2d705bb441" x="473.222841" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mee8e838b44" x="473.222841" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_4">
@@ -261,7 +261,7 @@ z
     <g id="xtick_5">
      <g id="line2d_5">
       <g>
-       <use xlink:href="#m2d705bb441" x="585.950114" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mee8e838b44" x="585.950114" y="228.96" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_5">
@@ -684,12 +684,12 @@ z
     <g id="ytick_1">
      <g id="line2d_6">
       <defs>
-       <path id="m17be4a002f" d="M 0 0 
+       <path id="m7145f7b133" d="M 0 0 
 L -3.5 0 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="207.702548" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="207.702548" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_7">
@@ -746,7 +746,7 @@ z
     <g id="ytick_2">
      <g id="line2d_7">
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="171.121361" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="171.121361" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_8">
@@ -762,7 +762,7 @@ z
     <g id="ytick_3">
      <g id="line2d_8">
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="134.540175" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="134.540175" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_9">
@@ -777,7 +777,7 @@ z
     <g id="ytick_4">
      <g id="line2d_9">
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="97.958988" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="97.958988" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_10">
@@ -792,7 +792,7 @@ z
     <g id="ytick_5">
      <g id="line2d_10">
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="61.377801" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="61.377801" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_11">
@@ -834,7 +834,7 @@ z
     <g id="ytick_6">
      <g id="line2d_11">
       <g>
-       <use xlink:href="#m17be4a002f" x="53.31375" y="24.796614" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m7145f7b133" x="53.31375" y="24.796614" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_12">
@@ -1095,7 +1095,7 @@ L 416.859205 77.167211
 L 473.222841 57.204807 
 L 529.586477 37.242404 
 L 585.950114 17.28 
-" clip-path="url(#p16dc0451fb)" style="fill: none; stroke: #ff7f0e; stroke-width: 2; stroke-linecap: square"/>
+" clip-path="url(#pc35f5ba65c)" style="fill: none; stroke: #ff7f0e; stroke-width: 2; stroke-linecap: square"/>
    </g>
    <g id="line2d_13">
     <path d="M 78.677386 218.88 
@@ -1108,7 +1108,7 @@ L 416.859205 109.876523
 L 473.222841 91.709276 
 L 529.586477 73.54203 
 L 585.950114 55.374784 
-" clip-path="url(#p16dc0451fb)" style="fill: none; stroke-dasharray: 2,3.3; stroke-dashoffset: 0; stroke: #ff7f0e; stroke-width: 2"/>
+" clip-path="url(#pc35f5ba65c)" style="fill: none; stroke-dasharray: 2,3.3; stroke-dashoffset: 0; stroke: #ff7f0e; stroke-width: 2"/>
    </g>
    <g id="line2d_14">
     <path d="M 78.677386 187.154688 
@@ -1121,7 +1121,7 @@ L 416.859205 151.665244
 L 473.222841 134.049418 
 L 529.586477 115.840108 
 L 585.950114 97.558745 
-" clip-path="url(#p16dc0451fb)" style="fill: none; stroke: #1f77b4; stroke-width: 2; stroke-linecap: square"/>
+" clip-path="url(#pc35f5ba65c)" style="fill: none; stroke: #1f77b4; stroke-width: 2; stroke-linecap: square"/>
    </g>
    <g id="line2d_15">
     <path d="M 78.677386 204.806749 
@@ -1134,7 +1134,7 @@ L 416.859205 172.515279
 L 473.222841 156.03855 
 L 529.586477 137.987277 
 L 585.950114 119.724324 
-" clip-path="url(#p16dc0451fb)" style="fill: none; stroke-dasharray: 2,3.3; stroke-dashoffset: 0; stroke: #1f77b4; stroke-width: 2"/>
+" clip-path="url(#pc35f5ba65c)" style="fill: none; stroke-dasharray: 2,3.3; stroke-dashoffset: 0; stroke: #1f77b4; stroke-width: 2"/>
    </g>
    <g id="patch_3">
     <path d="M 53.31375 228.96 
@@ -1421,7 +1421,7 @@ L 82.31375 64.332812
   </g>
  </g>
  <defs>
-  <clipPath id="p16dc0451fb">
+  <clipPath id="pc35f5ba65c">
    <rect x="53.31375" y="7.2" width="558" height="221.76"/>
   </clipPath>
  </defs>
diff --git a/_images/16e48cdc7a977659f4eaad079ea83de8bfa1a1174384dae0402a3d682d6c8adf.svg b/_images/b3beea434b2bfb3f38f481eea7255126f65e9daf72048e4ed5e4231fb94e4ba5.svg
similarity index 96%
rename from _images/16e48cdc7a977659f4eaad079ea83de8bfa1a1174384dae0402a3d682d6c8adf.svg
rename to _images/b3beea434b2bfb3f38f481eea7255126f65e9daf72048e4ed5e4231fb94e4ba5.svg
index ee75a93..cd89939 100644
--- a/_images/16e48cdc7a977659f4eaad079ea83de8bfa1a1174384dae0402a3d682d6c8adf.svg
+++ b/_images/b3beea434b2bfb3f38f481eea7255126f65e9daf72048e4ed5e4231fb94e4ba5.svg
@@ -6,7 +6,7 @@
   <rdf:RDF xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:cc="http://creativecommons.org/ns#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
    <cc:Work>
     <dc:type rdf:resource="http://purl.org/dc/dcmitype/StillImage"/>
-    <dc:date>2023-11-21T22:30:51.523881</dc:date>
+    <dc:date>2023-11-23T13:21:00.318250</dc:date>
     <dc:format>image/svg+xml</dc:format>
     <dc:creator>
      <cc:Agent>
@@ -211,7 +211,7 @@ L 272.618125 104.43519
 L 273.618125 104.463425 
 L 274.618125 104.507213 
 L 276.274489 104.527902 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 47.055102 
 L 103.618125 47.086539 
 L 104.618125 47.123479 
@@ -386,7 +386,7 @@ L 272.618125 46.07123
 L 273.618125 46.099466 
 L 274.618125 46.143253 
 L 276.274489 46.163942 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 154.338699 
 L 103.618125 154.370135 
 L 104.618125 154.407075 
@@ -555,7 +555,7 @@ L 266.618125 153.357056
 L 267.618125 153.351221 
 L 268.618125 153.344338 
 L 269.669176 153.339165 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 47.296499 
 L 103.618125 47.327936 
 L 104.618125 47.364876 
@@ -730,7 +730,7 @@ L 272.618125 46.312627
 L 273.618125 46.340862 
 L 274.618125 46.38465 
 L 276.274489 46.405339 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 132.028954 
 L 103.618125 132.060391 
 L 104.618125 132.097331 
@@ -907,7 +907,7 @@ L 274.618125 131.117105
 L 275.618125 131.137794 
 L 276.618125 131.178768 
 L 278.4955 131.218843 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 117.193876 
 L 103.618125 117.225312 
 L 104.618125 117.262253 
@@ -1087,7 +1087,7 @@ L 277.618125 116.383764
 L 278.618125 116.402874 
 L 279.618125 116.425383 
 L 280.822071 116.492034 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 63.389204 
 L 103.618125 63.42064 
 L 104.618125 63.45758 
@@ -1262,7 +1262,7 @@ L 272.618125 62.405331
 L 273.618125 62.433567 
 L 274.618125 62.477354 
 L 276.274489 62.498044 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 119.0736 
 L 103.618125 119.105036 
 L 104.618125 119.141976 
@@ -1441,7 +1441,7 @@ L 276.618125 118.223413
 L 277.618125 118.263488 
 L 278.618125 118.282598 
 L 280.611076 118.305106 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 100.393262 
 L 103.618125 100.424699 
 L 104.618125 100.461639 
@@ -1616,7 +1616,7 @@ L 272.618125 99.40939
 L 273.618125 99.437625 
 L 274.618125 99.481413 
 L 276.274489 99.502102 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <path d="M 102.618125 169.853095 
 L 103.618125 169.884531 
 L 104.618125 169.921471 
@@ -1770,18 +1770,18 @@ L 251.618125 169.324302
 L 252.618125 169.288124 
 L 253.618125 169.256033 
 L 254.717797 169.221754 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-width: 0.2; stroke-linecap: square"/>
    <g id="patch_3">
     <path d="M 167.464489 7.2 
 L 167.464489 40.464 
 M 201.28267 7.2 
 L 201.28267 40.464 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
     <path d="M 167.464489 7.2 
 L 167.464489 40.464 
 M 201.28267 7.2 
 L 201.28267 40.464 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #1f77b4; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #1f77b4; stroke-linejoin: miter"/>
     <g id="PolyCollection_1">
      <path d="M 201.28267 7.2 
 L 167.464489 7.2 
@@ -1790,19 +1790,19 @@ L 201.28267 40.464
 L 201.28267 40.464 
 L 201.28267 7.2 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #1f77b4; fill-opacity: 0.5"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #1f77b4; fill-opacity: 0.5"/>
     </g>
     <g id="patch_4">
      <path d="M 66.009943 40.464 
 L 66.009943 173.52 
 M 99.828125 40.464 
 L 99.828125 173.52 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
      <path d="M 66.009943 40.464 
 L 66.009943 173.52 
 M 99.828125 40.464 
 L 99.828125 173.52 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ff7f0e; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ff7f0e; stroke-linejoin: miter"/>
      <g id="PolyCollection_2">
       <path d="M 99.828125 40.464 
 L 66.009943 40.464 
@@ -1811,7 +1811,7 @@ L 99.828125 173.52
 L 99.828125 173.52 
 L 99.828125 40.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5"/>
      </g>
      <g id="patch_5">
       <path d="M 279.064489 40.464 
@@ -1857,7 +1857,7 @@ L 314.572126 170.16
 L 317.517162 172.176 
 L 319.646307 173.52 
 L 319.646307 173.52 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linejoin: miter"/>
       <path d="M 279.064489 40.464 
 L 279.064489 106.992 
 L 284.475398 106.992 
@@ -1901,7 +1901,7 @@ L 314.572126 170.16
 L 317.517162 172.176 
 L 319.646307 173.52 
 L 319.646307 173.52 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #2ca02c; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #2ca02c; stroke-linejoin: miter"/>
       <g id="PolyCollection_3">
        <path d="M 292.591761 40.464 
 L 279.064489 40.464 
@@ -2110,7 +2110,7 @@ L 287.180852 106.992
 L 292.591761 106.992 
 L 292.591761 40.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #2ca02c; fill-opacity: 0.5"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #2ca02c; fill-opacity: 0.5"/>
       </g>
       <g id="matplotlib.axis_1">
        <g id="xtick_1">
@@ -2188,12 +2188,12 @@ z
        <g id="ytick_1">
         <g id="line2d_3">
          <defs>
-          <path id="m9f8a56d3cc" d="M 0 0 
+          <path id="mbf17906b63" d="M 0 0 
 L -3.5 0 
 " style="stroke: #000000; stroke-width: 0.8"/>
          </defs>
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="173.52" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="173.52" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_3">
@@ -2229,7 +2229,7 @@ z
        <g id="ytick_2">
         <g id="line2d_4">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="146.9088" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="146.9088" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_4">
@@ -2270,7 +2270,7 @@ z
        <g id="ytick_3">
         <g id="line2d_5">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="120.2976" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="120.2976" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_5">
@@ -2306,7 +2306,7 @@ z
        <g id="ytick_4">
         <g id="line2d_6">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="93.6864" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="93.6864" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_6">
@@ -2353,7 +2353,7 @@ z
        <g id="ytick_5">
         <g id="line2d_7">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="67.0752" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="67.0752" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_7">
@@ -2409,7 +2409,7 @@ z
        <g id="ytick_6">
         <g id="line2d_8">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="40.464" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="40.464" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_8">
@@ -2441,7 +2441,7 @@ z
        <g id="ytick_7">
         <g id="line2d_9">
          <g>
-          <use xlink:href="#m9f8a56d3cc" x="53.328125" y="13.8528" style="stroke: #000000; stroke-width: 0.8"/>
+          <use xlink:href="#mbf17906b63" x="53.328125" y="13.8528" style="stroke: #000000; stroke-width: 0.8"/>
          </g>
         </g>
         <g id="text_9">
@@ -2819,7 +2819,7 @@ L 106.462314 41.279735
 L 105.462314 41.306129 
 L 104.462314 41.3559 
 L 102.945149 41.390973 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
        <path d="M 165.462314 40.464 
 L 164.462314 40.432564 
 L 163.462314 40.395623 
@@ -2883,7 +2883,7 @@ L 106.462314 41.279735
 L 105.462314 41.306129 
 L 104.462314 41.3559 
 L 102.945149 41.390973 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
        <path d="M 106.945149 42.464 
 L 106.064781 41.988669 
 L 105.186874 41.508415 
@@ -2897,7 +2897,7 @@ L 106.470875 39.464
 L 106.418911 40.464 
 L 106.359821 42.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
        <path d="M 106.945149 42.464 
 L 106.064781 41.988669 
 L 105.186874 41.508415 
@@ -2911,7 +2911,7 @@ L 106.470875 39.464
 L 106.418911 40.464 
 L 106.359821 42.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
        <g id="patch_7">
         <path d="M 203.281337 40.464 
 L 204.281337 40.495436 
@@ -2986,7 +2986,7 @@ L 272.281337 39.46661
 L 273.281337 39.479867 
 L 274.281337 39.488258 
 L 275.943641 39.509794 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
         <path d="M 203.281337 40.464 
 L 204.281337 40.495436 
 L 205.281337 40.532377 
@@ -3060,7 +3060,7 @@ L 272.281337 39.46661
 L 273.281337 39.479867 
 L 274.281337 39.488258 
 L 275.943641 39.509794 
-" clip-path="url(#p21ec095efd)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: none; stroke: #1f77b4; stroke-linecap: round"/>
         <path d="M 271.943641 38.464 
 L 272.824009 38.939331 
 L 273.701916 39.419585 
@@ -3074,7 +3074,7 @@ L 272.417915 41.464
 L 272.469879 40.464 
 L 272.528969 38.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ffffff; stroke: #ffffff; stroke-width: 3; stroke-linecap: round"/>
         <path d="M 271.943641 38.464 
 L 272.824009 38.939331 
 L 273.701916 39.419585 
@@ -3088,57 +3088,57 @@ L 272.417915 41.464
 L 272.469879 40.464 
 L 272.528969 38.464 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ffffff; stroke: #1f77b4; stroke-linecap: round"/>
         <path d="M 277.274489 105.419062 
 L 275.274489 104.419062 
 L 275.274489 106.419062 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 277.274489 47.055102 
 L 275.274489 46.055102 
 L 275.274489 48.055102 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 270.669176 154.338699 
 L 268.669176 153.338699 
 L 268.669176 155.338699 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 277.274489 47.296499 
 L 275.274489 46.296499 
 L 275.274489 48.296499 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 279.4955 132.028954 
 L 277.4955 131.028954 
 L 277.4955 133.028954 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 281.822071 117.193876 
 L 279.822071 116.193876 
 L 279.822071 118.193876 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 277.274489 63.389204 
 L 275.274489 62.389204 
 L 275.274489 64.389204 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 281.611076 119.0736 
 L 279.611076 118.0736 
 L 279.611076 120.0736 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 277.274489 100.393262 
 L 275.274489 99.393262 
 L 275.274489 101.393262 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <path d="M 255.717797 169.853095 
 L 253.717797 168.853095 
 L 253.717797 170.853095 
 z
-" clip-path="url(#p21ec095efd)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
+" clip-path="url(#pbc37c2e40e)" style="fill: #ff7f0e; fill-opacity: 0.5; stroke: #ff7f0e; stroke-opacity: 0.5; stroke-linejoin: miter"/>
         <g id="patch_8">
          <path d="M 53.328125 173.52 
 L 53.328125 7.2 
@@ -3270,7 +3270,7 @@ z
        </g>
       </g>
       <defs>
-       <clipPath id="p21ec095efd">
+       <clipPath id="pbc37c2e40e">
         <rect x="53.328125" y="7.2" width="279" height="166.32"/>
        </clipPath>
       </defs>
diff --git a/_images/9879460663347f6185ecf3730bfe94621c5658e37655eb26a1fe3e56eee3d9e4.svg b/_images/d59f0e212d1906e9016ab86b181618f53e021707cf1af4a31a1a121077c4d6e7.svg
similarity index 86%
rename from _images/9879460663347f6185ecf3730bfe94621c5658e37655eb26a1fe3e56eee3d9e4.svg
rename to _images/d59f0e212d1906e9016ab86b181618f53e021707cf1af4a31a1a121077c4d6e7.svg
index 07f09b1..c931cf5 100644
--- a/_images/9879460663347f6185ecf3730bfe94621c5658e37655eb26a1fe3e56eee3d9e4.svg
+++ b/_images/d59f0e212d1906e9016ab86b181618f53e021707cf1af4a31a1a121077c4d6e7.svg
@@ -6,7 +6,7 @@
   <rdf:RDF xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:cc="http://creativecommons.org/ns#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
    <cc:Work>
     <dc:type rdf:resource="http://purl.org/dc/dcmitype/StillImage"/>
-    <dc:date>2023-11-21T22:30:50.707639</dc:date>
+    <dc:date>2023-11-23T13:20:59.510309</dc:date>
     <dc:format>image/svg+xml</dc:format>
     <dc:creator>
      <cc:Agent>
@@ -41,12 +41,12 @@ z
     <g id="xtick_1">
      <g id="line2d_1">
       <defs>
-       <path id="mf598524778" d="M 0 0 
+       <path id="m3496a52a93" d="M 0 0 
 L 0 3.5 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#mf598524778" x="114.322142" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="114.322142" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_1">
@@ -98,7 +98,7 @@ z
     <g id="xtick_2">
      <g id="line2d_2">
       <g>
-       <use xlink:href="#mf598524778" x="198.10396" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="198.10396" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_2">
@@ -139,7 +139,7 @@ z
     <g id="xtick_3">
      <g id="line2d_3">
       <g>
-       <use xlink:href="#mf598524778" x="281.885778" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="281.885778" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_3">
@@ -188,7 +188,7 @@ z
     <g id="xtick_4">
      <g id="line2d_4">
       <g>
-       <use xlink:href="#mf598524778" x="365.667597" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="365.667597" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_4">
@@ -224,7 +224,7 @@ z
     <g id="xtick_5">
      <g id="line2d_5">
       <g>
-       <use xlink:href="#mf598524778" x="449.449415" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="449.449415" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_5">
@@ -266,7 +266,7 @@ z
     <g id="xtick_6">
      <g id="line2d_6">
       <g>
-       <use xlink:href="#mf598524778" x="533.231233" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="533.231233" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_6">
@@ -313,313 +313,313 @@ z
     <g id="xtick_7">
      <g id="line2d_7">
       <defs>
-       <path id="m46f50302b5" d="M 0 0 
+       <path id="m6055d84d65" d="M 0 0 
 L 0 2 
 " style="stroke: #000000; stroke-width: 0.6"/>
       </defs>
       <g>
-       <use xlink:href="#m46f50302b5" x="95.73525" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="95.73525" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_8">
      <g id="line2d_8">
       <g>
-       <use xlink:href="#m46f50302b5" x="101.344174" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="101.344174" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_9">
      <g id="line2d_9">
       <g>
-       <use xlink:href="#m46f50302b5" x="106.202845" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="106.202845" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_10">
      <g id="line2d_10">
       <g>
-       <use xlink:href="#m46f50302b5" x="110.488496" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="110.488496" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_11">
      <g id="line2d_11">
       <g>
-       <use xlink:href="#m46f50302b5" x="139.542982" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="139.542982" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_12">
      <g id="line2d_12">
       <g>
-       <use xlink:href="#m46f50302b5" x="154.296228" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="154.296228" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_13">
      <g id="line2d_13">
       <g>
-       <use xlink:href="#m46f50302b5" x="164.763823" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="164.763823" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_14">
      <g id="line2d_14">
       <g>
-       <use xlink:href="#m46f50302b5" x="172.88312" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="172.88312" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_15">
      <g id="line2d_15">
       <g>
-       <use xlink:href="#m46f50302b5" x="179.517069" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="179.517069" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_16">
      <g id="line2d_16">
       <g>
-       <use xlink:href="#m46f50302b5" x="185.125992" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="185.125992" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_17">
      <g id="line2d_17">
       <g>
-       <use xlink:href="#m46f50302b5" x="189.984663" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="189.984663" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_18">
      <g id="line2d_18">
       <g>
-       <use xlink:href="#m46f50302b5" x="194.270314" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="194.270314" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_19">
      <g id="line2d_19">
       <g>
-       <use xlink:href="#m46f50302b5" x="223.324801" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="223.324801" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_20">
      <g id="line2d_20">
       <g>
-       <use xlink:href="#m46f50302b5" x="238.078046" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="238.078046" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_21">
      <g id="line2d_21">
       <g>
-       <use xlink:href="#m46f50302b5" x="248.545641" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="248.545641" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_22">
      <g id="line2d_22">
       <g>
-       <use xlink:href="#m46f50302b5" x="256.664938" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="256.664938" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_23">
      <g id="line2d_23">
       <g>
-       <use xlink:href="#m46f50302b5" x="263.298887" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="263.298887" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_24">
      <g id="line2d_24">
       <g>
-       <use xlink:href="#m46f50302b5" x="268.907811" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="268.907811" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_25">
      <g id="line2d_25">
       <g>
-       <use xlink:href="#m46f50302b5" x="273.766481" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="273.766481" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_26">
      <g id="line2d_26">
       <g>
-       <use xlink:href="#m46f50302b5" x="278.052133" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="278.052133" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_27">
      <g id="line2d_27">
       <g>
-       <use xlink:href="#m46f50302b5" x="307.106619" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="307.106619" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_28">
      <g id="line2d_28">
       <g>
-       <use xlink:href="#m46f50302b5" x="321.859865" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="321.859865" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_29">
      <g id="line2d_29">
       <g>
-       <use xlink:href="#m46f50302b5" x="332.327459" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="332.327459" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_30">
      <g id="line2d_30">
       <g>
-       <use xlink:href="#m46f50302b5" x="340.446756" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="340.446756" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_31">
      <g id="line2d_31">
       <g>
-       <use xlink:href="#m46f50302b5" x="347.080705" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="347.080705" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_32">
      <g id="line2d_32">
       <g>
-       <use xlink:href="#m46f50302b5" x="352.689629" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="352.689629" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_33">
      <g id="line2d_33">
       <g>
-       <use xlink:href="#m46f50302b5" x="357.5483" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="357.5483" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_34">
      <g id="line2d_34">
       <g>
-       <use xlink:href="#m46f50302b5" x="361.833951" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="361.833951" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_35">
      <g id="line2d_35">
       <g>
-       <use xlink:href="#m46f50302b5" x="390.888437" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="390.888437" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_36">
      <g id="line2d_36">
       <g>
-       <use xlink:href="#m46f50302b5" x="405.641683" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="405.641683" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_37">
      <g id="line2d_37">
       <g>
-       <use xlink:href="#m46f50302b5" x="416.109277" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="416.109277" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_38">
      <g id="line2d_38">
       <g>
-       <use xlink:href="#m46f50302b5" x="424.228574" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="424.228574" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_39">
      <g id="line2d_39">
       <g>
-       <use xlink:href="#m46f50302b5" x="430.862523" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="430.862523" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_40">
      <g id="line2d_40">
       <g>
-       <use xlink:href="#m46f50302b5" x="436.471447" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="436.471447" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_41">
      <g id="line2d_41">
       <g>
-       <use xlink:href="#m46f50302b5" x="441.330118" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="441.330118" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_42">
      <g id="line2d_42">
       <g>
-       <use xlink:href="#m46f50302b5" x="445.615769" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="445.615769" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_43">
      <g id="line2d_43">
       <g>
-       <use xlink:href="#m46f50302b5" x="474.670255" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="474.670255" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_44">
      <g id="line2d_44">
       <g>
-       <use xlink:href="#m46f50302b5" x="489.423501" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="489.423501" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_45">
      <g id="line2d_45">
       <g>
-       <use xlink:href="#m46f50302b5" x="499.891096" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="499.891096" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_46">
      <g id="line2d_46">
       <g>
-       <use xlink:href="#m46f50302b5" x="508.010393" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="508.010393" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_47">
      <g id="line2d_47">
       <g>
-       <use xlink:href="#m46f50302b5" x="514.644341" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="514.644341" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_48">
      <g id="line2d_48">
       <g>
-       <use xlink:href="#m46f50302b5" x="520.253265" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="520.253265" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_49">
      <g id="line2d_49">
       <g>
-       <use xlink:href="#m46f50302b5" x="525.111936" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="525.111936" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_50">
      <g id="line2d_50">
       <g>
-       <use xlink:href="#m46f50302b5" x="529.397587" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="529.397587" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -914,12 +914,12 @@ z
     <g id="ytick_1">
      <g id="line2d_51">
       <defs>
-       <path id="m59ca688139" d="M 0 0 
+       <path id="mcd6de3f9e7" d="M 0 0 
 L -3.5 0 
 " style="stroke: #000000; stroke-width: 0.8"/>
       </defs>
       <g>
-       <use xlink:href="#m59ca688139" x="93.376688" y="280.365733" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="93.376688" y="280.365733" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_8">
@@ -944,7 +944,7 @@ z
     <g id="ytick_2">
      <g id="line2d_52">
       <g>
-       <use xlink:href="#m59ca688139" x="93.376688" y="227.472534" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="93.376688" y="227.472534" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_9">
@@ -960,7 +960,7 @@ z
     <g id="ytick_3">
      <g id="line2d_53">
       <g>
-       <use xlink:href="#m59ca688139" x="93.376688" y="174.579335" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="93.376688" y="174.579335" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_10">
@@ -976,7 +976,7 @@ z
     <g id="ytick_4">
      <g id="line2d_54">
       <g>
-       <use xlink:href="#m59ca688139" x="93.376688" y="121.686137" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="93.376688" y="121.686137" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_11">
@@ -991,257 +991,257 @@ z
     <g id="ytick_5">
      <g id="line2d_55">
       <defs>
-       <path id="m84a11e1b90" d="M 0 0 
+       <path id="m1a88b992c7" d="M 0 0 
 L -2 0 
 " style="stroke: #000000; stroke-width: 0.6"/>
       </defs>
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="317.336492" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="317.336492" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_6">
      <g id="line2d_56">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="308.022462" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="308.022462" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_7">
      <g id="line2d_57">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="301.414053" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="301.414053" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_8">
      <g id="line2d_58">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="296.288172" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="296.288172" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_9">
      <g id="line2d_59">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="292.100023" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="292.100023" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_10">
      <g id="line2d_60">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="288.558993" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="288.558993" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_11">
      <g id="line2d_61">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="285.491613" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="285.491613" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_12">
      <g id="line2d_62">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="282.785993" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="282.785993" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_13">
      <g id="line2d_63">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="264.443293" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="264.443293" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_14">
      <g id="line2d_64">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="255.129263" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="255.129263" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_15">
      <g id="line2d_65">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="248.520854" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="248.520854" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_16">
      <g id="line2d_66">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="243.394973" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="243.394973" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_17">
      <g id="line2d_67">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="239.206824" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="239.206824" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_18">
      <g id="line2d_68">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="235.665794" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="235.665794" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_19">
      <g id="line2d_69">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="232.598415" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="232.598415" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_20">
      <g id="line2d_70">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="229.892794" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="229.892794" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_21">
      <g id="line2d_71">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="211.550095" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="211.550095" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_22">
      <g id="line2d_72">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="202.236065" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="202.236065" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_23">
      <g id="line2d_73">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="195.627655" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="195.627655" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_24">
      <g id="line2d_74">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="190.501775" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="190.501775" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_25">
      <g id="line2d_75">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="186.313625" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="186.313625" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_26">
      <g id="line2d_76">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="182.772595" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="182.772595" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_27">
      <g id="line2d_77">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="179.705216" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="179.705216" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_28">
      <g id="line2d_78">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="176.999595" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="176.999595" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_29">
      <g id="line2d_79">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="158.656896" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="158.656896" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_30">
      <g id="line2d_80">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="149.342866" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="149.342866" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_31">
      <g id="line2d_81">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="142.734457" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="142.734457" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_32">
      <g id="line2d_82">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="137.608576" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="137.608576" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_33">
      <g id="line2d_83">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="133.420427" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="133.420427" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_34">
      <g id="line2d_84">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="129.879397" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="129.879397" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_35">
      <g id="line2d_85">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="126.812017" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="126.812017" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_36">
      <g id="line2d_86">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="124.106397" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="124.106397" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_37">
      <g id="line2d_87">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="105.763697" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="105.763697" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_38">
      <g id="line2d_88">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="96.449667" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="96.449667" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_39">
      <g id="line2d_89">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="89.841258" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="89.841258" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_40">
      <g id="line2d_90">
       <g>
-       <use xlink:href="#m84a11e1b90" x="93.376688" y="84.715377" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="93.376688" y="84.715377" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -1593,7 +1593,7 @@ L 281.885778 181.090599
 L 365.667597 231.574836 
 L 449.449415 281.406785 
 L 533.231233 320.184 
-" clip-path="url(#p006a53974d)" style="fill: none; stroke: #1f77b4; stroke-width: 4; stroke-linecap: square"/>
+" clip-path="url(#p9053ecc8f5)" style="fill: none; stroke: #1f77b4; stroke-width: 4; stroke-linecap: square"/>
    </g>
    <g id="patch_3">
     <path d="M 93.376688 331.524 
@@ -1802,7 +1802,7 @@ z
     <g id="xtick_51">
      <g id="line2d_92">
       <g>
-       <use xlink:href="#mf598524778" x="860.325514" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="860.325514" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_14">
@@ -1817,7 +1817,7 @@ z
     <g id="xtick_52">
      <g id="line2d_93">
       <g>
-       <use xlink:href="#mf598524778" x="951.351943" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="951.351943" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_15">
@@ -1832,7 +1832,7 @@ z
     <g id="xtick_53">
      <g id="line2d_94">
       <g>
-       <use xlink:href="#mf598524778" x="1042.378373" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="1042.378373" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_16">
@@ -1847,7 +1847,7 @@ z
     <g id="xtick_54">
      <g id="line2d_95">
       <g>
-       <use xlink:href="#mf598524778" x="1133.404803" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="1133.404803" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_17">
@@ -1862,7 +1862,7 @@ z
     <g id="xtick_55">
      <g id="line2d_96">
       <g>
-       <use xlink:href="#mf598524778" x="1224.431233" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#m3496a52a93" x="1224.431233" y="331.524" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_18">
@@ -1877,280 +1877,280 @@ z
     <g id="xtick_56">
      <g id="line2d_97">
       <g>
-       <use xlink:href="#m46f50302b5" x="796.70077" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="796.70077" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_57">
      <g id="line2d_98">
       <g>
-       <use xlink:href="#m46f50302b5" x="812.729728" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="812.729728" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_58">
      <g id="line2d_99">
       <g>
-       <use xlink:href="#m46f50302b5" x="824.102455" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="824.102455" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_59">
      <g id="line2d_100">
       <g>
-       <use xlink:href="#m46f50302b5" x="832.923828" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="832.923828" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_60">
      <g id="line2d_101">
       <g>
-       <use xlink:href="#m46f50302b5" x="840.131414" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="840.131414" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_61">
      <g id="line2d_102">
       <g>
-       <use xlink:href="#m46f50302b5" x="846.225341" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="846.225341" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_62">
      <g id="line2d_103">
       <g>
-       <use xlink:href="#m46f50302b5" x="851.504141" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="851.504141" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_63">
      <g id="line2d_104">
       <g>
-       <use xlink:href="#m46f50302b5" x="856.160373" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="856.160373" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_64">
      <g id="line2d_105">
       <g>
-       <use xlink:href="#m46f50302b5" x="887.727199" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="887.727199" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_65">
      <g id="line2d_106">
       <g>
-       <use xlink:href="#m46f50302b5" x="903.756158" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="903.756158" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_66">
      <g id="line2d_107">
       <g>
-       <use xlink:href="#m46f50302b5" x="915.128885" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="915.128885" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_67">
      <g id="line2d_108">
       <g>
-       <use xlink:href="#m46f50302b5" x="923.950258" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="923.950258" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_68">
      <g id="line2d_109">
       <g>
-       <use xlink:href="#m46f50302b5" x="931.157844" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="931.157844" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_69">
      <g id="line2d_110">
       <g>
-       <use xlink:href="#m46f50302b5" x="937.251771" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="937.251771" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_70">
      <g id="line2d_111">
       <g>
-       <use xlink:href="#m46f50302b5" x="942.530571" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="942.530571" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_71">
      <g id="line2d_112">
       <g>
-       <use xlink:href="#m46f50302b5" x="947.186802" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="947.186802" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_72">
      <g id="line2d_113">
       <g>
-       <use xlink:href="#m46f50302b5" x="978.753629" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="978.753629" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_73">
      <g id="line2d_114">
       <g>
-       <use xlink:href="#m46f50302b5" x="994.782588" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="994.782588" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_74">
      <g id="line2d_115">
       <g>
-       <use xlink:href="#m46f50302b5" x="1006.155315" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1006.155315" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_75">
      <g id="line2d_116">
       <g>
-       <use xlink:href="#m46f50302b5" x="1014.976688" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1014.976688" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_76">
      <g id="line2d_117">
       <g>
-       <use xlink:href="#m46f50302b5" x="1022.184274" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1022.184274" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_77">
      <g id="line2d_118">
       <g>
-       <use xlink:href="#m46f50302b5" x="1028.278201" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1028.278201" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_78">
      <g id="line2d_119">
       <g>
-       <use xlink:href="#m46f50302b5" x="1033.557001" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1033.557001" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_79">
      <g id="line2d_120">
       <g>
-       <use xlink:href="#m46f50302b5" x="1038.213232" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1038.213232" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_80">
      <g id="line2d_121">
       <g>
-       <use xlink:href="#m46f50302b5" x="1069.780059" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1069.780059" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_81">
      <g id="line2d_122">
       <g>
-       <use xlink:href="#m46f50302b5" x="1085.809018" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1085.809018" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_82">
      <g id="line2d_123">
       <g>
-       <use xlink:href="#m46f50302b5" x="1097.181745" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1097.181745" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_83">
      <g id="line2d_124">
       <g>
-       <use xlink:href="#m46f50302b5" x="1106.003117" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1106.003117" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_84">
      <g id="line2d_125">
       <g>
-       <use xlink:href="#m46f50302b5" x="1113.210703" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1113.210703" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_85">
      <g id="line2d_126">
       <g>
-       <use xlink:href="#m46f50302b5" x="1119.304631" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1119.304631" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_86">
      <g id="line2d_127">
       <g>
-       <use xlink:href="#m46f50302b5" x="1124.583431" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1124.583431" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_87">
      <g id="line2d_128">
       <g>
-       <use xlink:href="#m46f50302b5" x="1129.239662" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1129.239662" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_88">
      <g id="line2d_129">
       <g>
-       <use xlink:href="#m46f50302b5" x="1160.806489" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1160.806489" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_89">
      <g id="line2d_130">
       <g>
-       <use xlink:href="#m46f50302b5" x="1176.835448" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1176.835448" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_90">
      <g id="line2d_131">
       <g>
-       <use xlink:href="#m46f50302b5" x="1188.208175" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1188.208175" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_91">
      <g id="line2d_132">
       <g>
-       <use xlink:href="#m46f50302b5" x="1197.029547" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1197.029547" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_92">
      <g id="line2d_133">
       <g>
-       <use xlink:href="#m46f50302b5" x="1204.237133" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1204.237133" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_93">
      <g id="line2d_134">
       <g>
-       <use xlink:href="#m46f50302b5" x="1210.331061" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1210.331061" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_94">
      <g id="line2d_135">
       <g>
-       <use xlink:href="#m46f50302b5" x="1215.60986" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1215.60986" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="xtick_95">
      <g id="line2d_136">
       <g>
-       <use xlink:href="#m46f50302b5" x="1220.266092" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m6055d84d65" x="1220.266092" y="331.524" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -2176,7 +2176,7 @@ z
     <g id="ytick_41">
      <g id="line2d_137">
       <g>
-       <use xlink:href="#m59ca688139" x="784.576688" y="271.772087" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="784.576688" y="271.772087" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_20">
@@ -2191,7 +2191,7 @@ z
     <g id="ytick_42">
      <g id="line2d_138">
       <g>
-       <use xlink:href="#m59ca688139" x="784.576688" y="206.524651" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="784.576688" y="206.524651" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_21">
@@ -2206,7 +2206,7 @@ z
     <g id="ytick_43">
      <g id="line2d_139">
       <g>
-       <use xlink:href="#m59ca688139" x="784.576688" y="141.277215" style="stroke: #000000; stroke-width: 0.8"/>
+       <use xlink:href="#mcd6de3f9e7" x="784.576688" y="141.277215" style="stroke: #000000; stroke-width: 0.8"/>
       </g>
      </g>
      <g id="text_22">
@@ -2221,217 +2221,217 @@ z
     <g id="ytick_44">
      <g id="line2d_140">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="317.378088" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="317.378088" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_45">
      <g id="line2d_141">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="305.888584" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="305.888584" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_46">
      <g id="line2d_142">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="297.736652" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="297.736652" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_47">
      <g id="line2d_143">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="291.413522" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="291.413522" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_48">
      <g id="line2d_144">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="286.247149" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="286.247149" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_49">
      <g id="line2d_145">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="281.879043" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="281.879043" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_50">
      <g id="line2d_146">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="278.095217" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="278.095217" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_51">
      <g id="line2d_147">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="274.757646" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="274.757646" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_52">
      <g id="line2d_148">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="252.130651" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="252.130651" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_53">
      <g id="line2d_149">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="240.641148" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="240.641148" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_54">
      <g id="line2d_150">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="232.489216" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="232.489216" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_55">
      <g id="line2d_151">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="226.166086" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="226.166086" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_56">
      <g id="line2d_152">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="220.999713" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="220.999713" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_57">
      <g id="line2d_153">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="216.631607" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="216.631607" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_58">
      <g id="line2d_154">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="212.847781" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="212.847781" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_59">
      <g id="line2d_155">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="209.51021" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="209.51021" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_60">
      <g id="line2d_156">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="186.883215" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="186.883215" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_61">
      <g id="line2d_157">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="175.393712" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="175.393712" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_62">
      <g id="line2d_158">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="167.24178" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="167.24178" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_63">
      <g id="line2d_159">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="160.91865" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="160.91865" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_64">
      <g id="line2d_160">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="155.752277" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="155.752277" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_65">
      <g id="line2d_161">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="151.38417" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="151.38417" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_66">
      <g id="line2d_162">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="147.600345" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="147.600345" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_67">
      <g id="line2d_163">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="144.262774" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="144.262774" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_68">
      <g id="line2d_164">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="121.635779" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="121.635779" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_69">
      <g id="line2d_165">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="110.146276" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="110.146276" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_70">
      <g id="line2d_166">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="101.994344" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="101.994344" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_71">
      <g id="line2d_167">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="95.671214" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="95.671214" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_72">
      <g id="line2d_168">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="90.504841" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="90.504841" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_73">
      <g id="line2d_169">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="86.136734" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="86.136734" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
     <g id="ytick_74">
      <g id="line2d_170">
       <g>
-       <use xlink:href="#m84a11e1b90" x="784.576688" y="82.352908" style="stroke: #000000; stroke-width: 0.6"/>
+       <use xlink:href="#m1a88b992c7" x="784.576688" y="82.352908" style="stroke: #000000; stroke-width: 0.6"/>
       </g>
      </g>
     </g>
@@ -2585,7 +2585,7 @@ L 1172.067478 115.703823
 L 1189.522089 105.500132 
 L 1206.976682 99.161262 
 L 1224.431233 93.384 
-" clip-path="url(#p0e9f254d10)" style="fill: none; stroke: #1f77b4; stroke-width: 4; stroke-linecap: square"/>
+" clip-path="url(#p77f3d605a2)" style="fill: none; stroke: #1f77b4; stroke-width: 4; stroke-linecap: square"/>
    </g>
    <g id="patch_6">
     <path d="M 784.576688 331.524 
@@ -2743,10 +2743,10 @@ z
   </g>
  </g>
  <defs>
-  <clipPath id="p006a53974d">
+  <clipPath id="p9053ecc8f5">
    <rect x="93.376688" y="82.044" width="460.8" height="249.48"/>
   </clipPath>
-  <clipPath id="p0e9f254d10">
+  <clipPath id="p77f3d605a2">
    <rect x="784.576688" y="82.044" width="460.8" height="249.48"/>
   </clipPath>
  </defs>
diff --git a/args.html b/args.html
index 5c10cd5..e4d2ee9 100644
--- a/args.html
+++ b/args.html
@@ -655,7 +655,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
 
 .saving .message {
     display: none;
-}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_9443570440'class='d3arg' style='min-width:540px; min-height:455px;'></div><script>var line = d3.line();
+}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_7797219935'class='d3arg' style='min-width:540px; min-height:455px;'></div><script>var line = d3.line();
 var step = d3.line().curve(d3.curveStep);
 var stepAfter = d3.line().curve(d3.curveStepAfter);
 var stepBefore = d3.line().curve(d3.curveStepBefore);
@@ -667,14 +667,14 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
     var subset = [0, 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16];
     var evenly_distributed_positions = [100.0, 170.0, 240.0, 310.0, 380.0, 450.0];
 
-    var dashboard = d3.select("#arg_9443570440").append("div").attr("class", "dashboard");
+    var dashboard = d3.select("#arg_7797219935").append("div").attr("class", "dashboard");
     
     var clipboard = dashboard.append("button")
         .on("click", function() {
             navigator.clipboard.writeText("{'arg': {'nodes': [{'id': 0, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '0', 'fx': 100.0, 'fy': 250.0, 'y': 250.0}, {'id': 1, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [6], 'parent_of': [], 'label': '1', 'fx': 240.0, 'fy': 250.0, 'y': 250.0}, {'id': 2, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '2', 'fx': 170.0, 'fy': 250.0, 'y': 250.0}, {'id': 3, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [6], 'parent_of': [], 'label': '3', 'fx': 310.0, 'fy': 250.0, 'y': 250.0}, {'id': 4, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [10], 'parent_of': [], 'label': '4', 'fx': 450.0, 'fy': 250.0, 'y': 250.0}, {'id': 5, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [7], 'parent_of': [], 'label': '5', 'fx': 380.0, 'fy': 250.0, 'y': 250.0}, {'id': 6, 'flag': 0, 'time': 56.0454802286223, 'time_01': 0.9594597716363211, 'logtime_01': 0.4408104125482307, 'rank_01': 0.8888888888888888, 'child_of': [9], 'parent_of': [1, 3], 'label': '6', 'x': 275.0, 'fy': 227.77777777777777, 'y': 227.77777777777777}, {'id': 7, 'flag': 131072, 'time': 59.45059299910596, 'time_01': 0.9569966997033771, 'logtime_01': 0.4327931901064175, 'rank_01': 0.7777777777777778, 'child_of': [10], 'parent_of': [5], 'x_pos_reference': 5, 'label': '7/8', 'x': 275.0, 'fy': 205.55555555555557, 'y': 205.55555555555557}, {'id': 9, 'flag': 0, 'time': 120.7850821708138, 'time_01': 0.9126306921779251, 'logtime_01': 0.3359364561713586, 'rank_01': 0.6666666666666667, 'child_of': [12], 'parent_of': [6, 7], 'label': '9', 'x': 275.0, 'fy': 183.33333333333334, 'y': 183.33333333333334}, {'id': 10, 'flag': 0, 'time': 142.86643656492956, 'time_01': 0.8966582507595428, 'logtime_01': 0.31289495466312167, 'rank_01': 0.5555555555555556, 'child_of': [12], 'parent_of': [4, 7], 'label': '10', 'x': 275.0, 'fy': 161.11111111111111, 'y': 161.11111111111111}, {'id': 11, 'flag': 0, 'time': 236.7237255340037, 'time_01': 0.8287670325403284, 'logtime_01': 0.24344667636347894, 'rank_01': 0.4444444444444444, 'child_of': [15], 'parent_of': [0, 2], 'label': '11', 'x': 275.0, 'fy': 138.88888888888889, 'y': 138.88888888888889}, {'id': 12, 'flag': 0, 'time': 272.05118690557765, 'time_01': 0.8032130833963393, 'logtime_01': 0.22428775813629553, 'rank_01': 0.33333333333333337, 'child_of': [13], 'parent_of': [9, 10], 'label': '12', 'x': 275.0, 'fy': 116.66666666666667, 'y': 116.66666666666667}, {'id': 13, 'flag': 131072, 'time': 588.0902773240502, 'time_01': 0.574607728510451, 'logtime_01': 0.11796030426281645, 'rank_01': 0.22222222222222232, 'child_of': [16], 'parent_of': [12], 'x_pos_reference': 12, 'label': '13/14', 'x': 275.0, 'fy': 94.44444444444446, 'y': 94.44444444444446}, {'id': 15, 'flag': 0, 'time': 610.912738605865, 'time_01': 0.5580992109919682, 'logtime_01': 0.11270418970307061, 'rank_01': 0.11111111111111116, 'child_of': [16], 'parent_of': [11, 13], 'label': '15', 'x': 275.0, 'fy': 72.22222222222223, 'y': 72.22222222222223}, {'id': 16, 'flag': 0, 'time': 1382.4658244607965, 'time_01': 0.0, 'logtime_01': -9.998911688890999e-05, 'rank_01': 0.0, 'child_of': [], 'parent_of': [13, 15], 'label': '16', 'x': 275.0, 'fy': 50.0, 'y': 50.0}], 'links': [{'source': 11, 'target': 0, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 2, 'region_fraction': 1.0}, {'source': 6, 'target': 1, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 1.0}, {'source': 11, 'target': 2, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 0, 'region_fraction': 1.0}, {'source': 6, 'target': 3, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 1, 'region_fraction': 1.0}, {'source': 10, 'target': 4, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 7, 'region_fraction': 1.0}, {'source': 7, 'target': 5, 'bounds': '0.0-6516.940179280937 6516.940179280937-10000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 9, 'target': 6, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 7, 'region_fraction': 1.0}, {'source': 10, 'target': 7, 'bounds': '0.0-6516.940179280937', 'alt_parent': 9, 'alt_child': 4, 'region_fraction': 0.6516940179280937}, {'source': 9, 'target': 7, 'bounds': '6516.940179280937-10000.0', 'alt_parent': 10, 'alt_child': 6, 'region_fraction': 0.34830598207190633}, {'source': 12, 'target': 9, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 10, 'region_fraction': 1.0}, {'source': 12, 'target': 10, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 1.0}, {'source': 15, 'target': 11, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 13, 'region_fraction': 1.0}, {'source': 13, 'target': 12, 'bounds': '0.0-2601.014547981321 2601.014547981321-10000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 16, 'target': 13, 'bounds': '0.0-2601.014547981321', 'alt_parent': 15, 'alt_child': 15, 'region_fraction': 0.26010145479813207}, {'source': 15, 'target': 13, 'bounds': '2601.014547981321-10000.0', 'alt_parent': 16, 'alt_child': 11, 'region_fraction': 0.7398985452018679}, {'source': 16, 'target': 15, 'bounds': '0.0-2601.014547981321', 'alt_parent': '', 'alt_child': 13, 'region_fraction': 0.26010145479813207}], 'breakpoints': [{'start': 0, 'stop': 2601.014547981321, 'x_pos_01': 0.0, 'width_01': 0.26010145479813207, 'x_pos': 50.0, 'width': 117.04565465915942}, {'start': 2601.014547981321, 'stop': 6516.940179280937, 'x_pos_01': 0.26010145479813207, 'width_01': 0.3915925631299616, 'x_pos': 167.04565465915942, 'width': 176.21665340848273}, {'start': 6516.940179280937, 'stop': 10000.0, 'x_pos_01': 0.6516940179280937, 'width_01': 0.34830598207190633, 'x_pos': 343.26230806764215, 'width': 156.73769193235785}]}, 'width': 500, 'height': 375, 'y_axis': {'include_labels': 'true', 'ticks': [250.0, 227.77777777777777, 205.55555555555557, 183.33333333333334, 161.11111111111111, 138.88888888888889, 116.66666666666667, 94.44444444444446, 72.22222222222223, 50.0], 'text': [0, 56, 59, 121, 143, 237, 272, 588, 611, 1382], 'max_min': [250.0, 50.0], 'scale': 'rank'}, 'tree_highlighting': 'true', 'edge_type': 'ortho', 'variable_edge_width': 'false', 'subset_nodes': [0, 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16], 'include_node_labels': 'true', 'evenly_distributed_positions': [100.0, 170.0, 240.0, 310.0, 380.0, 450.0]}".replace(/'nodes': .*'links'/, "'nodes': " + JSON.stringify(graph.nodes) + ", 'links'").replaceAll("'", '"'));
-            d3.select("#arg_9443570440 .copymessage").style("visibility", "visible");
+            d3.select("#arg_7797219935 .copymessage").style("visibility", "visible");
             setTimeout( function() {
-                d3.select("#arg_9443570440 .copymessage").style("visibility", "hidden");
+                d3.select("#arg_7797219935 .copymessage").style("visibility", "hidden");
             }, 1000);
         });
     clipboard.append("svg") //<!--! Font Awesome Free 6.4.2 by @fontawesome - https://fontawesome.com License - https://fontawesome.com/license (Commercial License) Copyright 2023 Fonticons, Inc. -->
@@ -688,8 +688,8 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
     var reheat = dashboard.append("button")
         .on("click", function(event) {
             if (!event.active) simulation.alphaTarget(0.3).restart();       
-            var order = d3.selectAll("#arg_9443570440 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_9443570440 .node").classed("unfix", function(d) {
+            var order = d3.selectAll("#arg_7797219935 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_7797219935 .node").classed("unfix", function(d) {
                 if (d.flag != 1) {
                     delete d.fx;
                 } else {
@@ -706,8 +706,8 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
     
     var evenly_distribute = dashboard.append("button")
         .on("click", function() {
-            var order = d3.selectAll("#arg_9443570440 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_9443570440 .sample").classed("distribute", function(d) {
+            var order = d3.selectAll("#arg_7797219935 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_7797219935 .sample").classed("distribute", function(d) {
                 d.fx = evenly_distributed_positions[order.indexOf(d.id)];
             });
         });
@@ -718,7 +718,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
         .attr("d", "M504.3 273.6c4.9-4.5 7.7-10.9 7.7-17.6s-2.8-13-7.7-17.6l-112-104c-7-6.5-17.2-8.2-25.9-4.4s-14.4 12.5-14.4 22l0 56-192 0 0-56c0-9.5-5.7-18.2-14.4-22s-18.9-2.1-25.9 4.4l-112 104C2.8 243 0 249.3 0 256s2.8 13 7.7 17.6l112 104c7 6.5 17.2 8.2 25.9 4.4s14.4-12.5 14.4-22l0-56 192 0 0 56c0 9.5 5.7 18.2 14.4 22s18.9 2.1 25.9-4.4l112-104z")
     evenly_distribute.append("span").attr("class", "tip desc").text("Space Samples");
 
-    var svg = d3.select("#arg_9443570440").append("svg")
+    var svg = d3.select("#arg_7797219935").append("svg")
         .attr("width", 500)
         .attr("height", 375)
         .style("padding-top", "10px");
@@ -799,7 +799,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
                 d3.select(this)
                     .style('stroke', '#1eebb1')
                     .style("cursor", "pointer");
-                d3.select("#arg_9443570440 .breakpoints")
+                d3.select("#arg_7797219935 .breakpoints")
                     .selectAll("rect")
                         .filter(function(j) {
                             return d.bounds.split(" ").some(function(region) {
@@ -813,7 +813,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
                 d3.select(this)
                     .style('stroke', '#053e4e')
                     .style("cursor", "default")
-                d3.select("#arg_9443570440 .breakpoints").selectAll("rect")
+                d3.select("#arg_7797219935 .breakpoints").selectAll("rect")
                     .style("fill", "#053e4e")
             });
     }
@@ -826,7 +826,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
         .enter()
         .append("circle")
         .attr("id", function(d) {
-            return String(9443570440) + "_node" + d.id
+            return String(7797219935) + "_node" + d.id
         })
         .attr("class", function(d) {
             var classy = ""
@@ -887,7 +887,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
         if ("y_axis.scale" == "time" | "y_axis.scale" == "log_time") {
             vnub = 0;
         }
-        var alt_child = document.getElementById(String(9443570440) + "_node" + d.alt_child);
+        var alt_child = document.getElementById(String(7797219935) + "_node" + d.alt_child);
         if (alt_child != null) {
             var alt_child_x = alt_child.getAttribute("cx");
             var alt_child_y = alt_child.getAttribute("cy");
@@ -954,7 +954,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
                 }
             }
         }
-        var alt_parent = document.getElementById(String(9443570440) + "_node" + d.alt_parent);
+        var alt_parent = document.getElementById(String(7797219935) + "_node" + d.alt_parent);
         if (alt_parent != null) {
             var alt_parent_x = alt_parent.getAttribute("cx");
             var alt_parent_y = alt_parent.getAttribute("cy");
@@ -1133,7 +1133,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
             if (d.flag == 131072 || d.parent_of.length == 0 || d.child_of.length == 0) {
                 return "c";
             } else if (d.child_of.length == 1) {
-                var parent = document.getElementById(String(9443570440) + "_node" + d.child_of[0])
+                var parent = document.getElementById(String(7797219935) + "_node" + d.child_of[0])
                 if (parent != null) {
                     var parent_x = parent.getAttribute("cx");
                     if (parent_x > d.x) {
@@ -1223,7 +1223,7 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
                 d3.select(this)
                     .style('fill', '#1eebb1')
                     .style("cursor", "pointer");
-                var highlight_links = d3.select("#arg_9443570440 .links")
+                var highlight_links = d3.select("#arg_7797219935 .links")
                     .selectAll("g")
                         .filter(function(j) {
                             return j.bounds.split(" ").some(function(region) {
@@ -1248,10 +1248,10 @@ <h3>Visualization<a class="headerlink" href="#visualization" title="Permalink to
                     .style('fill', '#053e4e')
                     .style("cursor", "default");
                 //if (false) {
-                    d3.selectAll("#arg_9443570440 .link")
+                    d3.selectAll("#arg_7797219935 .link")
                         .style("stroke", "#053e4e");
                 //} else {
-                //    d3.selectAll("#arg_9443570440 .link")
+                //    d3.selectAll("#arg_7797219935 .link")
                 //        .style("stroke", "#053e4e")
                 //        .style("stroke-width", 3);
                 //};     
@@ -1567,7 +1567,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
 
 .saving .message {
     display: none;
-}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_6775182330'class='d3arg' style='min-width:540px; min-height:455px;'></div><script>var line = d3.line();
+}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_8053438747'class='d3arg' style='min-width:540px; min-height:455px;'></div><script>var line = d3.line();
 var step = d3.line().curve(d3.curveStep);
 var stepAfter = d3.line().curve(d3.curveStepAfter);
 var stepBefore = d3.line().curve(d3.curveStepBefore);
@@ -1579,14 +1579,14 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
     var subset = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12];
     var evenly_distributed_positions = [100.0, 170.0, 240.0, 310.0, 380.0, 450.0];
 
-    var dashboard = d3.select("#arg_6775182330").append("div").attr("class", "dashboard");
+    var dashboard = d3.select("#arg_8053438747").append("div").attr("class", "dashboard");
     
     var clipboard = dashboard.append("button")
         .on("click", function() {
             navigator.clipboard.writeText("{'arg': {'nodes': [{'id': 0, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '0', 'fx': 100.0, 'fy': 250.0, 'y': 250.0}, {'id': 1, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [6], 'parent_of': [], 'label': '1', 'fx': 240.0, 'fy': 250.0, 'y': 250.0}, {'id': 2, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '2', 'fx': 170.0, 'fy': 250.0, 'y': 250.0}, {'id': 3, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [6], 'parent_of': [], 'label': '3', 'fx': 310.0, 'fy': 250.0, 'y': 250.0}, {'id': 4, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [8, 10], 'parent_of': [], 'label': '4', 'fx': 450.0, 'fy': 250.0, 'y': 250.0}, {'id': 5, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [7, 8], 'parent_of': [], 'label': '5', 'fx': 380.0, 'fy': 250.0, 'y': 250.0}, {'id': 6, 'flag': 0, 'time': 56.0454802286223, 'time_01': 0.9594597716363211, 'logtime_01': 0.4408104125482307, 'rank_01': 0.8571428571428572, 'child_of': [7, 10], 'parent_of': [1, 3], 'label': '6', 'x': 275.0, 'fy': 221.42857142857144, 'y': 221.42857142857144}, {'id': 7, 'flag': 0, 'time': 120.7850821708138, 'time_01': 0.9126306921779251, 'logtime_01': 0.3359364561713586, 'rank_01': 0.7142857142857143, 'child_of': [10], 'parent_of': [5, 6], 'label': '7', 'x': 275.0, 'fy': 192.85714285714286, 'y': 192.85714285714286}, {'id': 8, 'flag': 0, 'time': 142.86643656492956, 'time_01': 0.8966582507595428, 'logtime_01': 0.31289495466312167, 'rank_01': 0.5714285714285714, 'child_of': [10], 'parent_of': [4, 5], 'label': '8', 'x': 275.0, 'fy': 164.28571428571428, 'y': 164.28571428571428}, {'id': 9, 'flag': 0, 'time': 236.7237255340037, 'time_01': 0.8287670325403284, 'logtime_01': 0.24344667636347894, 'rank_01': 0.4285714285714286, 'child_of': [11, 12], 'parent_of': [0, 2], 'label': '9', 'x': 275.0, 'fy': 135.71428571428572, 'y': 135.71428571428572}, {'id': 10, 'flag': 0, 'time': 272.05118690557765, 'time_01': 0.8032130833963393, 'logtime_01': 0.22428775813629553, 'rank_01': 0.2857142857142858, 'child_of': [11, 12], 'parent_of': [4, 6, 7, 8], 'label': '10', 'x': 275.0, 'fy': 107.14285714285717, 'y': 107.14285714285717}, {'id': 11, 'flag': 0, 'time': 610.912738605865, 'time_01': 0.5580992109919682, 'logtime_01': 0.11270418970307061, 'rank_01': 0.1428571428571429, 'child_of': [], 'parent_of': [9, 10], 'label': '11', 'x': 275.0, 'fy': 78.57142857142858, 'y': 78.57142857142858}, {'id': 12, 'flag': 0, 'time': 1382.4658244607965, 'time_01': 0.0, 'logtime_01': -9.998911688890999e-05, 'rank_01': 0.0, 'child_of': [], 'parent_of': [9, 10], 'label': '12', 'x': 275.0, 'fy': 50.0, 'y': 50.0}], 'links': [{'source': 9, 'target': 0, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 2, 'region_fraction': 1.0}, {'source': 6, 'target': 1, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 1.0}, {'source': 9, 'target': 2, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 0, 'region_fraction': 1.0}, {'source': 6, 'target': 3, 'bounds': '0.0-10000.0', 'alt_parent': '', 'alt_child': 1, 'region_fraction': 1.0}, {'source': 8, 'target': 4, 'bounds': '0.0-6516.940179280937', 'alt_parent': '', 'alt_child': 5, 'region_fraction': 0.6516940179280937}, {'source': 10, 'target': 4, 'bounds': '6516.940179280937-10000.0', 'alt_parent': '', 'alt_child': 6, 'region_fraction': 0.34830598207190633}, {'source': 7, 'target': 5, 'bounds': '6516.940179280937-10000.0', 'alt_parent': '', 'alt_child': 6, 'region_fraction': 0.34830598207190633}, {'source': 8, 'target': 5, 'bounds': '0.0-6516.940179280937', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 0.6516940179280937}, {'source': 7, 'target': 6, 'bounds': '6516.940179280937-10000.0', 'alt_parent': '', 'alt_child': 5, 'region_fraction': 0.34830598207190633}, {'source': 10, 'target': 6, 'bounds': '0.0-6516.940179280937', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 0.6516940179280937}, {'source': 10, 'target': 7, 'bounds': '6516.940179280937-10000.0', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 0.34830598207190633}, {'source': 10, 'target': 8, 'bounds': '0.0-6516.940179280937', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 0.6516940179280937}, {'source': 11, 'target': 9, 'bounds': '2601.014547981321-10000.0', 'alt_parent': '', 'alt_child': 10, 'region_fraction': 0.7398985452018679}, {'source': 12, 'target': 9, 'bounds': '0.0-2601.014547981321', 'alt_parent': '', 'alt_child': 10, 'region_fraction': 0.26010145479813207}, {'source': 11, 'target': 10, 'bounds': '2601.014547981321-10000.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.7398985452018679}, {'source': 12, 'target': 10, 'bounds': '0.0-2601.014547981321', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.26010145479813207}], 'breakpoints': [{'start': 0, 'stop': 2601.014547981321, 'x_pos_01': 0.0, 'width_01': 0.26010145479813207, 'x_pos': 50.0, 'width': 117.04565465915942}, {'start': 2601.014547981321, 'stop': 6516.940179280937, 'x_pos_01': 0.26010145479813207, 'width_01': 0.3915925631299616, 'x_pos': 167.04565465915942, 'width': 176.21665340848273}, {'start': 6516.940179280937, 'stop': 10000.0, 'x_pos_01': 0.6516940179280937, 'width_01': 0.34830598207190633, 'x_pos': 343.26230806764215, 'width': 156.73769193235785}]}, 'width': 500, 'height': 375, 'y_axis': {'include_labels': 'true', 'ticks': [250.0, 221.42857142857144, 192.85714285714286, 164.28571428571428, 135.71428571428572, 107.14285714285717, 78.57142857142858, 50.0], 'text': [0, 56, 121, 143, 237, 272, 611, 1382], 'max_min': [250.0, 50.0], 'scale': 'rank'}, 'tree_highlighting': 'true', 'edge_type': 'line', 'variable_edge_width': 'false', 'subset_nodes': [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12], 'include_node_labels': 'true', 'evenly_distributed_positions': [100.0, 170.0, 240.0, 310.0, 380.0, 450.0]}".replace(/'nodes': .*'links'/, "'nodes': " + JSON.stringify(graph.nodes) + ", 'links'").replaceAll("'", '"'));
-            d3.select("#arg_6775182330 .copymessage").style("visibility", "visible");
+            d3.select("#arg_8053438747 .copymessage").style("visibility", "visible");
             setTimeout( function() {
-                d3.select("#arg_6775182330 .copymessage").style("visibility", "hidden");
+                d3.select("#arg_8053438747 .copymessage").style("visibility", "hidden");
             }, 1000);
         });
     clipboard.append("svg") //<!--! Font Awesome Free 6.4.2 by @fontawesome - https://fontawesome.com License - https://fontawesome.com/license (Commercial License) Copyright 2023 Fonticons, Inc. -->
@@ -1600,8 +1600,8 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
     var reheat = dashboard.append("button")
         .on("click", function(event) {
             if (!event.active) simulation.alphaTarget(0.3).restart();       
-            var order = d3.selectAll("#arg_6775182330 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_6775182330 .node").classed("unfix", function(d) {
+            var order = d3.selectAll("#arg_8053438747 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_8053438747 .node").classed("unfix", function(d) {
                 if (d.flag != 1) {
                     delete d.fx;
                 } else {
@@ -1618,8 +1618,8 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
     
     var evenly_distribute = dashboard.append("button")
         .on("click", function() {
-            var order = d3.selectAll("#arg_6775182330 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_6775182330 .sample").classed("distribute", function(d) {
+            var order = d3.selectAll("#arg_8053438747 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_8053438747 .sample").classed("distribute", function(d) {
                 d.fx = evenly_distributed_positions[order.indexOf(d.id)];
             });
         });
@@ -1630,7 +1630,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
         .attr("d", "M504.3 273.6c4.9-4.5 7.7-10.9 7.7-17.6s-2.8-13-7.7-17.6l-112-104c-7-6.5-17.2-8.2-25.9-4.4s-14.4 12.5-14.4 22l0 56-192 0 0-56c0-9.5-5.7-18.2-14.4-22s-18.9-2.1-25.9 4.4l-112 104C2.8 243 0 249.3 0 256s2.8 13 7.7 17.6l112 104c7 6.5 17.2 8.2 25.9 4.4s14.4-12.5 14.4-22l0-56 192 0 0 56c0 9.5 5.7 18.2 14.4 22s18.9 2.1 25.9-4.4l112-104z")
     evenly_distribute.append("span").attr("class", "tip desc").text("Space Samples");
 
-    var svg = d3.select("#arg_6775182330").append("svg")
+    var svg = d3.select("#arg_8053438747").append("svg")
         .attr("width", 500)
         .attr("height", 375)
         .style("padding-top", "10px");
@@ -1711,7 +1711,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
                 d3.select(this)
                     .style('stroke', '#1eebb1')
                     .style("cursor", "pointer");
-                d3.select("#arg_6775182330 .breakpoints")
+                d3.select("#arg_8053438747 .breakpoints")
                     .selectAll("rect")
                         .filter(function(j) {
                             return d.bounds.split(" ").some(function(region) {
@@ -1725,7 +1725,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
                 d3.select(this)
                     .style('stroke', '#053e4e')
                     .style("cursor", "default")
-                d3.select("#arg_6775182330 .breakpoints").selectAll("rect")
+                d3.select("#arg_8053438747 .breakpoints").selectAll("rect")
                     .style("fill", "#053e4e")
             });
     }
@@ -1738,7 +1738,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
         .enter()
         .append("circle")
         .attr("id", function(d) {
-            return String(6775182330) + "_node" + d.id
+            return String(8053438747) + "_node" + d.id
         })
         .attr("class", function(d) {
             var classy = ""
@@ -1799,7 +1799,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
         if ("y_axis.scale" == "time" | "y_axis.scale" == "log_time") {
             vnub = 0;
         }
-        var alt_child = document.getElementById(String(6775182330) + "_node" + d.alt_child);
+        var alt_child = document.getElementById(String(8053438747) + "_node" + d.alt_child);
         if (alt_child != null) {
             var alt_child_x = alt_child.getAttribute("cx");
             var alt_child_y = alt_child.getAttribute("cy");
@@ -1866,7 +1866,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
                 }
             }
         }
-        var alt_parent = document.getElementById(String(6775182330) + "_node" + d.alt_parent);
+        var alt_parent = document.getElementById(String(8053438747) + "_node" + d.alt_parent);
         if (alt_parent != null) {
             var alt_parent_x = alt_parent.getAttribute("cx");
             var alt_parent_y = alt_parent.getAttribute("cy");
@@ -2045,7 +2045,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
             if (d.flag == 131072 || d.parent_of.length == 0 || d.child_of.length == 0) {
                 return "c";
             } else if (d.child_of.length == 1) {
-                var parent = document.getElementById(String(6775182330) + "_node" + d.child_of[0])
+                var parent = document.getElementById(String(8053438747) + "_node" + d.child_of[0])
                 if (parent != null) {
                     var parent_x = parent.getAttribute("cx");
                     if (parent_x > d.x) {
@@ -2135,7 +2135,7 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
                 d3.select(this)
                     .style('fill', '#1eebb1')
                     .style("cursor", "pointer");
-                var highlight_links = d3.select("#arg_6775182330 .links")
+                var highlight_links = d3.select("#arg_8053438747 .links")
                     .selectAll("g")
                         .filter(function(j) {
                             return j.bounds.split(" ").some(function(region) {
@@ -2160,10 +2160,10 @@ <h3>Local trees and arity<a class="headerlink" href="#local-trees-and-arity" tit
                     .style('fill', '#053e4e')
                     .style("cursor", "default");
                 //if (false) {
-                    d3.selectAll("#arg_6775182330 .link")
+                    d3.selectAll("#arg_8053438747 .link")
                         .style("stroke", "#053e4e");
                 //} else {
-                //    d3.selectAll("#arg_6775182330 .link")
+                //    d3.selectAll("#arg_8053438747 .link")
                 //        .style("stroke", "#053e4e")
                 //        .style("stroke-width", 3);
                 //};     
diff --git a/counting_topologies.html b/counting_topologies.html
index cbccf70..427c644 100644
--- a/counting_topologies.html
+++ b/counting_topologies.html
@@ -761,7 +761,7 @@ <h2>Methods over tree sequences<a class="headerlink" href="#methods-over-tree-se
   time=int(extended_GF.time.tail(1) + 1), rate=0
 </pre></div>
 </div>
-<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Simulated 446 African+European+Chinese trees, each with 6000 tips
+<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Simulated 500 African+European+Chinese trees, each with 6000 tips
 </pre></div>
 </div>
 </div>
@@ -792,7 +792,7 @@ <h2>Methods over tree sequences<a class="headerlink" href="#methods-over-tree-se
 </div>
 </div>
 <div class="cell_output docutils container">
-<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Counted 3568000000000 embedded topologies in 0:00:10.117067 seconds
+<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Counted 4000000000000 embedded topologies in 0:00:09.944453 seconds
 </pre></div>
 </div>
 </div>
@@ -823,7 +823,7 @@ <h2>Methods over tree sequences<a class="headerlink" href="#methods-over-tree-se
 </div>
 </details>
 <div class="cell_output docutils container">
-<img alt="_images/5c7ca8795484b0e3370e3576152acf98067bba9e82a93f8551a2b734ba3b641f.svg" src="_images/5c7ca8795484b0e3370e3576152acf98067bba9e82a93f8551a2b734ba3b641f.svg" /><img alt="_images/ad7b78c682857fa573641fef3ce2c9f0b6c0d2a174bb18f8c734ba48c26a3a26.svg" src="_images/ad7b78c682857fa573641fef3ce2c9f0b6c0d2a174bb18f8c734ba48c26a3a26.svg" /><img alt="_images/dd31b18d1cff85e83eacba5ebc5be4060b1d41e81847508924a3700363192b12.svg" src="_images/dd31b18d1cff85e83eacba5ebc5be4060b1d41e81847508924a3700363192b12.svg" /><img alt="_images/7fd92d9de365279cc468b6a1314425c44830ed1b57dcf8975978c186202526d1.svg" src="_images/7fd92d9de365279cc468b6a1314425c44830ed1b57dcf8975978c186202526d1.svg" /></div>
+<img alt="_images/5c7ca8795484b0e3370e3576152acf98067bba9e82a93f8551a2b734ba3b641f.svg" src="_images/5c7ca8795484b0e3370e3576152acf98067bba9e82a93f8551a2b734ba3b641f.svg" /><img alt="_images/28112c9a2b8621830393ff556580b2730dd9d8cafe05774d5b45a95aec5addc8.svg" src="_images/28112c9a2b8621830393ff556580b2730dd9d8cafe05774d5b45a95aec5addc8.svg" /><img alt="_images/17f4bc0031e15f516841db89056f81e68678814a7304c678002c457075111dff.svg" src="_images/17f4bc0031e15f516841db89056f81e68678814a7304c678002c457075111dff.svg" /><img alt="_images/21fd693d05896d8d3a71eb9d8c964cfbf531433d389df672bd5a526b37b35b05.svg" src="_images/21fd693d05896d8d3a71eb9d8c964cfbf531433d389df672bd5a526b37b35b05.svg" /></div>
 </div>
 <p>For an example with real data, see <a class="reference internal" href="popgen.html#sec-popgen-topological"><span class="std std-ref">Topological analysis</span></a>
 in the <a class="reference internal" href="popgen.html#sec-intro-popgen"><span class="std std-ref">Tskit for population genetics</span></a> tutorial.</p>
diff --git a/examples/my_tree_sequence.trees b/examples/my_tree_sequence.trees
index bb0745b..ef56adf 100644
Binary files a/examples/my_tree_sequence.trees and b/examples/my_tree_sequence.trees differ
diff --git a/forward_sims.html b/forward_sims.html
index 1e5ee7e..5b39ec5 100644
--- a/forward_sims.html
+++ b/forward_sims.html
@@ -818,7 +818,7 @@ <h3>Larger simulations<a class="headerlink" href="#larger-simulations" title="Pe
 <div class="cell_output docutils container">
 <div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Full tree sequence including dead lineages: 16.79 MB
 Tree sequence of current-day individuals: 0.05 MB, 113 trees.
-Simplification has reduced the size by a factor of 320.58
+Simplification has reduced the size by a factor of 320.57
 </pre></div>
 </div>
 </div>
diff --git a/getting_started.html b/getting_started.html
index 7910b8c..7ca4865 100644
--- a/getting_started.html
+++ b/getting_started.html
@@ -638,7 +638,7 @@ <h2> Contents </h2>
 </div>
 <div class="cell_output docutils container">
 <div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>All 11167 trees coalesced
-Checked in 0.00959992 secs
+Checked in 0.0101852 secs
 </pre></div>
 </div>
 </div>
diff --git a/phylogen.html b/phylogen.html
index ee8ffcc..2173494 100644
--- a/phylogen.html
+++ b/phylogen.html
@@ -411,10 +411,10 @@ <h2> Contents </h2>
 </div>
 </div>
 <div class="cell_output docutils container">
-<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Tree sequence takes up 129.70018100738525 Mb
+<div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Tree sequence takes up 129.70018196105957 Mb
 Generating a &#39;comb&#39; (pectinate) tree of 1000000 tips took:
-CPU times: user 3.64 s, sys: 120 ms, total: 3.76 s
-Wall time: 3.76 s
+CPU times: user 3.69 s, sys: 97.8 ms, total: 3.79 s
+Wall time: 3.79 s
 </pre></div>
 </div>
 </div>
@@ -439,8 +439,8 @@ <h2> Contents </h2>
 </div>
 <div class="cell_output docutils container">
 <div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>Postorder traversal through 1999999 nodes took:
-CPU times: user 276 ms, sys: 4.04 ms, total: 280 ms
-Wall time: 279 ms
+CPU times: user 274 ms, sys: 120 µs, total: 274 ms
+Wall time: 274 ms
 </pre></div>
 </div>
 </div>
@@ -456,8 +456,8 @@ <h2> Contents </h2>
 </div>
 <div class="cell_output docutils container">
 <div class="output stream highlight-myst-ansi notranslate"><div class="highlight"><pre><span></span>B1 balance index is 14.39272472286399. Calculation took:
-CPU times: user 9.57 ms, sys: 177 µs, total: 9.74 ms
-Wall time: 9.68 ms
+CPU times: user 9.74 ms, sys: 0 ns, total: 9.74 ms
+Wall time: 9.67 ms
 </pre></div>
 </div>
 </div>
diff --git a/searchindex.js b/searchindex.js
index 157180d..a2a2e29 100644
--- a/searchindex.js
+++ b/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"docnames": ["advanced_msprime", "analysing_tree_sequences", "analysing_trees", "args", "bottlenecks", "completing_forward_sims", "counting_topologies", "demography", "forward_sims", "getting_started", "incremental_algorithms", "intro", "introgression", "metadata", "more_forward_sims", "no_mutations", "parallelization", "phylogen", "popgen", "simplification", "simulation_overview", "tables_and_editing", "terminology_and_concepts", "tskitr", "tutorial_development", "viz", "what_is"], "filenames": ["advanced_msprime.md", "analysing_tree_sequences.md", "analysing_trees.md", "args.md", "bottlenecks.md", "completing_forward_sims.md", "counting_topologies.md", "demography.md", "forward_sims.md", "getting_started.md", "incremental_algorithms.md", "intro.md", "introgression.md", "metadata.md", "more_forward_sims.md", "no_mutations.md", "parallelization.md", "phylogen.md", "popgen.md", "simplification.md", "simulation_overview.md", "tables_and_editing.md", "terminology_and_concepts.md", "tskitr.md", "tutorial_development.md", "viz.md", "what_is.md"], "titles": ["Advanced <strong class=\"program\">msprime</strong> topics", "<em>Analysing tree sequences</em>", "Analysing trees", "ARGs as tree sequences", "Instantaneous Bottlenecks", "Completing forwards simulations", "Counting topologies", "Demography", "Building a forward simulator", "Getting started with <strong class=\"program\">tskit</strong>", "<em>Incremental algorithms</em>", "Welcome!", "Introgression", "Working with Metadata", "<em>Advanced forward simulations</em>", "Do you really need mutations?", "<em>Parallelization</em>", "<code class=\"docutils literal notranslate\"><span class=\"pre\">Tskit</span></code> for phylogenetics", "<code class=\"docutils literal notranslate\"><span class=\"pre\">Tskit</span></code> for population genetics", "<em>Simplification</em>", "Tree sequences and simulation", "Tables and editing", "Terminology &amp; concepts", "Tskit and R", "<em>Developing new tutorials</em>", "Visualization", "What is a tree sequence?"], "terms": {"These": [0, 3, 5, 6, 7, 9, 11, 12, 17, 18, 21, 25, 26], "ar": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 18, 20, 21, 22, 23, 26], "exampl": [0, 1, 2, 3, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 26], "how": [0, 1, 2, 3, 5, 7, 8, 9, 10, 12, 13, 15, 16, 20, 21, 23, 25], "do": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 17, 18, 20, 21, 22, 25, 26], "some": [0, 1, 2, 3, 4, 5, 7, 8, 9, 12, 13, 14, 15, 17, 21, 22, 23, 25, 26], "particular": [0, 1, 3, 7, 8, 9, 12, 17, 21, 22, 23, 25, 26], "thing": [0, 9, 12, 14, 22], "thi": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "chapter": 0, "broken": [0, 8], "down": [0, 2, 3, 8, 9, 12, 14, 18, 25, 26], "follow": [0, 1, 2, 3, 5, 7, 8, 9, 11, 12, 13, 15, 17, 20, 21, 23, 25, 26], "section": [0, 1, 3, 5, 6, 9, 12, 14, 17, 18, 21, 22, 25], "demographi": [0, 4, 6, 12, 15, 20, 25, 26], "instantan": 0, "bottleneck": [0, 7], "introgress": [0, 25], "For": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "discuss": [0, 11, 13, 14, 21, 22, 25, 26], "other": [0, 1, 2, 4, 6, 8, 9, 12, 14, 17, 18, 21, 22, 26], "you": [0, 1, 3, 5, 6, 7, 8, 9, 11, 13, 14, 17, 18, 20, 21, 22, 23, 25, 26], "might": [0, 2, 3, 6, 7, 8, 9, 12, 14, 15, 16, 17, 22, 25, 26], "also": [0, 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "want": [0, 1, 2, 3, 5, 6, 7, 8, 12, 13, 14, 17, 18, 20, 21, 22, 25, 26], "look": [0, 8, 9, 12, 14, 15, 17, 18, 20, 21, 22, 25, 26], "forum": [0, 11], "tutori": [1, 3, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 25, 26], "work": [1, 2, 4, 5, 7, 8, 9, 11, 12, 15, 16, 21, 23, 25], "progress": [1, 8, 11], "tskit": [1, 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 19, 21, 22, 25, 26], "provid": [1, 2, 5, 6, 7, 8, 9, 10, 11, 15, 16, 17, 18, 21, 22, 23, 25, 26], "an": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25], "extens": [1, 16, 17, 21, 25, 26], "flexibl": [1, 3, 17, 18, 25], "interfac": [1, 16, 21, 23, 25], "popul": [1, 3, 5, 6, 8, 9, 12, 13, 14, 15, 17, 20, 23, 25, 26], "genet": [1, 3, 5, 6, 8, 9, 11, 12, 20, 22, 23], "which": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 26], "document": [1, 5, 6, 8, 13, 21, 23, 25, 26], "detail": [1, 3, 5, 8, 9, 13, 14, 17, 20, 21, 22, 25, 26], "gener": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 22, 23, 25, 26], "offic": [1, 26], "aim": [1, 9, 11, 15], "give": [1, 2, 4, 6, 8, 9, 12, 15, 16, 17, 20, 21, 22, 25], "quick": [1, 9, 17, 25], "overview": [1, 17], "api": [1, 2, 7, 9, 13, 16, 17, 18, 21, 22], "us": [1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "them": [1, 2, 3, 7, 8, 9, 11, 12, 14, 15, 17, 20, 21, 22, 25, 26], "effect": [1, 3, 4, 7, 8, 9, 12, 14, 15, 16, 17, 22, 26], "first": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 21, 22, 23, 25, 26], "let": [1, 2, 6, 7, 8, 9, 23], "s": [1, 2, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "load": [1, 2, 9, 11, 13, 16, 18, 21, 22, 25, 26], "ha": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 15, 16, 17, 18, 21, 22, 23, 25, 26], "roughli": 1, "human": [1, 7, 8, 12, 15, 18, 22, 26], "paramet": [1, 2, 3, 4, 7, 8, 9, 12, 14, 15, 20, 23, 25], "10": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "thousand": [1, 9, 15, 18, 22], "sampl": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 18, 20, 21, 23, 26], "10mb": [1, 9], "chromosom": [1, 3, 5, 6, 7, 8, 9, 12, 18, 20, 21, 22, 26], "ts": [1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 23, 26], "data": [1, 3, 4, 6, 11, 12, 13, 15, 16, 18, 20, 22, 23, 25], "computing_statist": 1, "trees36599": 1, "length10000000": [1, 9], "0": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "time": [1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 21, 22, 23, 25, 26], "unitsunknown": [1, 17], "nodes10000": 1, "total": [1, 2, 4, 6, 7, 9, 12, 17, 22, 23], "size9": 1, "5": [1, 2, 3, 4, 5, 6, 7, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25, 26], "mib": [1, 9], "metadatano": [1, 7, 9, 17, 22, 23], "metadata": [1, 6, 7, 8, 9, 12, 14, 18, 22, 23, 25], "tabl": [1, 3, 5, 7, 8, 9, 12, 14, 17, 23, 25, 26], "row": [1, 7, 8, 9, 12, 13, 17, 18, 22, 23], "size": [1, 2, 3, 4, 6, 8, 9, 12, 14, 15, 17, 18, 20, 22, 23, 25, 26], "edg": [1, 2, 3, 5, 7, 8, 9, 14, 23, 25, 26], "157894": 1, "4": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25, 26], "8": [1, 2, 3, 4, 7, 9, 12, 15, 17, 18, 21, 22, 23, 25, 26], "individu": [1, 3, 5, 7, 8, 9, 11, 13, 14, 15, 17, 18, 23, 25], "24": [1, 2, 9, 15, 17, 18], "byte": [1, 7, 9, 13, 17, 21, 22, 23], "migrat": [1, 9, 12, 17, 18, 21, 22, 23, 26], "mutat": [1, 2, 3, 4, 7, 8, 17, 20, 23, 26], "38778": 1, "1": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "node": [1, 2, 4, 5, 6, 7, 9, 12, 14, 18, 23, 26], "44864": 1, "2": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "16": [1, 2, 5, 7, 8, 9, 17, 18, 22, 23, 25], "proven": [1, 7, 9, 13, 17, 21, 23], "kib": [1, 7, 9, 22, 23], "site": [1, 2, 3, 6, 7, 11, 12, 13, 14, 15, 17, 18, 23, 25, 26], "946": 1, "7": [1, 2, 3, 5, 7, 8, 9, 12, 14, 15, 17, 18, 22, 23, 25, 26], "36": [1, 9, 17], "6": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 17, 18, 21, 22, 23, 25, 26], "39": [1, 2, 9, 12, 17, 18], "segreg": 1, "we": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "d": [1, 3, 4, 15, 17, 18, 21, 25, 26], "now": [1, 2, 5, 6, 7, 8, 9, 12, 13, 14, 18, 21, 23, 26], "like": [1, 3, 4, 6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 25, 26], "dataset": [1, 12, 16, 17, 18, 20, 22, 25, 26], "refer": [1, 3, 5, 8, 9, 12, 14, 17, 21, 22, 26], "defin": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 15, 17, 18, 21, 22, 23, 25, 26], "respect": [1, 5, 8, 14, 17, 21, 25], "singl": [1, 2, 3, 4, 6, 7, 8, 9, 12, 16, 17, 18, 21, 22, 23, 25, 26], "set": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 22, 23, 25, 26], "one": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 16, 17, 21, 22, 23, 25, 26], "divers": [1, 4, 8, 9, 12, 15, 18, 23, 25], "treesequ": [1, 3, 6, 8, 9, 10, 13, 17, 18, 21, 22, 23, 25], "method": [1, 2, 3, 5, 7, 8, 9, 10, 15, 18, 20, 21, 22, 25, 26], "print": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "averag": [1, 6, 9, 12, 15], "per": [1, 3, 5, 7, 8, 9, 14, 25], "unit": [1, 4, 8, 12, 17, 23], "3g": 1, "tell": [1, 3, 15, 22, 25], "across": [1, 15, 16, 17, 21, 22, 25], "whole": [1, 4, 12, 18, 22, 26], "return": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 21, 22, 23, 25], "number": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "ll": [1, 2, 7, 8, 9, 13, 21, 22, 23], "usual": [1, 5, 8, 9, 12, 15, 18, 22], "window": [1, 3, 15, 17, 18, 25], "along": [1, 2, 3, 8, 9, 14, 15, 17, 18, 21, 22, 25, 26], "genom": [1, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 18, 20, 21, 23, 25, 26], "argument": [1, 5, 7, 25], "np": [1, 3, 4, 5, 7, 8, 9, 12, 14, 15, 21, 25, 26], "linspac": [1, 9, 15], "sequence_length": [1, 3, 6, 7, 8, 9, 12, 13, 14, 15, 18, 21, 22, 23, 25], "num": [1, 9, 15], "sep": 1, "n": [1, 2, 3, 5, 6, 7, 8, 9, 13, 15, 18, 21, 22, 23, 25, 26], "2500000": 1, "5000000": 1, "7500000": 1, "10000000": [1, 9, 23], "00040717": 1, "00040891": 1, "00041644": 1, "00039899": 1, "The": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 21, 22, 23, 25, 26], "take": [1, 2, 3, 5, 6, 8, 9, 12, 15, 17, 20, 21, 22, 23, 25], "numpi": [1, 3, 4, 5, 7, 8, 9, 11, 12, 14, 15, 16, 17, 21, 25, 26], "arrai": [1, 2, 3, 4, 7, 8, 9, 12, 14, 15, 17, 21, 23, 25, 26], "specifi": [1, 2, 4, 6, 7, 8, 9, 13, 17, 20, 21, 22, 25], "breakpoint": [1, 3, 8, 14, 22, 26], "here": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "creat": [1, 2, 3, 5, 6, 7, 8, 9, 10, 13, 15, 17, 19, 21, 22, 25], "four": [1, 6, 21], "equal": [1, 4, 7, 8, 13, 14, 15, 21, 22], "space": [1, 6, 16, 20, 22, 25], "megabas": [1, 3, 15, 26], "contain": [1, 3, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25], "k": [1, 12, 25, 26], "element": [1, 6, 7, 17, 18, 21], "becaus": [1, 3, 5, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 25, 26], "have": [1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 18, 20, 21, 22, 25, 26], "ask": [1, 9, 12], "valu": [1, 2, 3, 4, 5, 6, 7, 9, 14, 17, 20, 21, 22, 25, 26], "rather": [1, 3, 5, 6, 8, 9, 12, 15, 16, 17, 21, 22, 25, 26], "than": [1, 2, 3, 6, 7, 8, 9, 12, 15, 16, 17, 21, 22, 23, 25, 26], "see": [1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26], "output": [1, 2, 3, 5, 7, 8, 9, 17, 18, 20, 25], "dimens": [1, 9, 21, 22], "full": [1, 8, 9, 13, 20, 21, 22, 25, 26], "descript": [1, 2, 5, 7, 9, 13, 21, 22], "determin": [1, 4, 21, 22], "suppos": [1, 7], "within": [1, 3, 8, 9, 11, 12, 14, 17, 18, 23, 26], "specif": [1, 2, 3, 7, 9, 17, 18, 20, 21, 22, 25, 26], "subset": [1, 6, 9, 12], "can": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "sample_set": [1, 6, 15, 18], "A": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23], "100": [1, 3, 5, 6, 7, 8, 12, 14, 15, 21, 22, 25], "00041007806060604034": 1, "ve": [1, 5, 7, 9, 12, 13, 14, 21, 25], "hundr": [1, 8, 26], "As": [1, 3, 5, 6, 7, 9, 11, 12, 15, 17, 18, 21, 25, 26], "ani": [1, 3, 4, 5, 6, 7, 8, 13, 14, 17, 21, 22, 25, 26], "again": [1, 2, 4, 6, 8, 9, 21], "multipl": [1, 3, 7, 8, 9, 10, 16, 18, 21, 22, 25, 26], "same": [1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 17, 21, 22, 25, 26], "list": [1, 2, 3, 6, 7, 8, 9, 11, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "b": [1, 4, 5, 6, 7, 13, 17, 21, 22, 23, 25, 26], "200": [1, 6, 7, 8, 9, 13, 14, 25], "c": [1, 2, 3, 4, 6, 8, 9, 11, 15, 16, 17, 18, 21, 23, 25, 26], "300": [1, 2, 3, 8, 12, 22, 25], "00041008": 1, "00040893": 1, "00040853": 1, "concurr": 1, "three": [1, 2, 3, 4, 6, 7, 12, 21, 22], "differ": [1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "therefor": [1, 3, 5, 6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 25], "In": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "input": [1, 2, 21], "rule": 1, "shape": [1, 9, 25], "3": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18, 21, 22, 23, 25], "00041199": 1, "00040542": 1, "00040588": 1, "00040889": 1, "00041216": 1, "00041419": 1, "00041636": 1, "00041463": 1, "0004128": 1, "00040307": 1, "0004035": 1, "00040126": 1, "our": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 21, 22, 23, 26], "2d": 1, "column": [1, 7, 8, 13, 18], "each": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "mani": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "compar": [1, 3, 5, 6, 12, 15, 20, 21, 22, 25, 26], "diverg": [1, 4, 7, 12, 15, 17], "between": [1, 3, 5, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 22, 23, 25, 26], "two": [1, 3, 4, 5, 6, 7, 8, 9, 12, 15, 17, 18, 20, 21, 22, 25], "0004059772800000012": 1, "float": [1, 22, 23, 25], "point": [1, 2, 3, 7, 8, 14, 15, 20, 21, 22, 23, 25], "result": [1, 2, 3, 4, 5, 8, 9, 11, 12, 14, 15, 17, 22, 25, 26], "befor": [1, 2, 3, 4, 6, 7, 8, 12, 14, 21], "00040787": 1, "00040481": 1, "00041219": 1, "00039904": 1, "power": [1, 4, 8, 9, 12, 15, 18, 23, 26], "featur": [1, 17, 25, 26], "stat": [1, 17, 18], "simultan": [1, 4], "index": [1, 4, 6, 9, 17, 21, 25], "00040598": 1, "00040943": 1, "pair": [1, 4, 8, 18, 22, 26], "interest": [1, 4, 7, 9, 12, 13, 15, 18, 22, 26], "combin": [1, 2, 3, 5, 6, 18, 20, 21, 22, 25, 26], "00040834": 1, "00041207": 1, "00041464": 1, "00040267": 1, "correspond": [1, 2, 3, 9, 15, 25, 26], "chosen": [1, 8, 9, 21, 25], "If": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 15, 18, 20, 21, 22, 23, 25, 26], "1d": 1, "interpret": [1, 3, 7, 13, 16, 22], "remov": [1, 5, 9, 12, 13, 16, 17, 18, 21, 23, 25], "empti": [1, 13, 17, 18, 21, 25], "outer": 1, "It": [1, 2, 3, 6, 7, 8, 9, 11, 14, 15, 17, 20, 21, 22, 23, 25, 26], "import": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "note": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 17, 18, 21, 22, 23, 25, 26], "don": [1, 2, 9, 12, 13, 22, 25, 26], "t": [1, 2, 3, 4, 5, 7, 8, 9, 12, 13, 15, 17, 21, 22, 23, 25, 26], "onli": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 21, 22, 23, 25, 26], "explicitli": [1, 15, 17, 25], "keep": [1, 3, 8, 14, 21, 22, 23, 25], "wish": [1, 3, 7, 8, 11, 16, 21, 26], "pleas": [1, 5, 11, 14], "spectrum": [1, 9, 15, 18], "fundament": [1, 3, 4, 9, 26], "tool": [1, 8, 9, 18, 21, 25], "approach": [1, 2, 4, 5, 10, 12, 15, 17, 20, 26], "simul": [1, 2, 3, 4, 6, 7, 9, 12, 15, 16, 17, 21, 22, 23, 25, 26], "from": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "ipython": [1, 4, 6, 25], "displai": [1, 3, 4, 6, 17, 18, 22, 23, 25], "draw_svg": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 17, 18, 21, 22, 23, 25, 26], "idpositionancestral_statemetadata": [1, 21], "00": [1, 3, 6, 13, 25], "300436430": 1, "322207940": 1, "20": [1, 2, 3, 4, 8, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25], "365070270": 1, "30": [1, 7, 8, 9, 12, 17, 18, 22, 25], "509402550": 1, "40": [1, 3, 8, 9, 17, 21, 25], "513271370": 1, "50": [1, 4, 7, 8, 12, 14, 17, 21, 23, 25], "514008610": 1, "60": [1, 3, 21, 25], "547961100": 1, "70": [1, 3, 7, 12, 22, 25], "759294040": 1, "80": [1, 3, 7, 23, 25], "805918000": 1, "90": [1, 3, 12, 23], "923242080": 1, "easi": [1, 7, 8, 17, 18, 21, 22, 25], "allele_frequency_spectrum": [1, 4, 9, 15, 18], "polaris": [1, 4, 9, 15], "true": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "span_normalis": [1, 4], "fals": [1, 3, 4, 8, 9, 13, 14, 21, 25], "singleton": [1, 4, 9, 21], "six": [1, 3, 22], "doubleton": [1, 4], "ton": 1, "doe": [1, 3, 4, 6, 7, 13, 16, 17, 22, 25], "below": [1, 2, 3, 4, 6, 7, 8, 9, 14, 15, 17, 18, 21, 22, 23, 25, 26], "why": [1, 2, 3, 7, 9, 16], "know": [1, 2, 5, 6, 7, 9, 12, 15, 17, 21, 22, 23, 25, 26], "ancestr": [1, 2, 3, 5, 7, 9, 11, 12, 17, 18, 21, 25, 26], "deriv": [1, 4, 7, 12, 18, 21], "state": [1, 2, 3, 7, 9, 21, 22, 25], "get": [1, 2, 5, 7, 8, 12, 13, 14, 16, 17, 18, 22, 23, 25, 26], "fold": [1, 9], "simpl": [1, 3, 4, 5, 7, 8, 9, 12, 13, 15, 16, 17, 18, 21, 25, 26], "count": [1, 8, 9, 12, 14, 17, 18, 23, 26], "default": [1, 2, 3, 5, 6, 7, 8, 9, 14, 15, 17, 21, 25, 26], "divid": [1, 7], "so": [1, 2, 3, 5, 6, 7, 8, 9, 12, 14, 15, 17, 21, 22, 23, 25, 26], "thei": [1, 2, 3, 4, 5, 6, 8, 12, 14, 17, 18, 21, 22, 25, 26], "actual": [1, 9, 12, 15, 20, 21, 22, 25, 26], "perform": [1, 2, 7, 9, 10, 13, 14, 15, 16, 17, 21, 25, 26], "half": [1, 17, 21], "abov": [1, 2, 3, 4, 5, 7, 8, 13, 14, 15, 17, 18, 21, 22, 25, 26], "tripleton": [1, 4], "node_colour": [1, 2, 25], "blue": [1, 2, 3, 4, 6, 7, 12, 25, 26], "green": [1, 2, 6, 7, 12, 18, 25], "style": [1, 2, 3, 6, 7, 12, 18, 22, 23, 26], "f": [1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "sym": [1, 2, 3, 6, 7, 12, 18, 25, 26], "fill": [1, 2, 3, 6, 7, 8, 12, 18, 21, 25, 26], "v": [1, 2, 3, 9, 12, 18, 21, 25], "item": [1, 2, 3, 4, 6, 7, 12, 18, 25], "join": [1, 2, 3, 5, 6, 7, 9, 12, 18, 25, 26], "mark": [1, 3, 9, 17, 21, 22, 25, 26], "either": [1, 3, 4, 6, 9, 12, 14, 21, 22, 23, 25], "imagin": [1, 8, 22, 26], "belong": [1, 7, 9, 17, 18, 21, 22, 25, 26], "base": [1, 3, 4, 5, 7, 9, 18, 22, 23, 26], "where": [1, 2, 5, 7, 8, 9, 12, 14, 17, 20, 21, 22, 25, 26], "both": [1, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 16, 17, 20, 21, 22, 25], "present": [1, 4, 5, 8, 15, 17, 21, 22, 25, 26], "up": [1, 2, 3, 7, 9, 12, 17, 21, 22, 25, 26], "summaris": [1, 25], "occur": [1, 8, 9, 12, 14, 17, 21, 22, 25, 26], "subtend": [1, 15, 25], "given": [1, 2, 3, 7, 9, 12, 14, 17, 21, 22, 23, 25], "mode": [1, 4, 9, 15, 17], "86089166": 1, "39638988": 1, "55239269": 1, "07444286": 1, "thu": [1, 2, 4, 12, 14, 22, 25], "over": [1, 2, 3, 5, 8, 9, 12, 14, 15, 16, 18, 21, 22, 23, 25, 26], "86": 1, "signific": 1, "when": [1, 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "all": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 21, 22, 23, 25, 26], "33184862": 1, "30022646": 1, "252042": 1, "25": [1, 4, 9, 12, 13, 14, 17, 18, 21, 25], "what": [1, 2, 3, 5, 8, 9, 11, 12, 14, 15, 17, 20, 21, 22, 25], "33": [1, 3, 9, 14, 17, 21, 25], "signifi": 1, "By": [1, 6, 7, 8, 9, 10, 12, 14, 15, 21, 25], "includ": [1, 3, 8, 9, 11, 12, 14, 15, 18, 20, 21, 22, 23, 25], "maintain": [1, 2], "properti": [1, 3, 5, 12, 13, 14, 22, 25], "sum": [1, 2, 4, 6, 12, 25], "alwai": [1, 2, 3, 6, 9, 15, 21, 22, 25], "len": [1, 2, 4, 6, 8, 9, 12, 14, 17, 21, 25], "total_branch_length": [1, 2], "14": [1, 3, 9, 14, 17, 18, 25], "884117086717392": 1, "884117086717396": 1, "similar": [1, 3, 4, 5, 6, 11, 12, 25, 26], "still": [1, 3, 5, 6, 8, 11, 14, 15, 23, 25], "polymorph": 1, "entir": [1, 5, 6, 8, 9, 13, 15, 16, 17, 18, 20, 21, 22, 25, 26], "howev": [1, 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 22, 23, 25, 26], "fix": [1, 6, 7], "among": [1, 21], "e": [1, 2, 3, 4, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "g": [1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "ones": [1, 3, 11, 21, 25], "root": [1, 3, 4, 6, 8, 9, 12, 23, 25], "There": [2, 3, 5, 6, 7, 9, 12, 17, 20, 21, 22, 26], "wai": [2, 3, 7, 8, 9, 11, 14, 15, 16, 17, 21, 22, 23, 25, 26], "most": [2, 3, 8, 9, 11, 12, 13, 15, 17, 21, 22, 25, 26], "involv": [2, 3, 6, 7, 8, 9, 12, 17, 20, 21, 22, 25, 26], "sort": [2, 3, 4, 5, 7, 8, 12, 14, 15, 17, 18, 26], "branch": [2, 3, 5, 6, 7, 8, 9, 17, 22, 25, 26], "variou": [2, 5, 9, 11, 17, 18, 21, 25], "through": [2, 3, 5, 9, 12, 14, 17, 21, 23, 25, 26], "built": [2, 3, 9, 17, 20, 21, 26], "phylogenet": [2, 23, 26], "map_mut": [2, 15, 21], "effic": [2, 8], "place": [2, 3, 12, 21, 22, 25, 26], "charact": 2, "terminolog": [2, 9, 12, 17, 26], "order": [2, 3, 5, 6, 7, 8, 9, 12, 17, 21, 22, 25, 26], "possibl": [2, 3, 5, 6, 9, 11, 14, 15, 18, 21, 22, 25, 26], "iter": [2, 3, 6, 8, 9, 14, 21, 22, 26], "tree_travers": 2, "visit": [2, 3, 18], "preorder": [2, 17], "inord": 2, "postord": [2, 17], "much": [2, 8, 9, 10, 11, 12, 21, 22, 23, 25, 26], "leav": [2, 6, 8, 12, 15, 17, 25], "out": [2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 20, 21, 23, 25, 26], "comput": [2, 5, 11, 12, 18, 20, 22, 23], "length": [2, 3, 6, 8, 9, 12, 14, 17, 21, 22, 23, 25, 26], "branch_length": [2, 4, 17], "u": [2, 3, 4, 5, 6, 7, 14, 17, 18, 25, 26], "avail": [2, 12, 17], "attribut": [2, 3, 9, 13, 21, 22, 25], "applic": 2, "abl": [2, 11, 14, 15], "parent": [2, 4, 8, 13, 14, 17, 21, 22, 25, 26], "path": [2, 3, 8, 14, 25], "while": [2, 3, 4, 5, 8, 12, 14, 15, 16, 20, 22, 25], "null": [2, 4, 9, 20, 21, 25], "append": [2, 8, 9, 12, 14, 21, 25], "sometim": [2, 3, 5, 15, 22, 25, 26], "need": [2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 17, 18, 20, 21, 22, 23, 25, 26], "about": [2, 3, 4, 7, 9, 11, 12, 15, 17, 18, 21, 22], "done": [2, 3, 5, 7, 8, 9, 11, 12, 13, 22, 23, 25], "recurs": [2, 4], "often": [2, 3, 8, 9, 14, 15, 16, 17, 20, 21, 22, 25, 26], "more": [2, 3, 4, 5, 6, 7, 9, 12, 13, 14, 15, 17, 20, 21, 22, 23, 24], "conveni": [2, 4, 6, 8, 17, 21, 22], "effici": [2, 3, 6, 8, 9, 10, 13, 17, 18, 20, 21, 22, 23], "yield": 2, "def": [2, 3, 4, 5, 6, 8, 12, 14, 15, 25], "preorder_dist": 2, "stack": [2, 21, 25], "pop": [2, 8, 12, 14, 18], "children": [2, 3, 6, 17, 22, 25], "network": [2, 17], "analysi": [2, 6, 8, 9, 13, 17, 22, 25], "sizeabl": 2, "librari": [2, 8, 9, 11, 16, 17, 18, 22, 25, 26], "achiev": [2, 17, 21], "call": [2, 3, 5, 6, 7, 9, 13, 14, 17, 18, 21, 22, 23, 25], "as_dict_of_dict": 2, "convert": [2, 3, 9, 21, 23], "instanc": [2, 5, 6, 7, 8, 9, 12, 13, 14, 17, 20, 21, 22, 23, 25], "format": [2, 11, 17, 18, 20, 21, 23, 26], "graph": [2, 11, 22, 26], "nx": [2, 3, 25], "digraph": [2, 3, 25], "revisit": 2, "depth": [2, 12], "search": [2, 3], "child": [2, 5, 6, 8, 14, 17, 21, 22, 25, 26], "_": [2, 5, 8, 14], "edge_df": 2, "sourc": [2, 3, 7, 9, 12, 25, 26], "orient": 2, "revers": [2, 3, 9, 12, 26], "similarli": [2, 9, 13, 18], "pre": [2, 11, 25], "well": [2, 3, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 21, 22, 25, 26], "run": [2, 5, 6, 7, 8, 9, 12, 14, 15, 20, 22, 23], "shortest_path_length": 2, "bit": [2, 9, 14, 15, 25], "instead": [2, 3, 5, 6, 8, 13, 17, 18, 21, 22, 25, 26], "write": [2, 9, 11, 13, 14], "own": [2, 8, 10, 11, 14, 17, 18, 22, 25], "code": [2, 3, 7, 8, 9, 14, 15, 16, 17, 21, 25, 26], "draw": [2, 3, 7, 9, 12, 17, 22, 23, 25], "start": [2, 4, 6, 7, 8, 11, 12, 14, 17, 18, 21, 22, 23, 25, 26], "were": [2, 22, 25, 26], "different_time_sampl": 2, "y_axi": [2, 3, 4, 6, 8, 12, 17, 18, 21, 22, 23, 25, 26], "time_scal": [2, 6, 12, 22, 25], "rank": [2, 6, 17, 25], "00539877826333": 2, "17": [2, 3, 5, 9, 17, 18, 25], "833492457579652": 2, "35": [2, 9, 14, 17], "apart": [2, 3, 20, 25], "even": [2, 3, 5, 8, 9, 14, 17, 20, 21, 22, 25, 26], "though": [2, 3, 8, 22], "almost": [2, 15], "closer": 2, "easier": [2, 8, 14, 21, 22, 25], "treat": [2, 3, 7, 9, 14, 22, 23, 25], "undirect": 2, "annot": [2, 3, 25], "0053987782633306836": 2, "1719063206836786": 2, "field": [2, 13, 17, 18, 21], "weight": [2, 6, 15, 25], "shortest": 2, "collect": [2, 12, 14, 18, 20, 21, 22, 25], "itertool": [2, 3], "dictionari": [2, 8], "repres": [2, 3, 5, 8, 9, 17, 21, 22, 25, 26], "matrix": [2, 7, 9, 23, 26], "dist_dod": 2, "defaultdict": [2, 12], "dict": [2, 3, 8, 13, 14, 18, 21, 25], "target": [2, 3, 25], "extract": [2, 7, 9, 12, 18, 21, 25], "nearest_neighbor_of": 2, "min": [2, 3, 18, 25], "kei": [2, 6, 8, 13, 14, 21], "rang": [2, 3, 4, 5, 6, 8, 9, 14, 15, 18, 20, 25, 26], "zip": [2, 6, 8, 12, 14, 17, 18, 21, 25, 26], "allel": [2, 3, 15, 18, 21, 22, 25, 26], "colour": [2, 3, 6, 7, 12, 18, 25, 26], "possess": [2, 9, 22], "posit": [2, 3, 8, 9, 12, 14, 15, 17, 18, 21, 22, 25, 26], "caus": [2, 5, 13, 22, 25], "variat": [2, 3, 4, 9, 12, 17, 20, 21, 26], "parsimony_simpl": 2, "red": [2, 3, 4, 6, 7, 12, 18, 21, 22, 25], "genotyp": [2, 3, 21, 23], "j": [2, 4, 5, 26], "enumer": [2, 3, 4, 9, 12, 15, 21, 26], "explan": [2, 7, 22, 25], "discret": [2, 4, 5, 7, 8, 22], "observ": [2, 3, 12, 15, 20, 21, 26], "classic": [2, 3, 9], "ancestral_st": [2, 9, 17, 21, 22, 25, 26], "mut": [2, 3, 12, 21, 22, 25, 26], "derived_st": [2, 17, 21, 22, 25, 26], "case": [2, 3, 5, 7, 8, 12, 14, 15, 17, 18, 21, 22, 23, 25], "conclud": 2, "quit": [2, 5, 6, 7, 9, 12, 14, 25], "reason": [2, 3, 5, 6, 7, 8, 16, 17, 20, 21, 22, 25], "wa": [2, 3, 5, 7, 8, 13, 15, 21, 22, 25, 26], "show": [2, 3, 4, 5, 7, 8, 9, 11, 12, 14, 15, 16, 18, 21, 22, 23, 25, 26], "updat": [2, 9, 16, 26], "advantag": [2, 5, 18, 25], "identifi": [2, 3, 6, 9, 12, 14, 17, 20, 21, 25], "pickl": [2, 16], "parsimony_map": 2, "500": [2, 3, 7, 8, 12, 14, 18, 21, 25, 26], "modifi": [2, 7, 8, 17, 21, 25], "ad": [2, 5, 7, 8, 12, 13, 14, 15, 20, 21, 22, 25], "To": [2, 3, 6, 7, 8, 9, 12, 13, 15, 17, 20, 21, 22, 23, 25], "locat": [2, 3, 7, 9, 13, 18, 21, 22, 25, 26], "infer": [2, 3, 4, 9, 15, 20, 22, 26], "associ": [2, 3, 6, 8, 13, 16, 17, 21, 22, 23, 25, 26], "convent": [2, 8, 9, 15, 21, 25], "encod": [2, 3, 13, 17, 18, 21, 22], "open": [2, 11, 25], "rb": 2, "file": [2, 9, 11, 13, 15, 17, 18, 21, 22, 23, 25, 26], "save": [2, 7, 8, 12, 26], "variant": [2, 3, 9, 18, 21, 26], "i": [2, 3, 4, 6, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "po": [2, 3, 9, 14, 25], "4f": 2, "anywai": 2, "dump_tabl": [2, 12, 17, 21, 25, 26], "site_id": [2, 21], "add_row": [2, 5, 8, 13, 14, 21], "info": [2, 9], "parent_offset": 2, "mut_id": 2, "new_t": [2, 9, 17], "tree_sequ": [2, 5, 6, 8, 12, 14, 17, 21, 25, 26], "3726": 2, "4759": 2, "34": [2, 9, 17], "3178": 2, "2118": 2, "44": [2, 12, 17], "0257": 2, "48": [2, 25], "0932": 2, "68": [2, 14, 17], "4830": 2, "69": [2, 25], "4755": 2, "71": [2, 21], "2330": 2, "9": [2, 3, 4, 5, 9, 12, 13, 15, 17, 18, 22, 23, 25, 26], "9150": 2, "And": [2, 7, 8, 9, 25], "mut_label": [2, 21, 25, 26], "label": [2, 3, 4, 7, 8, 12, 17, 18, 21, 22, 23, 26], "make": [2, 3, 7, 8, 9, 13, 14, 17, 20, 21, 25, 26], "pretti": [2, 7, 8, 21, 25, 26], "chang": [2, 3, 4, 6, 9, 13, 14, 17, 18, 21, 25, 26], "older_mut": [2, 21, 25, 26], "older": [2, 3, 21, 25, 26], "prev": [2, 21, 25, 26], "els": [2, 6, 8, 9, 17, 21, 25, 26], "id": [2, 3, 5, 6, 7, 9, 12, 13, 14, 15, 18, 21, 22, 26], "mutation_label": [2, 3, 21, 25, 26], "account": [2, 6, 9, 12, 15, 17, 20], "transit": [2, 21, 25], "special": [2, 7, 22, 25], "missing_data": [2, 21], "could": [2, 8, 14, 15, 17, 18, 21, 22, 25], "anyth": [2, 9], "indic": [2, 12, 21, 25, 26], "white": [2, 25], "appli": [2, 7, 8, 12, 17, 25], "hartigan": 2, "decid": 2, "would": [2, 5, 9, 11, 12, 14, 15, 17, 20, 21, 22], "imput": 2, "littl": [2, 3, 4, 6], "surpris": [2, 9], "consid": [2, 4, 10, 15, 17, 21], "msprime": [2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 15, 17, 18, 20, 21, 22, 23, 25], "random_se": [2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 21, 23, 25], "42": [2, 8, 14, 17, 21, 23, 25], "put": [2, 12, 14, 22, 25], "expect": [2, 3, 7, 8, 9, 12, 14, 15, 20, 21, 23, 25], "rememb": 2, "minimis": 2, "mai": [2, 3, 4, 5, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 25, 26], "add": [2, 3, 7, 8, 9, 13, 14, 15, 17, 20, 21, 23, 24, 25], "few": [2, 8, 12, 13, 15, 20, 22, 23, 25, 26], "speed": [2, 6, 17, 18, 22, 26], "dynam": [2, 26], "program": [2, 9, 11, 25, 26], "good": [2, 4, 7, 14, 15, 20, 25], "issu": [2, 10, 11, 12, 14, 16, 17, 19, 20, 25], "63": [2, 7, 18], "At": [3, 8, 9, 12, 21], "its": [3, 4, 8, 9, 13, 17, 18, 21, 22, 25], "heart": 3, "consist": [3, 6, 7, 8, 17, 21, 22, 25], "connect": [3, 8, 15, 21, 22, 25], "succinct": [3, 11, 17, 18, 26], "equival": [3, 6, 7, 8, 12, 17, 21, 23, 25], "direct": [3, 11, 13, 17, 22, 23, 25], "addition": [3, 9, 18, 21], "exist": [3, 5, 8, 9, 11, 12, 13, 15, 17, 18, 21, 22, 25, 26], "tightli": 3, "concept": [3, 8, 14, 17, 26], "preprint": 3, "further": [3, 7, 12, 14, 17, 21, 22, 25], "origin": [3, 5, 7, 9, 12, 13, 15, 21, 22, 25, 26], "narrow": 3, "definit": [3, 12, 17, 21, 25], "restrict": [3, 6], "term": [3, 6, 17, 22], "neutral": [3, 9, 14, 15, 20, 26], "coalesc": [3, 5, 7, 9, 12, 22, 25], "process": [3, 5, 8, 12, 15, 16, 22, 26], "crossov": [3, 8, 14], "structur": [3, 16, 17, 22, 26], "griffith": [3, 4], "marjoram": 3, "1997": 3, "describ": [3, 6, 8, 9, 14, 15, 18, 21, 22, 25, 26], "genealog": [3, 4, 8, 9, 11, 14, 18, 21, 22], "evolv": [3, 17], "via": [3, 7, 8, 9, 12, 13, 16, 17, 18, 21, 23, 25], "inherit": [3, 5, 17, 20, 21, 22, 25, 26], "just": [3, 7, 8, 11, 12, 13, 17, 21, 22, 25, 26], "addit": [3, 7, 11, 12, 13, 15, 17, 21, 25], "event": [3, 4, 5, 8, 9, 12, 21, 22, 25], "store": [3, 8, 11, 13, 14, 18, 21, 22, 23, 25, 26], "analys": [3, 7, 9, 15, 17, 18, 22, 26], "sim_ancestri": [3, 4, 5, 6, 7, 8, 9, 12, 15, 21, 23, 25], "record_full_arg": [3, 25], "option": [3, 8, 9, 12, 14, 15, 17, 21, 25], "doc": [3, 21, 25], "diploid": [3, 4, 5, 8, 9, 14, 15, 18, 21, 22], "1e4": [3, 15, 23, 25], "recombination_r": [3, 5, 7, 8, 9, 12, 14, 15, 21, 23, 25], "1e": [3, 7, 8, 9, 12, 15, 23, 25], "population_s": [3, 5, 7, 8, 9, 25], "1e3": [3, 21, 23], "333": 3, "ts_arg": 3, "discrete_genom": [3, 21], "nb": [3, 12, 17, 21, 25], "strict": [3, 8, 12, 25], "hudson": 3, "uniqu": [3, 8, 14, 22, 25], "continu": [3, 7, 8, 20, 26], "under": [3, 4, 9, 11, 12, 14, 17, 18, 20, 25, 26], "model": [3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 18, 20, 22, 25, 26], "num_nod": [3, 17, 22, 25, 26], "num_edg": [3, 22], "num_tre": [3, 6, 8, 9, 11, 21, 22, 23, 25], "18": [3, 4, 5, 9, 17, 18, 21], "mu": [3, 14, 15], "sim_mut": [3, 9, 12, 15, 17, 21, 23, 25], "rate": [3, 5, 6, 8, 9, 12, 14, 15, 17, 18, 20, 21, 23, 25], "888": [3, 13], "str": [3, 4, 6, 8, 13, 21, 22, 25], "variabl": [3, 14, 15, 17, 18, 22, 23, 25, 26], "record": [3, 4, 5, 7, 8, 12, 13, 14, 17, 21, 22], "gamet": [3, 14], "mean": [3, 4, 5, 6, 7, 8, 9, 14, 16, 17, 21, 22, 25], "captur": [3, 4, 8, 17], "transmiss": [3, 5, 8], "left": [3, 5, 8, 9, 12, 14, 17, 21, 22, 25, 26], "vs": [3, 14, 25], "right": [3, 5, 8, 9, 12, 14, 17, 18, 21, 22, 25, 26], "timepoint": 3, "node_is_re_ev": 3, "ortho": [3, 25], "viz": [3, 18, 25, 26], "separ": [3, 6, 7, 8, 9, 17, 21, 22, 26], "slash": 3, "normal": [3, 8, 15, 22, 25, 26], "plot": [3, 4, 6, 7, 8, 9, 12, 14, 15, 17, 18, 21, 22, 23, 26], "guarante": [3, 21], "split": [3, 12, 16, 22, 25, 26], "lineag": [3, 4, 7, 8, 12, 14, 15, 17, 22, 25], "common": [3, 4, 7, 8, 9, 15, 17, 21, 25, 26], "ancestor": [3, 7, 8, 9, 12, 15, 17, 21, 22, 25, 26], "Such": [3, 9, 15], "drawn": [3, 6, 7, 25], "horizont": [3, 25], "vertic": [3, 25], "line": [3, 8, 9, 13, 21, 22, 25], "tskit_arg_visualis": 3, "javascript": [3, 25], "requir": [3, 4, 5, 6, 8, 11, 13, 14, 15, 21, 22, 23, 25], "config": [3, 25], "d3": [3, 25], "http": [3, 5, 6, 11, 12, 17, 19, 25], "d3j": [3, 25], "org": [3, 5, 6, 12, 25], "v7": [3, 25], "function": [3, 4, 6, 8, 9, 12, 14, 15, 18, 20, 23, 25], "tskit_arg_visu": [3, 25], "d3arg": [3, 25], "from_t": [3, 25], "w": [3, 5, 6, 15, 25], "h": [3, 6, 9, 18, 21, 26], "450": 3, "width": [3, 6, 25, 26], "height": [3, 5, 6, 25], "edge_typ": [3, 25], "sample_ord": [3, 25], "unlabel": [3, 6], "occurr": 3, "re_nod": 3, "nd": [3, 25], "flag": [3, 6, 7, 8, 9, 13, 17, 21, 23, 25, 26], "ca_nod": 3, "arang": [3, 4, 5, 9, 15], "re_tim": 3, "int": [3, 5, 6, 8, 9, 12, 14, 18, 23, 25], "y": [3, 4, 12, 15, 25, 26], "axi": [3, 4, 6, 12, 21, 25, 26], "grid": [3, 4, 12, 25], "stroke": [3, 12, 18, 25, 26], "ff000033": 3, "goldenrod": 3, "600": [3, 8], "y_tick": [3, 8, 12, 18, 22, 23, 25, 26], "y_gridlin": [3, 12, 21, 22, 25], "node_label": [3, 6, 8, 12, 17, 18, 22, 25, 26], "descend": [3, 5, 15, 17, 22, 25, 26], "clear": [3, 6, 9, 12, 17, 21, 25], "seem": [3, 12, 14, 17], "unusu": [3, 9, 17, 22, 25], "affair": [3, 25], "represent": [3, 9, 13, 14, 17, 22, 23], "focu": [3, 8, 9, 15, 17, 23, 25], "ignor": [3, 4, 6, 22, 25], "inde": [3, 9, 12, 15, 21, 22, 25, 26], "simplifi": [3, 5, 6, 8, 9, 12, 14, 18, 21, 22, 23], "whose": [3, 6, 7, 8, 9, 21, 25], "tip": [3, 4, 6, 8, 9, 17, 22, 25, 26], "never": [3, 7], "compact": [3, 15], "omit": [3, 8, 15, 21, 25], "inform": [3, 4, 9, 12, 13, 15, 17, 21, 22, 25, 26], "topolog": [3, 4, 12, 17, 21, 22, 25, 26], "oper": [3, 17, 21, 22, 23, 25], "unari": [3, 5, 8, 25], "retain": [3, 5, 8, 15, 25], "precis": [3, 5, 9], "ensur": [3, 16, 17, 21], "edit": [3, 9, 13, 17, 22, 26], "subtre": [3, 5, 22], "prune": [3, 22, 25], "regraft": [3, 22, 25], "move": [3, 7, 9, 17, 22, 25, 26], "anoth": [3, 7, 8, 9, 17, 21, 22, 25, 26], "evolut": 3, "commonli": 3, "cwr": 3, "1983": 3, "impli": [3, 21], "happen": [3, 5, 7, 8, 12, 13, 22], "588": 3, "59": 3, "ago": [3, 4, 7, 8, 26], "13": [3, 9, 17, 18, 23, 25], "2601": 3, "01": [3, 7, 21, 25], "second": [3, 5, 6, 8, 12, 13, 15, 21, 22, 26], "onto": [3, 5, 7, 9, 12, 14, 15, 17, 22], "around": [3, 8], "simpli": [3, 6, 8, 11, 12, 15, 17, 18, 21, 22, 23, 25, 26], "ocur": 3, "6516": 3, "94": 3, "middl": [3, 9, 21, 25], "last": [3, 9, 12, 13, 21, 22, 25], "led": [3, 26], "closest": [3, 12], "rel": [3, 4, 8, 12, 13, 15, 25, 26], "000": [3, 4, 7, 9], "standard": [3, 9, 15, 17, 18, 22, 26], "larg": [3, 8, 9, 12, 16, 17, 18, 22, 25, 26], "log_arg_likelihood": 3, "log": [3, 9, 12, 15, 25], "ne": [3, 12, 25], "89": 3, "68606886284756": 3, "ti": 3, "allow": [3, 5, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 20, 21, 23, 25, 26], "diamond": 3, "trace": [3, 8], "directli": [3, 6, 8, 9, 12, 13, 14, 15, 21, 23, 25], "back": [3, 8, 9, 12, 13, 14, 17, 21, 25, 26], "fulli": [3, 5, 9, 22, 25], "remain": [3, 8, 15, 21, 26], "greater": [3, 15, 22], "lose": [3, 8], "non": [3, 4, 8, 12, 14, 21, 22, 25], "ancestri": [3, 5, 7, 8, 9, 12, 15, 17, 18, 20], "intact": 3, "been": [3, 4, 5, 8, 12, 14, 15, 16, 17, 18, 21, 22, 25, 26], "lost": 3, "reflect": [3, 8, 9, 25, 26], "recent": [3, 5, 8, 9, 12, 13, 15, 17, 21, 25, 26], "decend": [3, 25], "simultanous": 3, "unsuit": 3, "diagon": 3, "d3graph": 3, "produc": [3, 7, 8, 9, 15, 17, 18, 21, 22, 25, 26], "exact": [3, 5, 8, 22], "longer": [3, 6, 7, 8, 9, 12, 14, 21, 25, 26], "obviou": [3, 8, 9, 15], "cannot": [3, 8, 9, 14, 17, 21], "form": [3, 4, 7, 8, 11, 12, 17, 18, 20, 21, 25, 26], "pattern": [3, 6, 12, 20, 22, 26], "unchang": [3, 26], "after": [3, 8, 9, 15, 21, 23], "log_mutation_likelihood": 3, "mutation_r": [3, 6, 18], "204860594400216": 3, "main": [3, 14, 25, 26], "version": [3, 7, 9, 15, 25, 26], "firstli": [3, 12], "real": [3, 5, 6, 8, 12, 15, 22], "desir": [3, 8], "compat": 3, "secondli": [3, 12], "extra": [3, 8, 21, 25, 26], "fact": [3, 5, 6, 7, 8, 14, 21, 22, 23, 25, 26], "increas": [3, 4, 8, 12, 15, 21, 25], "come": [3, 10, 12, 21, 26], "domin": [3, 22, 25], "percentag": [3, 12], "large_sim_paramet": 3, "copi": [3, 5, 9, 13, 17, 21, 22], "1000": [3, 4, 6, 7, 8, 9, 12, 17, 22, 25, 26], "large_ts_arg": 3, "large_t": [3, 8], "2f": [3, 8, 12, 15], "1e6": 3, "num_sampl": [3, 4, 6, 9, 15, 18, 22, 23, 25], "99": [3, 25], "32": [3, 9, 17, 18, 23], "primari": [3, 12], "exclud": 3, "slim": [3, 5, 8, 9, 20], "relev": [3, 8, 18, 21, 26], "mathemat": 3, "formul": 3, "1991": 3, "lead": [3, 9, 17, 23, 25, 26], "vastli": 3, "larger": [3, 9, 12, 15, 21, 22, 26], "infeas": 3, "worth": [3, 14, 15, 17, 20, 21, 25, 26], "subtl": [3, 4, 14], "somewhat": [3, 15], "philosoph": 3, "taken": [3, 12, 22, 25], "region": [3, 8, 9, 12, 17, 18, 20, 21, 23, 25, 26], "contrast": [3, 15], "crucial": [3, 12], "interv": [3, 5, 8, 9, 12, 21, 25], "idleftrightparentchildmetadata": [3, 21], "0000000010000": 3, "0000000061": 3, "0000000063": 3, "000000006516": 3, "9401792875": 3, "36516": 3, "9401792810000": 3, "0000000085": 3, "0000000096": 3, "56516": 3, "0000000098": 3, "00000000104": 3, "94017928107": 3, "00000000110": 3, "00000000112": 3, "00000000129": 3, "110": [3, 9, 21], "000000001210": 3, "120": [3, 17, 21], "000000002601": 3, "014547981312": 3, "132601": 3, "0145479810000": 3, "000000001412": 3, "140": 3, "000000001511": 3, "152601": 3, "000000001514": 3, "160": [3, 6, 23], "014547981613": 3, "170": 3, "014547981615": 3, "technic": [3, 22], "garg": 3, "those": [3, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "gene": [3, 8, 18], "convers": [3, 8, 12, 25], "world": [3, 11], "inferr": 3, "viral": 3, "without": [3, 4, 5, 6, 12, 15, 16, 21, 22, 25, 26], "pin": 3, "exactli": [3, 8, 22, 25], "took": [3, 6, 17], "limit": [3, 9, 17, 25, 26], "acycl": 3, "although": [3, 4, 5, 6, 8, 9, 12, 15, 17, 21, 22, 25], "natur": [3, 15, 21], "pass": [3, 5, 7, 8, 9, 12, 13, 14, 16, 21, 23, 25], "regardless": [3, 6, 12, 26], "edge_diff": [3, 10, 25], "goe": 3, "match": [3, 8, 14, 25], "necessarili": [3, 15, 17, 21], "group": [3, 6, 7, 8, 12, 18, 25], "altern": [3, 4, 6, 8, 9, 21, 25], "top": [3, 5, 8, 13, 21, 25, 26], "bottom": [3, 8, 25], "strictli": [3, 8, 22, 26], "timeasc": [3, 17], "breadth": 3, "level": [3, 8, 13, 17, 25], "ineffici": [3, 6, 9, 12], "access": [3, 9, 13, 22, 23], "vice": [3, 7], "versa": [3, 7], "edges_by_parent_timeasc": 3, "groupbi": 3, "attrgett": 3, "parent_id": [3, 17, 25], "56": 3, "0454802286223": 3, "7850821708138": 3, "142": 3, "86643656492956": 3, "236": [3, 9], "7237255340037": 3, "272": [3, 17], "05118690557765": 3, "11": [3, 6, 8, 9, 13, 17, 18, 21, 22, 25], "610": 3, "912738605865": 3, "12": [3, 4, 6, 7, 8, 9, 12, 15, 17, 18, 22, 23, 25], "1382": 3, "4658244607965": 3, "termin": [3, 9, 22], "isol": [3, 8, 17, 18], "leaf": [3, 18, 22], "slower": 3, "edges_by_child_timeasc": 3, "lexsort": 3, "edges_child": [3, 25], "nodes_tim": [3, 17, 23], "child_id": [3, 8, 14, 17], "negat": [3, 25], "algorithm": [3, 5, 9, 14, 17, 18, 26], "theori": [3, 4, 8, 14], "help": [3, 7, 8, 9, 13, 14, 15, 21, 22, 23, 24, 25], "networkx": [3, 25], "panda": [3, 18, 25], "pd": [3, 18, 25], "to_networkx_graph": [3, 25], "interval_list": [3, 25], "intervals_list": [3, 25], "otherwis": [3, 21, 25], "edges_par": [3, 25], "edges_left": [3, 18, 25], "edges_right": [3, 25], "from_pandas_edgelist": [3, 25], "datafram": [3, 18, 25], "edge_attr": [3, 25], "create_us": [3, 25], "multidigraph": [3, 25], "gg": [3, 25], "mave": [3, 25], "new": [3, 6, 7, 8, 9, 11, 12, 13, 14, 21, 22, 25, 26], "contai": [3, 25], "adjac": [3, 9, 10, 22, 25, 26], "edict": [3, 25], "ilist": [3, 25], "add_edg": [3, 25], "set_node_attribut": [3, 25], "assert": [3, 8, 12, 14, 21, 25], "is_directed_acyclic_graph": 3, "should": [3, 9, 11, 12, 13, 14, 15, 16, 17, 20, 21, 25], "dag": 3, "simplest": [3, 8, 12, 17, 26], "layer": 3, "topological_gener": 3, "multipartite_layout": 3, "subset_kei": 3, "align": [3, 17], "draw_networkx": 3, "argweav": 3, "kwarg": [3, 13], "implement": [3, 4, 8, 11, 14, 16, 25, 26], "re": [3, 6, 14, 15, 26], "konrad": [4, 12], "lohs": [4, 12], "jerom": [4, 12], "kelleh": [4, 12, 22], "demograph": [4, 7, 12], "histori": [4, 5, 7, 8, 12, 14, 18, 21, 22, 26], "assum": [4, 8, 12, 21, 25], "n_e": [4, 12], "step": [4, 5, 7, 12, 21], "seri": [4, 6, 17, 18], "epoch": [4, 7, 25], "1994": 4, "marth": 4, "et": [4, 12, 22], "al": [4, 12, 22], "2004": 4, "keightlei": 4, "eyr": 4, "walker": 4, "2007": 4, "li": 4, "durbin": 4, "2011": [4, 12], "piec": [4, 8, 22, 25], "wise": 4, "constant": [4, 11, 25, 26], "reduc": [4, 8, 9, 23, 25], "fraction": [4, 7, 8, 12, 21], "t_": [4, 12], "recov": 4, "initi": [4, 7, 8, 25], "end": [4, 5, 8, 9, 12, 14, 17, 21, 22, 25, 26], "short": [4, 8, 12, 18, 22, 25, 26], "timescal": [4, 25], "durat": [4, 25], "sequenc": [4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 23], "simpler": [4, 7, 8, 20], "rightarrow": 4, "sudden": [4, 7], "burst": 4, "merger": [4, 22], "strength": [4, 7], "thought": [4, 7, 15, 21, 26], "imaginari": 4, "period": [4, 5, 8], "dure": [4, 8, 14, 20], "collaps": 4, "growth": 4, "probabl": [4, 7], "enter": 4, "attract": 4, "empir": [4, 26], "galtier": 4, "2000": [4, 6, 25], "bunnefeld": 4, "2015": 4, "develop": [4, 11, 14], "straightforward": 4, "ms": [4, 7, 17], "instant": 4, "select": [4, 9, 11, 14, 20, 25, 26], "sweep": [4, 9, 25], "unlik": [4, 7, 17, 21], "durret": 4, "scheinsberg": 4, "affect": [4, 7, 12, 14, 25, 26], "exchang": [4, 7], "consequ": [4, 7], "underw": 4, "2n": [4, 8], "sinc": [4, 7, 8, 9, 12, 15, 17, 21, 22, 25], "obtain": [4, 6, 8, 9, 17, 18, 22], "scale": [4, 5, 12, 14, 18, 22, 26], "2n_e": 4, "matplotlib": [4, 8, 9, 11, 12, 15, 18, 20, 25], "pyplot": [4, 8, 9, 12, 15, 18, 25], "plt": [4, 8, 9, 12, 15, 18, 25], "svg": [4, 6, 7, 9], "run_bott_sim": 4, "num_samp": 4, "num_rep": 4, "none": [4, 5, 6, 8, 9, 12, 13, 14, 15, 18, 21, 22, 25], "seed": [4, 5, 14, 15, 18, 25], "123": [4, 6, 15, 21, 25], "add_popul": [4, 7, 12, 25], "initial_s": [4, 6, 7, 12, 25], "add_instantaneous_bottleneck": 4, "sampleset": [4, 12, 25], "ploidi": [4, 5, 6, 8, 12, 15, 25], "haploid": [4, 5, 12, 18, 21], "num_repl": [4, 8, 15], "bottt": 4, "bottb": 4, "400": [4, 7, 8, 25], "sever": [4, 5, 8, 14, 16, 17, 18, 20, 21, 25, 26], "2016": [4, 12], "exp": 4, "p": [4, 5, 6, 7, 12, 15, 18, 25, 26], "15": [4, 9, 17, 18, 21, 22, 25], "expsfsbottln": 4, "7722266": 4, "17689752": 4, "05087588": 4, "replic": [4, 8, 12, 15, 16], "close": [4, 7, 9, 12, 18, 26], "fit": [4, 13, 20], "nrep": 4, "10_000": [4, 9, 18], "nsamp": 4, "sim": [4, 8, 14], "blist": 4, "zero": [4, 5, 6, 7, 8, 9, 12, 23, 25], "rep_index": 4, "af": [4, 9, 12, 15, 18], "fig": [4, 9, 15, 18], "ax": [4, 18], "subplot": [4, 9, 15, 18], "bar_width": 4, "opac": [4, 25], "expsf": 4, "bar": [4, 9, 12, 15, 18], "alpha": 4, "simsf": 4, "surviv": 4, "paircoalbott": 4, "tree": [4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 23], "tmrca": [4, 8, 15], "rep": 4, "next": [4, 8, 9, 21, 22, 25, 26], "bottblist": 4, "dat": 4, "prob": 4, "mrca": [4, 9, 12, 15, 17, 25, 26], "bottt2": 4, "dat2": 4, "prob2": 4, "expprob": 4, "expprob2": 4, "expmean": 4, "expmean2": 4, "brown": 4, "ls": [4, 15, 18], "lw": [4, 12], "theoret": [4, 8, 15], "marker": 4, "navi": 4, "xlabel": [4, 8, 9, 12, 15, 18], "ylabel": [4, 8, 9, 15, 18], "legend": [4, 12, 18], "maxima": 4, "sprob": 4, "coaldi": 4, "10000": [4, 9, 12, 23, 25, 26], "coaldisfilt": 4, "probtest": 4, "tlist": 4, "coalepx1": 4, "coalepx2": 4, "color": [4, 12, 18, 25], "black": [4, 18, 25], "linewidth": [4, 9], "hist": [4, 8, 12], "bin": [4, 8], "densiti": [4, 8], "substanti": [4, 8, 12], "summari": [4, 17, 23, 25, 26], "basi": [4, 15, 17], "modern": [4, 12, 20, 26], "sweepfind": 4, "dfe": 4, "dadi": 4, "absenc": [4, 17], "linkag": 4, "lossless": 4, "measur": [4, 8, 9, 12, 17, 22, 26], "f_": [4, 15, 18], "st": [4, 15, 18], "tajima": [4, 15, 18, 26], "etc": [4, 9, 13, 14, 15, 17, 18, 23, 25], "achaz": 4, "2009": 4, "depend": [4, 8, 12, 15, 21, 25], "chen": 4, "diffus": 4, "equat": 4, "gutenkunst": 4, "composit": 4, "likelihood": [4, 20], "excoffi": 4, "2002": 4, "bottsf": 4, "5_000": 4, "datalist": 4, "With": [4, 7, 15, 18, 21, 25], "becom": [4, 7, 8, 12, 23, 26], "increasingli": [4, 12], "skew": [4, 25], "leftmost": [4, 22], "complex": [4, 9, 14, 20], "class": [4, 14, 21], "monoton": 4, "relationship": [4, 14, 17, 18, 22, 25, 26], "ss": 4, "pdf": [4, 25], "immedi": [4, 17, 21, 25], "nonrecombin": 4, "block": [4, 25], "discontinu": 4, "75": [4, 14, 15, 18, 25], "numrep": 4, "20_000": [4, 8, 18], "nleav": 4, "btran": 4, "tolist": 4, "x": [4, 5, 6, 21, 25, 26], "ylim": [4, 12], "instantaneousbottleneck": 4, "small": [4, 7, 8, 9, 15, 23, 25, 26], "strongli": [4, 7], "backward": [5, 7, 8, 9, 12, 20, 22, 25], "But": [5, 17, 21], "fwdpy11": [5, 8], "build": [5, 12, 14, 18, 21], "slow": [5, 20], "best": 5, "past": [5, 7, 12, 17, 23, 26], "ancient": [5, 12, 18], "recapit": [5, 8], "think": [5, 7, 14, 15, 17, 21, 22], "head": [5, 6, 8, 18], "wright": [5, 8, 14], "fisher": [5, 8, 14], "formal": [5, 6], "random": [5, 6, 8, 9, 12, 14, 15, 25], "wright_fish": 5, "l": [5, 8, 9, 14, 15, 23, 25, 26], "loci": 5, "recombin": [5, 11, 12, 14, 15, 17, 20, 21, 25, 26], "doi": 5, "1371": 5, "journal": 5, "pcbi": 5, "1006581": 5, "tablecollect": [5, 8, 13, 14, 21], "time_unit": [5, 8, 12, 14, 15, 17, 25, 26], "metadata_schema": [5, 12, 13, 21], "metadataschema": [5, 12, 13], "permissive_json": 5, "dtype": [5, 8, 9, 12, 14, 21, 25], "pp": 5, "randint": 5, "current": [5, 7, 8, 12, 14, 21, 22, 25], "keep_input_root": [5, 8, 14], "tini": [5, 26], "locu": 5, "num_loci": 5, "wf_t": 5, "ran": 5, "enough": [5, 8, 14, 15, 26], "19": [5, 9, 17, 18], "member": 5, "essenti": [5, 22], "correctli": [5, 8, 21, 25], "assembl": 5, "fragment": 5, "materi": [5, 8, 12], "condit": 5, "begin": [5, 9, 23], "examin": [5, 12, 15, 17], "segment": [5, 12, 25], "tupl": [5, 6, 8, 14, 25], "span": [5, 6, 15, 17, 18, 22, 25, 26], "minimum": 5, "initial_st": 5, "system": [5, 18, 21, 23, 25], "coalesced_t": 5, "successfulli": [5, 7, 11], "hoorai": 5, "care": [5, 9, 12, 23], "preserv": 5, "properli": [5, 14, 25], "portion": [5, 18, 26], "must": [5, 6, 7, 9, 12, 13, 14, 16, 21, 22, 23, 25, 26], "necessari": [5, 8, 11, 15, 17, 21, 23, 25, 26], "uncoalesc": [5, 8], "happili": 5, "easili": [5, 8, 9, 21, 25, 26], "practic": [5, 17], "skip": [5, 14, 25], "toi": [5, 12], "pyslim": 5, "front": 5, "slightli": [5, 7, 15, 22, 25, 26], "odd": [5, 14], "awar": 5, "old": [5, 8, 12, 16, 21, 25], "clearli": [5, 8], "redund": [5, 22], "modif": [5, 13, 21, 25], "task": [5, 9, 16, 26], "problem": [5, 8], "statist": [5, 16, 17, 18, 23, 25, 26], "inflat": 5, "overal": 5, "overestim": 5, "had": [5, 21], "alreadi": [5, 8, 23, 26], "better": [5, 6, 9, 15, 16, 20, 21], "your": [5, 7, 8, 9, 10, 11, 14, 15, 17, 18, 20, 22, 23, 25], "final_t": 5, "final": [5, 8, 12, 14, 21, 25, 26], "ident": [5, 6, 9, 15, 21, 25], "reassign": 5, "map_nod": 5, "map": [5, 8, 12, 25], "yan": [6, 20, 25], "wong": [6, 20, 25], "intend": [6, 8, 21, 25], "gentl": 6, "introduct": [6, 9, 17, 18, 22], "combinatori": 6, "treatment": 6, "offici": [6, 21], "avoid": [6, 9, 10, 16, 23, 25], "confus": [6, 8, 23, 25], "letter": [6, 9, 23, 25, 26], "generate_comb": [6, 17], "deep_tre": 6, "intern": [6, 8, 9, 17, 21, 22, 25, 26], "whether": [6, 15], "string": [6, 9, 13, 17, 21, 25, 26], "ascii_lowercas": [6, 25, 26], "str_none": 6, "prefix": [6, 23], "draw_svg_tre": 6, "x_lab_attr": 6, "150": [6, 7, 9], "xmln": 6, "www": 6, "w3": 6, "transform": [6, 18, 22], "translatei": [6, 25], "px": [6, 25], "canvas_s": [6, 18, 25], "root_svg_attribut": [6, 25, 26], "x_label": [6, 12], "getattr": 6, "all_tree_label": 6, "word": [6, 8, 9, 12, 14, 21, 22, 26], "generate_star": 6, "all_tre": 6, "generated_tre": 6, "all_tree_shap": 6, "categoris": 6, "26": [6, 9, 17, 18, 23], "shape_index": 6, "num_label": 6, "known": [6, 8, 15, 17, 20, 22, 25], "num_tip": [6, 17], "simulated_t": 6, "simulated_tre": 6, "ascii_node_label": 6, "1270": 6, "205540": 6, "unrank": 6, "appropri": [6, 8, 21, 25], "new_tre": [6, 17], "21580": 6, "grow": [6, 22], "veri": [6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 23, 25], "rapidli": 6, "282": 6, "137": 6, "824": 6, "perfectli": [6, 15, 22], "sai": [6, 7, 8, 12, 17, 21, 22, 25, 26], "finish": [6, 11], "death": 6, "galaxi": 6, "b2": [6, 8], "b2_index": 6, "balanc": [6, 17], "break": [6, 9, 12, 14, 18], "too": [6, 8, 14, 15, 20, 25, 26], "long": [6, 8, 9, 12, 14, 20, 22, 25], "0000000000000013": 6, "9986759016244608": 6, "9960946599243323": 6, "9958336776669476": 6, "9973695449917637": 6, "992978538300552": 6, "9927249774271467": 6, "recommend": [6, 7, 11, 25], "kc_distanc": 6, "sample_list": [6, 18, 25], "construct": [6, 13, 14], "despit": 6, "explos": 6, "classifi": 6, "count_topolog": 6, "newick_species_tre": 6, "from_species_tre": 6, "321": [6, 17, 23], "big_tre": [6, 17], "fairli": 6, "cluster": [6, 22, 25], "togeth": [6, 18, 21, 22, 25], "exclus": 6, "nearli": 6, "exhaust": 6, "choos": [6, 8], "topology_count": 6, "embedded_count": 6, "embedded_tre": 6, "number_of_inst": 6, "support": [6, 7, 9, 12, 25, 26], "neanderth": [6, 12, 25], "sister": 6, "european": [6, 25], "versu": [6, 25], "african": [6, 12, 18, 25], "increment": [6, 17, 26], "independ": [6, 15, 17, 23], "stdpopsim": [6, 18], "speci": [6, 8, 17, 18, 21], "get_speci": [6, 18], "homsap": [6, 18], "get_demographic_model": [6, 18], "outofafrica_3g09": 6, "contig": [6, 9, 18], "get_contig": [6, 18], "chr1": [6, 18], "length_multipli": 6, "0002": 6, "yri": 6, "ceu": 6, "chb": 6, "engin": [6, 18, 25], "get_engin": [6, 18], "chines": 6, "opt": [6, 13, 18, 21], "hostedtoolcach": [6, 13, 18, 21], "python": [6, 7, 8, 9, 11, 12, 13, 16, 17, 18, 21, 22, 23], "x64": [6, 13, 18, 21], "lib": [6, 13, 18, 21], "python3": [6, 11, 13, 18, 21], "packag": [6, 11, 13, 17, 18, 21, 23, 26], "catalog": [6, 18], "demographic_model": [6, 18], "py": [6, 11, 13, 18, 21], "158": [6, 18], "futurewarn": [6, 18], "deprec": [6, 18], "rais": [6, 13, 18, 21, 23], "typeerror": [6, 18], "futur": [6, 14, 18], "ser": [6, 18], "iloc": [6, 18], "extended_gf": [6, 18], "161": [6, 18], "tail": [6, 18], "446": 6, "6000": [6, 23], "doabl": 6, "02": [6, 7, 12, 25], "calcul": [6, 9, 10, 12, 15, 16, 17, 18, 21, 26], "datetim": [6, 8], "name": [6, 7, 9, 12, 13, 17, 18, 21, 22, 25, 26], "yellow": [6, 18, 25], "population_map": 6, "sample_popul": 6, "topology_span": 6, "embedded_topolog": 6, "3568000000000": 6, "117067": 6, "ntip": 6, "text": [6, 15, 18, 22, 23], "lab": [6, 12, 18, 22, 25, 26], "baselin": [6, 8, 9, 15, 18, 25], "shift": [6, 25], "super": 6, "font": [6, 12, 22, 25, 26], "7em": 6, "1f": [6, 8, 15, 26], "georgia": [7, 20], "tsambo": [7, 20], "isn": [7, 12], "particularli": [7, 15, 21, 25], "excit": 7, "One": [7, 25], "complic": 7, "exponenti": 7, "dem": 7, "idnamedescriptioninitial_sizegrowth_ratedefault_sampling_timeextra_metadata0aplot": 7, "1bplot": 7, "object": [7, 9, 13, 21, 22, 23], "inividu": 7, "forev": 7, "unless": [7, 15, 17, 25], "understand": [7, 11, 12, 13, 21], "recal": 7, "until": [7, 8, 26], "setup": [7, 25], "absolut": 7, "off": [7, 9, 12, 25], "set_migration_r": 7, "migrant": 7, "dest": [7, 12, 25], "approxim": [7, 15, 20], "yourself": 7, "type": [7, 9, 12, 13, 14, 21, 23, 25], "set_symmetric_migration_r": 7, "perhap": [7, 17], "counter": 7, "intuit": [7, 25], "05": [7, 8, 25], "141": [7, 17], "trees1": [7, 17], "length1000": [7, 17, 22], "unitsgener": [7, 9, 22, 23], "nodes4": 7, "size2": [7, 9], "204": 7, "288": 7, "idflagspopulationindividualtimemetadata": [7, 21], "01000": [7, 21], "00000000": [7, 21], "11000": [7, 21], "21110": 7, "31110": 7, "1161": 7, "20712736": 7, "501": 7, "1336": 7, "10713452": 7, "601": 7, "1590": 7, "71203375": 7, "notic": [7, 17, 22], "jupyt": [7, 9, 11, 25], "notebook": [7, 9, 11, 16, 17, 25], "colour_map": [7, 12], "col": [7, 12], "enabl": [7, 18, 25], "sens": [7, 22], "add_migration_rate_chang": 7, "prior": [7, 8, 14], "matrixaba00": 7, "05b0": 7, "020event": 7, "timetypeparameterseffect100migr": 7, "changesourc": 7, "01backward": 7, "readi": [7, 11], "63461": 7, "diagram": [7, 21, 26], "add_admixtur": 7, "suppli": 7, "particip": 7, "proport": [7, 8, 9, 12, 15, 25], "ancestralpop0": 7, "growth_rat": 7, "ancestralpop1": 7, "admixedpop": 7, "haplotyp": [7, 9, 18, 21, 25, 26], "admix": [7, 12, 18], "trigger": 7, "activ": [7, 25], "inact": 7, "beyond": 7, "idnamedescriptioninitial_sizegrowth_ratedefault_sampling_timeextra_metadata0ancestralpop0plot": 7, "1ancestralpop1plot": 7, "2admixedpopplot": 7, "matrixancestralpop0ancestralpop1admixedpopancestralpop000": 7, "050ancestralpop10": 7, "0200admixedpop000ev": 7, "timetypeparameterseffect50admixturederiv": 7, "x27": 7, "proba": 7, "error": [7, 13, 21, 23, 25], "read": [7, 17, 21, 22, 23, 25], "life": 7, "cycl": 7, "situat": [7, 20], "add_population_split": 7, "did": [7, 12], "quantiti": [7, 15], "ancestralpopul": 7, "2ancestralpopulationplot": 7, "001e": 7, "timetypeparameterseffect100popul": 7, "splitderiv": 7, "ancestralpopulationmov": 7, "familiar": 7, "add_mass_migr": [7, 12, 25], "mention": 7, "specialis": 7, "safer": 7, "destin": [7, 12], "timetypeparameterseffect50mass": 7, "migrationsourc": 7, "3lineag": 7, "forward": [7, 9, 20, 22], "view": [7, 25], "receiv": 7, "add_population_parameters_chang": 7, "250": [7, 9, 23, 25, 26], "sort_ev": 7, "pop1_growth": 7, "earli": 7, "ie": 7, "local": [7, 8, 12, 13, 15, 17, 22, 25, 26], "add_censu": 7, "350": [7, 25], "112": 7, "node_is_cen_ev": 7, "seen": [7, 12, 21, 22, 25], "mistak": 7, "spot": [7, 8, 22], "debugg": 7, "readabl": [7, 25], "habit": 7, "demographydebugg": 7, "my_histori": 7, "generationspopul": 7, "startendgrowth_ratea": 7, "0event": 7, "350timetypeparameterseffect350censusinsert": 7, "lineagesepoch": 7, "inf": 7, "scratch": [8, 21], "track": [8, 12, 14, 20, 21, 22, 25], "pedigre": [8, 21], "clariti": [8, 9, 21, 22, 25, 26], "purpos": [8, 9, 15], "condens": [8, 17], "complet": [8, 9, 14, 20, 21], "try": [8, 9, 13, 21], "highli": [8, 12, 17, 18, 25, 26], "capabl": [8, 25], "websit": [8, 18], "illustr": [8, 12, 15, 18, 20, 22, 23, 25], "principl": [8, 26], "lie": 8, "behind": [8, 10, 22], "willing": 8, "book": [8, 14], "themselv": [8, 12, 21, 22], "birth": [8, 21], "integ": [8, 9, 13, 14, 22, 23], "assign": [8, 13, 21, 23], "sequenti": [8, 9, 12, 21], "wf": [8, 14], "notion": 8, "reach": 8, "dai": [8, 18, 26], "subsequ": [8, 14, 17, 25], "previou": [8, 14, 21, 25], "aid": 8, "minim": [8, 12, 14], "export": [8, 23], "immut": [8, 17, 21], "default_rng": [8, 14], "50_000": [8, 14], "kb": [8, 9, 12, 14, 15, 23], "repeat": [8, 17], "pick": [8, 15, 25], "add_inheritance_path": [8, 14], "later": [8, 9, 15, 21, 25], "lower": [8, 12], "languag": [8, 9], "reli": [8, 17, 25], "alloc": [8, 17, 21], "visualis": [8, 25], "unsimplifi": [8, 14], "default_node_flag": 8, "node_is_sampl": [8, 21, 26], "make_diploid": [8, 14], "parent_individu": [8, 14], "being": [8, 14, 16, 25], "individual_id": [8, 14], "new_popul": [8, 14], "prev_pop": [8, 14], "maternal_genome_id": 8, "paternal_genome_id": 8, "cach": 8, "prev_individu": [8, 14], "int32": [8, 9, 14, 21], "replac": [8, 12, 14, 17, 21, 25], "self": [8, 13, 21], "mother_and_fath": [8, 14], "choic": [8, 14, 15], "child_genom": [8, 14], "parent_genom": [8, 14], "initialise_popul": [8, 14], "simplic": [8, 18, 21], "mother": 8, "father": 8, "hermaphrodit": 8, "repeatedli": [8, 9], "next_popul": 8, "routin": [8, 17, 21], "forward_wf": [8, 14], "num_diploid": [8, 14], "seq_len": [8, 14], "global": [8, 14, 15, 16], "focal": [8, 22], "parent_nod": 8, "child_nod": 8, "randomli": [8, 9, 22], "21_000": 8, "inherit_from": [8, 14], "1st": [8, 25], "2nd": 8, "mosaic": 8, "hotspot": 8, "redefin": 8, "uniform": 8, "poisson": [8, 14], "num_recombin": [8, 14], "concaten": 8, "b1": [8, 17], "b3": 8, "bn": 8, "switch": [8, 14, 15], "infinit": [8, 14, 15, 22], "alter": 8, "test": [8, 14, 20, 21], "appear": [8, 14, 21, 25], "pervers": 8, "toward": 8, "graphics_param": 8, "y_label": [8, 12, 25, 26], "21": [8, 9, 17, 18], "1200": [8, 12, 25], "extinct": [8, 14], "made": [8, 12, 25], "shown": [8, 11, 21, 22, 26], "typic": [8, 25, 26], "contribut": [8, 11, 12, 22], "current_day_genom": 8, "simplified_t": 8, "keep_unari": 8, "filter_nod": [8, 25], "part": [8, 11, 21, 22, 25, 26], "renumb": 8, "youngest": 8, "oldest": [8, 17], "meant": [8, 18, 25], "kept": 8, "unneed": 8, "rho": [8, 15], "bp": [8, 12], "07": 8, "50000": [8, 25], "symbol_s": [8, 25], "someth": [8, 9, 15, 21, 22, 25], "manag": [8, 21], "visual": [8, 9, 21, 22, 26], "far": [8, 9, 12, 25], "dramat": 8, "disk": [8, 17, 22], "storag": [8, 11, 17, 26], "memori": [8, 9, 15, 16, 17, 22, 23], "gen": [8, 12], "ten": [8, 26], "500_000": 8, "dead": 8, "nbyte": [8, 15, 17], "1024": [8, 17], "mb": [8, 9, 12, 17, 18], "factor": [8, 12, 25], "79": 8, "113": 8, "320": 8, "58": 8, "improv": 8, "carri": [8, 14, 17], "regular": [8, 14], "figur": [8, 14, 20, 25], "figsiz": [8, 9, 15, 18, 25], "stair": [8, 9, 15, 18], "num_root": 8, "as_arrai": [8, 22], "hand": [8, 17, 21, 25], "10n": 8, "4n": [8, 14], "varianc": [8, 14], "big": [8, 14], "margin": [8, 22, 25], "distribut": [8, 12, 14, 21, 26], "faster": [8, 9, 26], "5e": 8, "cours": [8, 15], "henc": [8, 16], "prohibit": [8, 15], "matter": 8, "distanc": [8, 15, 17], "betweem": 8, "undefin": 8, "techniqu": [8, 25], "fast": [8, 15, 17, 18, 20], "trick": 8, "learn": [8, 9, 11, 18], "user": [9, 17, 25], "who": 9, "basic": [9, 11, 14, 15, 17, 21, 22, 25], "five": 9, "throughout": [9, 25], "pointer": [9, 21, 22], "written": 9, "r": [9, 11, 13, 25, 26], "notabl": 9, "rust": 9, "softwar": [9, 11, 20, 25], "twenti": 9, "throw": [9, 17], "pop_siz": 9, "seq_length": 9, "10_000_000": 9, "sweep_model": 9, "sweepgenicselect": 9, "start_frequ": 9, "0001": 9, "end_frequ": 9, "9999": 9, "dt": 9, "standardcoalesc": 9, "1234": 9, "repeatabilti": 9, "finit": 9, "juke": 9, "cantor": 9, "snp": [9, 18], "4321": 9, "trees11167": 9, "nodes40": 9, "36372": 9, "584": 9, "13568": 9, "490": [9, 21], "7342": 9, "224": [9, 23], "13554": 9, "330": 9, "idiom": [9, 21], "underli": [9, 13, 15, 17, 18, 21, 22, 23, 26], "encount": [9, 17, 21, 22], "661": 9, "3116": 9, "4451": 9, "4673": 9, "5020": 9, "11166": 9, "9999635": 9, "loop": [9, 14, 21, 26], "outsid": [9, 14], "eat": 9, "aslist": 9, "snippet": 9, "stop": 9, "That": [9, 12, 21, 22, 25], "check": [9, 14, 21, 23, 25], "elaps": 9, "has_multiple_root": 9, "6g": 9, "sec": [9, 17], "11167": 9, "00959992": 9, "find": [9, 12, 15, 20, 22, 25, 26], "found": [9, 12, 14, 17, 25], "mrca_tim": 9, "yscale": [9, 12], "design": [9, 16, 17, 18], "rapid": 9, "pull": 9, "swept_tre": 9, "5_000_000": 9, "nth": [9, 25], "at_index": [9, 25], "intvl": 9, "wide": [9, 18, 25], "room": [9, 25], "5382": 9, "4998293": 9, "5033047": 9, "signatur": 9, "expans": [9, 26], "excess": [9, 12], "simplif": [9, 21, 25], "smaller": [9, 12, 17, 21], "x_lim": [9, 12, 25, 26], "reduced_t": [9, 23], "5kb": 9, "5000": [9, 25, 26], "higher": [9, 12, 22], "frequenc": [9, 14, 15, 18], "numer": [9, 23, 25, 26], "meaning": [9, 17, 25], "perman": 9, "attach": [9, 25], "incorpor": [9, 22, 26], "automat": [9, 13, 25], "entitl": [9, 17], "realli": [9, 14, 17, 20], "itself": [9, 14, 15, 21, 25, 26], "nevertheless": [9, 12, 15, 25], "num_mut": [9, 12, 21, 22, 23], "num_sit": [9, 18, 21, 26], "nmut": 9, "bincount": [9, 21], "13540": 9, "2275": 9, "2287": 9, "2658": 9, "3789": 9, "4043": 9, "9694": 9, "11023": 9, "11780": 9, "11853": 9, "11890": 9, "11999": 9, "12023": 9, "12096": 9, "12310": 9, "miss": [9, 15, 17, 18, 26], "set_printopt": 9, "optimis": 9, "less": [9, 12, 17], "resid": [9, 22, 26], "samp_id": 9, "22": [9, 17, 18, 21], "23": [9, 17, 18], "27": [9, 17, 18], "28": [9, 12, 17, 18, 25], "29": [9, 17, 18, 23], "31": [9, 17, 18, 21], "37": [9, 17], "38": [9, 17], "jc69": 9, "indel": 9, "nor": 9, "relat": [9, 12, 21, 22], "titl": [9, 12, 18, 25], "unpolaris": 9, "unpolar": 9, "doesn": [9, 13, 25], "polar": 9, "estim": [9, 15, 18], "influenc": [9, 20], "nois": [9, 15], "ax1": [9, 15], "ax2": [9, 15], "ncol": [9, 15, 18], "afs1": [9, 15], "set_titl": [9, 15, 18], "restricted_t": 9, "keep_interv": [9, 21], "5e6": 9, "afs2": [9, 15], "5mb": 9, "On": [9, 13], "delet": [9, 21, 23, 25], "unsurprisingli": 9, "vari": 9, "\u03c0": 9, "wherea": [9, 22, 23], "10kb": [9, 18], "1_000": [9, 12, 15], "set_ylabel": [9, 15], "set_xlabel": [9, 15], "set_xlim": 9, "4e3": 9, "6e3": 9, "set_yscal": [9, 15], "set_ylim": 9, "drop": 9, "noisi": 9, "signal": [9, 12], "dump": [9, 13], "suffix": 9, "my_tree_sequ": 9, "interchang": [9, 17, 20], "interoper": [9, 18], "small_t": 9, "135": 9, "5614": 9, "805": 9, "3587": 9, "2945": 9, "281": 9, "290": 9, "004": 9, "836": 9, "139": 9, "168": 9, "2655": 9, "277": 9, "641": 9, "955": 9, "2162": 9, "570": 9, "61457": 9, "489": [9, 17, 21], "8362": 9, "020": 9, "1757": 9, "640": 9, "6604": 9, "380": 9, "58845": 9, "274": 9, "act": 9, "trim": [9, 14, 18, 21, 23], "blank": 9, "cut": [9, 18], "as_nexu": 9, "include_align": 9, "taxa": 9, "ntax": 9, "taxlabel": 9, "n0": [9, 23, 25], "n1": [9, 23, 25], "n2": [9, 23, 25], "n3": 9, "n4": [9, 25], "n5": 9, "n6": 9, "n7": [9, 25], "n8": 9, "n9": [9, 25], "t0": [9, 25], "t661": 9, "50834": 9, "692": 9, "48222": 9, "477": 9, "t3116": 9, "20242": 9, "950": 9, "17630": 9, "736": 9, "t4451": 9, "5076": 9, "55250": 9, "945": 9, "52638": 9, "730": 9, "t5076": 9, "7049": 9, "21090": 9, "493": 9, "18478": 9, "278": 9, "t7049": 9, "7995": 9, "8736": 9, "6123": 9, "895": 9, "t7995": 9, "8742": 9, "5358": 9, "852": 9, "3003": 9, "t8742": 9, "9279": 9, "6741": 9, "465": 9, "4129": 9, "t9279": 9, "sy": [9, 17], "write_vcf": 9, "stdout": 9, "fileformat": 9, "vcfv4": 9, "filter": [9, 25], "gt": 9, "chrom": 9, "ref": 9, "alt": 9, "qual": 9, "tsk_0": 9, "tsk_1": 9, "tsk_2": 9, "tsk_3": 9, "tsk_4": 9, "310": 9, "890": [9, 13], "1052": 9, "1375": 9, "1918": 9, "4921": 9, "5050": 9, "5132": 9, "5531": 9, "7204": 9, "8930": 9, "9800": 9, "integr": [9, 17], "downstream": [9, 13], "unfortun": 9, "slight": 9, "mismatch": 9, "haplotypearrai": 9, "genotype_matrix": [9, 23], "n_variant": 9, "n_haplotyp": 9, "lt": 9, "0123456789000110010001110011011120011001000": 9, "90011001000100010000000111100110111": 9, "sckit": 9, "suit": [9, 18, 20], "pairwis": [9, 15, 16], "nativ": [9, 16, 23], "ac": 9, "count_allel": 9, "mean_pairwise_differ": 9, "46666667": 9, "home": 9, "messag": 9, "rough": [9, 22], "distinct": 9, "complement": 9, "delete_interv": [9, 21, 23], "prefer": [9, 15, 26], "fst": [9, 15, 18], "explain": [10, 15, 21, 26], "philosophi": 10, "content": [10, 13, 19, 21, 24], "233": [10, 14], "toolkit": [11, 17, 18, 22], "advanc": 11, "ecosystem": 11, "suggest": [11, 12, 17, 20, 26], "yet": [11, 15, 25], "ital": 11, "github": [11, 12, 17, 19, 25], "page": [11, 17, 25, 26], "video": 11, "public": [11, 18, 25], "friendli": 11, "commun": 11, "question": [11, 21], "tsinfer": [11, 18], "experi": [11, 14], "instal": [11, 23], "importantli": [11, 14, 21], "txt": 11, "shortcut": 11, "m": [11, 12, 25, 26], "pip": 11, "dev": [11, 12, 17, 19, 25], "reticul": [11, 23], "irkernel": 11, "command": 11, "installspec": 11, "directori": 11, "link": [11, 17, 20], "onc": [11, 12, 17, 21, 26], "script": [11, 25], "cell": [11, 13, 17, 21, 25], "magic": [11, 23], "great": [12, 26], "admixtur": [12, 26], "archaic": 12, "hominin": 12, "2010": 12, "geneticist": 12, "sankararaman": 12, "tract": 12, "heurist": 12, "recipi": 12, "quantifi": 12, "durand": 12, "clock": 12, "calibr": 12, "date": [12, 13], "admixur": 12, "sankararamanm": 12, "earlier": [12, 25], "shorter": [12, 20], "harder": 12, "detect": [12, 22], "poulat": 12, "share": [12, 16, 17, 21, 25, 26], "difficult": [12, 16, 25], "distinguish": [12, 26], "incomplet": [12, 17], "il": 12, "loos": 12, "motiv": 12, "africa": [12, 18, 25], "eurasia": [12, 25], "categori": 12, "ii": 12, "eurasian": [12, 18, 25], "iii": 12, "unambigu": 12, "due": [12, 15, 17, 25], "20mb": 12, "run_simul": 12, "kya": [12, 25], "unrealist": [12, 25], "merg": [12, 21, 25], "record_migr": [12, 25], "diff": [12, 25], "0f": [12, 15], "0mb": 12, "go": [12, 13, 14, 21, 23], "get_migrating_tract": 12, "neanderthal_id": 12, "migrating_tract": 12, "get_coalescing_tract": 12, "coalescing_tract": 12, "tract_left": 12, "mrca_pop": 12, "elif": 12, "get_eur_nea_tract": 12, "within_nea": 12, "eur_nea": 12, "denot": 12, "went": 12, "third": [12, 22, 25, 26], "migrating_l": 12, "migrating_tot": 12, "within_nea_tot": 12, "nea_eur_closest": 12, "373730": 12, "165617": 12, "4475561": 12, "0186865": 12, "00828085": 12, "22377805": 12, "accord": [12, 14, 25], "consider": [12, 25, 26], "300kya": 12, "50kya": 12, "year": [12, 25], "histogram": 12, "nea": 12, "eur": [12, 18], "firm": 12, "conclus": 12, "stand": 12, "confirm": 12, "assess": [12, 20], "outweigh": 12, "vast": [12, 15], "major": [12, 20, 22, 26], "orang": 12, "longest": 12, "intersect": 12, "longest_tract": 12, "argmax": 12, "upper": 12, "within_long": 12, "logical_or": 12, "logical_and": [12, 25], "eur_nea_long": 12, "hline": 12, "c0": 12, "c1": 12, "c2": 12, "breakdown": 12, "ytick": 12, "178kb": 12, "lot": 12, "chunk": 12, "reliabl": 12, "guid": 12, "rout": [12, 25], "hard": [12, 22, 25], "aros": 12, "impos": 12, "gather": 12, "get_mutation_popul": 12, "node_migr": 12, "mutation_popul": 12, "mig": 12, "migat": 12, "pypi": 12, "intervaltre": 12, "25kb": 12, "css": 12, "tick": [12, 26], "cccccc": 12, "85": [12, 25, 26], "25_000": [12, 25], "log_tim": [12, 18, 22, 25], "eu": 12, "moreov": [12, 21, 25], "comprehens": 12, "dataclass": 12, "high": [12, 20], "shouldn": [12, 15], "mess": [12, 25], "com": [12, 17, 19, 25], "codec": [12, 13], "json": [12, 13, 21], "extant_t": 12, "num_introgressed_mut": 12, "extant": [12, 14], "entiti": [13, 14, 17], "conform": 13, "metaschema": 13, "demonstr": [13, 17, 26], "decod": [13, 21], "ers0001": 13, "pcr": 13, "constraint": [13, 25], "table_metadata_schema": 13, "additionalproperti": 13, "ena": 13, "boolean": 13, "prettili": 13, "asdict": [13, 21], "indent": 13, "minor": 13, "valid": [13, 17, 21], "held": 13, "constructor": 13, "arbitrari": [13, 17, 22], "basic_schema": 13, "complex_schema": 13, "overwrit": [13, 21], "against": [13, 25, 26], "row_id": 13, "bob1234": 13, "accident": 13, "proper": 13, "validationerror": 13, "traceback": [13, 21], "683": 13, "validate_and_encode_row": [13, 21], "682": 13, "_validate_row": 13, "684": 13, "except": [13, 20, 21], "jsonschema": 13, "432": 13, "arg": [13, 18, 25, 26], "431": [13, 14], "iter_error": 13, "fail": 13, "ordereddict": 13, "metadatavalidationerror": 13, "individualt": [13, 21], "889": [13, 25], "empty_valu": 13, "891": 13, "ll_tabl": [13, 21], "892": 13, "893": 13, "685": 13, "686": 13, "encode_row": 13, "attempt": [13, 21, 22], "newkei": 13, "unexpect": 13, "mean_coverag": 13, "timestamp": 13, "ideal": [13, 22], "reconstruct": 13, "schema_dict": 13, "new_id": 13, "abc123": 13, "individual_t": 13, "nraw": 13, "packset_metadata": [13, 21], "set_column": [13, 21, 25], "append_column": 13, "prepar": 13, "metadata_column": 13, "etho1234": 13, "richard1235": 13, "albert1236": 13, "encoded_metadata_column": 13, "md": [13, 25], "md_offset": 13, "pack_byt": 13, "metadata_offset": [13, 21], "idflagslocationparentsmetadata": [13, 21], "Or": [13, 17, 18, 21, 23], "disabl": [13, 25], "custom": [13, 25], "hidden": [14, 25, 26], "break_po": 14, "return_count": 14, "left_posit": 14, "insert": 14, "right_posit": 14, "garbag": 14, "rid": 14, "forc": [14, 23, 25, 26], "reckon": 14, "remap": 14, "simplify_t": 14, "node_map": 14, "nodes_individu": 14, "remapped_pop": 14, "node1": 14, "node2": 14, "saniti": 14, "simplification_interv": 14, "simplify_mod": 14, "current_nod": 14, "800": [14, 17, 18, 25, 26], "critic": [14, 17], "mind": [14, 21], "compon": [14, 15], "determinist": 14, "satisfi": 14, "hold": 14, "test_interv": 14, "sure": [14, 21, 23], "ts_test": 14, "ignore_proven": 14, "101": 14, "134": 14, "167": 14, "266": 14, "299": 14, "332": 14, "365": 14, "398": 14, "464": 14, "497": [14, 23], "bug": 14, "encapsul": 14, "correct": [14, 25], "predict": [14, 15, 20, 26], "analyt": 14, "crude": 14, "catch": 14, "million": [14, 17, 18, 22, 26], "offspr": 14, "persist": [14, 22, 25], "aris": 14, "theta": 14, "twice": [14, 15], "uniformli": 14, "coeffici": 14, "synonym": 14, "sell": 14, "abil": [14, 15, 26], "plu": [14, 22], "neat": 14, "rest": [14, 17, 18, 22, 25], "port": 14, "workbook": 14, "primarili": [14, 15, 20, 25], "deal": [14, 17, 21, 22, 23, 26], "sensibl": [14, 17], "asid": 15, "studi": [15, 20, 22], "Of": 15, "wonder": 15, "cpu": [15, 16, 17], "inconsequenti": 15, "mutationless": 15, "1_000_000": [15, 17], "n_subpop": 15, "subpop_s": 15, "migration_r": 15, "deme": [15, 25], "ts_no_mut": 15, "pop_": 15, "subpop": 15, "island_model": 15, "ts_mutat": [15, 25], "456": [15, 21], "151": 15, "overlaid": [15, 21, 22, 25], "overlai": [15, 25], "fair": 15, "cost": 15, "remaind": 15, "focuss": [15, 25], "degre": 15, "descent": [15, 22], "identif": [15, 25], "nearest": 15, "neighbour": 15, "elsewher": 15, "1mb": 15, "sample_a": 15, "sample_b": 15, "av_tmrca": 15, "cover": [15, 21, 22, 25, 26], "pop_0": 15, "pop_1": 15, "42396": 15, "realist": [15, 20], "paper": [15, 20], "dualiti": 15, "patterson": 15, "6f": 15, "000840": 15, "low": 15, "framework": [15, 17, 18, 23], "ab_dist": 15, "av": 15, "previous": [15, 16, 21, 25], "multipli": 15, "84793": 15, "000848": 15, "stochast": 15, "evid": [15, 25, 26], "matplotlib_inlin": [15, 25], "n_rep": 15, "ts_rep": 15, "ts_mutated_rep": 15, "decreas": 15, "exagger": 15, "comparison": [15, 20], "fst_genealog": 15, "fst_genetic_var": 15, "crow": 15, "aoki": 15, "1984": 15, "pna": 15, "81": 15, "6073": 15, "eqn": 15, "fst_theori": 15, "scatter": 15, "axhlin": 15, "grei": [15, 25], "center": 15, "introduc": [15, 17, 21], "ultim": [15, 22], "goal": 15, "smooth": 15, "uneven": 15, "subject": [15, 20, 25], "1kb": 15, "sharei": 15, "especi": [15, 20, 21], "carefulli": 15, "accur": 15, "descriptor": 15, "thread": 16, "multiprocess": 16, "modul": 16, "offer": 16, "resourc": 16, "usag": 16, "lightweight": 16, "intens": [16, 25], "undertaken": 16, "cpython": 16, "lock": 16, "execut": 16, "bytecod": 16, "parallelis": 16, "nasti": 16, "pitfal": 16, "releas": 16, "gil": 16, "expens": 16, "proce": 16, "recreat": [16, 22], "stackoverflow": 16, "post": 16, "filenam": 16, "subprocess": 16, "transfer": 16, "evolutionari": [17, 18, 22, 26], "comb": 17, "pectin": 17, "129": 17, "70018100738525": 17, "1000000": 17, "64": [17, 18, 25], "76": 17, "wall": 17, "2372": 17, "issuecom": 17, "1298518380": 17, "2628": 17, "solv": [17, 25], "huge": [17, 25, 26], "traversed_nod": 17, "travers": [17, 26], "1999999": 17, "276": 17, "04": 17, "280": 17, "279": 17, "b1_index": 17, "39272472286399": 17, "57": 17, "177": 17, "\u00b5s": 17, "74": [17, 25], "newick": [17, 23], "2187": 17, "xxx": [17, 25], "mainli": 17, "tsconvert": 17, "from_newick": 17, "unifi": 17, "phylogeni": 17, "hybrid": [17, 26], "correl": [17, 22, 26], "seven": 17, "background": [17, 25, 26], "clade": [17, 25], "nice": [17, 23, 25], "roll": 17, "node_object": 17, "nodes5": 17, "size942": 17, "264": 17, "511": 17, "heavili": 17, "tend": [17, 25], "node_id": [17, 25], "parent_arrai": 17, "is_leaf": 17, "emphasis": 17, "edge_id": 17, "coordin": [17, 18, 21, 25], "numba": 17, "n_id": [17, 25], "levelord": 17, "colless": 17, "imbal": 17, "colless_index": 17, "squar": [17, 21, 22, 25], "is_sampl": [17, 25, 26], "n_is_sampl": 17, "bootstrap": 17, "awai": [17, 25], "implicit": 17, "cladogram": 17, "uncalibr": 17, "implic": 17, "tempor": 17, "imposs": [17, 22], "extend": [17, 25, 26], "unknown": [17, 21, 22, 25], "turn": [17, 25], "target_node_1": 17, "target_node_2": 17, "2627": 17, "mix": [17, 18], "path_length": 17, "branch_dist": 17, "unlink": 17, "seq": 17, "keep_edg": [17, 25], "replace_with": [17, 25], "erased_t": 17, "empty_tre": 17, "strang": 17, "corner": 17, "demo": 17, "bring": [17, 18], "popgen": 17, "kc": 17, "metric": 17, "93": 17, "mutated_t": [17, 26], "3e": 17, "mutated_tre": 17, "47": 17, "77": 17, "87": 17, "91": [17, 25], "115": 17, "116": 17, "117": 17, "126": 17, "130": 17, "143": 17, "203": 17, "230": 17, "247": 17, "317": 17, "335": 17, "355": 17, "364": 17, "382": 17, "426": 17, "430": 17, "433": 17, "516": 17, "523": 17, "540": 17, "623": 17, "671": 17, "711": 17, "737": 17, "742": 17, "752": 17, "803": 17, "819": 17, "842": 17, "849": 17, "861": 17, "913": 17, "922": 17, "41": [17, 22], "965": 17, "975": 17, "43": [17, 25], "979": 17, "988": 17, "45": 17, "997": 17, "missing_data_charact": [17, 26], "ggt": 17, "gga": 17, "gat": [17, 21], "aat": 17, "shine": 17, "adequ": 17, "pervas": 17, "undergon": 17, "enorm": 17, "edge_id_above_node_4": 17, "left_coord_for_edg": 17, "reset": [17, 25], "coord": 17, "multi_t": 17, "side": [17, 25], "lack": 17, "presenc": 17, "dna": [18, 21, 22], "jointli": 18, "core": 18, "scalabl": [18, 25], "interact": [18, 25], "homo": 18, "sapien": 18, "asian": 18, "american": 18, "demesdraw": [18, 25, 26], "schemat": [18, 25, 26], "americanadmixture_4b11": 18, "tube": [18, 25], "to_dem": 18, "gca": 18, "kilobas": 18, "afr": 18, "asia": 18, "20000": [18, 26], "inspect": [18, 25], "breviti": 18, "id0": 18, "position1348": 18, "samples32": 18, "alleles2": [18, 21], "78": 18, "datafals": 18, "missingtru": 18, "id1": 18, "position2062": 18, "97": 18, "id2": 18, "position3046": 18, "sample_id": 18, "cccacgcgcggtacaatctttgtgaccgttagagcttta": 18, "cccaaacgcagtacaacgtcagggaccgttagagcttgg": 18, "acaacgcgcgttacaatctttgtgaccgttagagctttg": 18, "cccaaacgcagtacaacctcagggaccgttagagcttta": 18, "cccaaacctagtaaaacctcatggcccgttagtgcgctt": 18, "acaacgcgcggtacaatctttgtaaccgttagagcttta": 18, "acaacgcgcggtacaatctttgtaaccgttagagctttg": 18, "acaacgcgcggtacaatctttgtaagcgttagagctttg": 18, "aaaacgcgcggtacaatctttgtaaccgtaagagctttg": 18, "acaacgcgcggtacaatctttgtaaccgtaagagctttg": 18, "acaacgcgcggtacaatctttgtaaccggtagagctttg": 18, "acaacgcgcggtacaatctttgtaaccgttaaagctttg": 18, "acatcgcgcggtacaatctttgtaaccgttaaagctttg": 18, "acaacgcgcggtacaatctttgtaaccctaagagttttg": 18, "acaacgcgcggtacaatctttgtgacggttagagctttg": 18, "acaacgcgcggtccgatctttgtaagcgttagagctttg": 18, "acaacgcgcggcacaatctttgtaaccggtagagctttg": 18, "cccaaacgcagtacaacctcagggaccgtttgtgcgctt": 18, "acaacgcgcggtacactctttgtaaccgtaagagctttg": 18, "accaaatgcagtacaaccacagggaccgttagatcttta": 18, "pop_id": 18, "2_000": 18, "f_st": 18, "grab": 18, "cyan": [18, 25], "rotat": [18, 22, 25], "anchor": [18, 22, 25], "90deg": [18, 22, 25], "translat": [18, 22, 25], "6px": [18, 22, 25], "capit": 18, "520": 18, "30_000": 18, "vcf": [18, 26], "7500": 18, "project": [18, 25], "108mb": 18, "110mb": 18, "edar": 18, "compress": [18, 22, 26], "tszip": 18, "decompress": 18, "unified_genealogy_2q_108mb": 18, "tsz": 18, "encompass": [18, 26], "chr": 18, "rs3827760": 18, "edar_gene_bound": 18, "108_894_471": 18, "108_989_220": 18, "focal_vari": 18, "id9378": 18, "position108897145": 18, "samples836": 18, "384": 18, "46": 18, "452": 18, "54": 18, "east": 18, "num_popul": [18, 22], "pop_names_region": 18, "67": 18, "bantukenya": 18, "bantusouthafrica": 18, "biaka": 18, "cambodian": 18, "east_asia": 18, "62": [18, 22], "uygur": 18, "eastasia": 18, "xibo": 18, "yi": 18, "65": 18, "yoruba": 18, "66": 18, "denisovan": 18, "rgn": 18, "edar_t": 18, "tajimas_d": 18, "amount": [18, 25], "plot_data": 18, "axvspan": 18, "lightgrai": 18, "axvlin": 18, "scikit": 18, "geograph": [18, 21, 25], "brief": 18, "taster": 18, "research": 18, "52": [19, 21], "peter": 20, "ralph": 20, "explor": 20, "histor": [20, 21], "scenario": 20, "benchmark": 20, "evalu": 20, "methodolog": 20, "accuraci": 20, "inferenti": 20, "train": 20, "eg": 20, "bayesian": 20, "potenti": [20, 22, 25], "impract": 20, "focus": 20, "fwdpy": 20, "capac": 20, "benefit": [20, 26], "afterward": 20, "extrapol": 20, "curv": 20, "minut": 20, "hour": 20, "104": 20, "bulk": 21, "eight": 21, "tables_exampl": 21, "live": [21, 26], "nodet": 21, "21010": 21, "30020": 21, "15000000": 21, "60000000": 21, "80000000": 21, "ag": [21, 25, 26], "contemporari": 21, "edget": 21, "0208030": 21, "1208032": 21, "2010041": 21, "302042": 21, "48010042": 21, "5208043": 21, "68010050": 21, "78010054": 21, "802060": 21, "902064": 21, "tables_example_mut": 21, "depict": [21, 25], "cross": [21, 25], "sitet": 21, "015a": 21, "142g": 21, "260t": 21, "mutationt": 21, "idsitenodetimederived_stateparentmetadata": 21, "0040": 21, "90000000g": 21, "1110": 21, "40000000a": 21, "2230": 21, "55000000c": 21, "3200": [21, 26], "10000000t2": 21, "agt": 21, "ggc": 21, "migrationt": 21, "provenancet": 21, "populationt": 21, "idmetadata": 21, "gbr": [21, 22], "british": [21, 22, 25], "england": [21, 22], "scotland": [21, 22], "visibl": [21, 25, 26], "topic": 21, "002": 21, "alic": [21, 25], "102": 21, "bob": [21, 22, 25], "carol": 21, "referenc": 21, "matern": 21, "patern": 21, "indivividu": 21, "famili": [21, 25, 26], "sibl": 21, "schema": 21, "nequival": 21, "new_tabl": 21, "everi": [21, 22, 25, 26], "node_t": 21, "25000000": 21, "40000000": 21, "85000000": 21, "05000000": 21, "valueerror": 21, "488": [21, 22], "baset": 21, "__setattr__": 21, "486": 21, "487": 21, "1210": 21, "1177": 21, "1178": 21, "1179": 21, "1207": 21, "1208": 21, "1209": 21, "_check_required_arg": 21, "1211": 21, "1212": 21, "1213": 21, "1214": 21, "1215": 21, "1216": 21, "1217": 21, "1218": 21, "1219": 21, "1220": 21, "brace": 21, "raw": 21, "nodetablerow": 21, "slice": [21, 25], "01010": 21, "10020": 21, "sitetablerow": 21, "enforc": 21, "frozeninstanceerror": 21, "entri": [21, 22], "replacement_row": 21, "new_po": 21, "new_site_id": 21, "feed": 21, "015c": 21, "310gb": 21, "nonsens": 21, "constitu": 21, "nondecreas": 21, "altered_t": 21, "won": 21, "tickmark": [21, 25, 26], "ever": 21, "extrem": 21, "construction_exampl": 21, "alia": 21, "edge_t": 21, "00100020": 21, "10100021": 21, "20100042": 21, "30100043": 21, "atgc": 21, "barrier": 21, "delete_sit": [21, 26], "certain": [21, 25, 26], "union": 21, "strip": 21, "sites_with_a_singleton_allel": 21, "non_missing_genotyp": 21, "ts_new": 21, "109": 21, "saw": 21, "individualtablerow": 21, "robert": 21, "edited_t": 21, "rag": 21, "suffic": 21, "packset_": 21, "surnam": 21, "new_metadata": 21, "smith": 21, "validated_metadata": 21, "parsimoni": [21, 26], "placement": [21, 26], "recurr": [21, 25], "reus": 21, "anc_stat": 21, "compute_mutation_par": 21, "compute_mutation_tim": 21, "parsimonious_t": 21, "fewer": [21, 25], "v1": [21, 25], "v2": 21, "alleles1": 21, "verifi": 21, "154": 21, "hope": 22, "piqu": 22, "serv": [22, 25], "download": [22, 25], "datafil": 22, "biolog": [22, 26], "workaround": [22, 25], "multi": [22, 23], "contigu": 22, "organ": 22, "convention": 22, "moment": [22, 25], "symbol": [22, 25, 26], "duplic": [22, 26], "emphas": 22, "307": 22, "567": 22, "uk": 22, "biobank": 22, "uncompress": 22, "gigabyt": 22, "rare": 22, "explictli": 22, "rightarrow1": 22, "rightarrow10": 22, "rightarrow8": 22, "rightmost": [22, 25], "relianc": 22, "first_tre": 22, "parent_of_7": 22, "children_of_7": 22, "childen": 22, "autosom": 22, "spatial": [22, 26], "ada": 22, "cat": 22, "num_individu": 22, "mate": 22, "nan": 22, "unknown_tim": [22, 25], "751": 22, "homozyg": 22, "heterozyg": 22, "coupl": [22, 23], "suffici": 22, "bother": 22, "silent": 22, "monomorph": 22, "bifurc": 22, "coalec": 22, "polytomi": 22, "coales": 22, "physic": 22, "literatur": 22, "concentr": 22, "undetect": 22, "logic": 22, "realis": 22, "outcom": 22, "2019": 22, "screen": 22, "plain": [22, 25], "trees3": 22, "nodes6": 22, "size3": 22, "166": 22, "53": 22, "344": [22, 23], "255": 22, "session": 23, "haven": [23, 25], "render": [23, 25], "414": 23, "No": [23, 25], "ye": 23, "953": 23, "6kb": 23, "bare": 23, "digit": 23, "Will": 23, "coerc": 23, "prepend": [23, 25], "0l": 23, "attent": 23, "paid": 23, "root_id": 23, "4634393266485": 23, "ts_mut": 23, "000720238095238095": 23, "matric": 23, "00010000": 23, "00000010": 23, "00100000": 23, "00110110": 23, "01110110": 23, "01111111": 23, "00001001": 23, "00001000": 23, "allele_frequ": 23, "rowmean": 23, "1250": 23, "6250": 23, "8750": 23, "125": 23, "repr_html": 23, "obj": 23, "_repr_html_": 23, "repr_svg": 23, "svgstring": 23, "__str__": 23, "nicer": 23, "tabular": 23, "trees6": 23, "length6000": 23, "nodes8": 23, "size6": 23, "136": 23, "568": 23, "341": 23, "inlin": [23, 25], "popular": 23, "ap": 23, "nexu": 23, "tempfil": 23, "write_nexu": 23, "warn": 23, "as_newick": 23, "downward": [23, 25], "srt": 23, "adj": 23, "Be": 23, "ascii": 25, "unicod": 25, "vector": 25, "50kb": 25, "subdivis": 25, "markdown": 25, "menubar": 25, "ts_tini": 25, "viz_ts_tini": 25, "ts_small": 25, "viz_ts_smal": 25, "ts_full": 25, "viz_ts_ful": 25, "brows": 25, "reproduc": 25, "draw_text": 25, "unspecifi": 25, "chri": 25, "dora": 25, "11428": 25, "11144": 25, "9753": 25, "6204": 25, "3893": 25, "3378": 25, "92": 25, "2076": 25, "1941": 25, "72": 25, "1439": 25, "9855": 25, "13901": 25, "21285": 25, "23424": 25, "25213": 25, "30463": 25, "46237": 25, "Being": 25, "vectoris": 25, "suitabl": 25, "svg_size": 25, "svg_string": 25, "x_scale": 25, "treewis": 25, "wrap": 25, "circl": 25, "hide": 25, "apolog": 25, "reader": 25, "spell": 25, "eas": 25, "imag": 25, "unconvent": 25, "linear": 25, "shade": [25, 26], "obscur": 25, "overlap": 25, "advis": 25, "slighli": 25, "x_limit": 25, "15000": [25, 26], "evenli": 25, "y_tick_po": 25, "3000": 25, "4000": 25, "third_tre": 25, "bunch": 25, "faint": 25, "shrink": 25, "wide_fmt": 25, "stylesheet": 25, "node_label_styl": 25, "omit_sit": 25, "chevron": 25, "342": 25, "viz_ts_small_mut": 25, "site_descr": 25, "13963": 25, "619": 25, "6499091610359": 25, "370": 25, "24979591084764": 25, "6295": 25, "all_edge_mut": 25, "fall": 25, "terribl": 25, "intuitu": 25, "nd_label": 25, "manipul": 25, "cascad": 25, "sheet": 25, "programmat": 25, "css_string": 25, "clearer": 25, "p0": 25, "p1": 25, "p2": 25, "divis": 25, "substructur": 25, "hood": 25, "579": 25, "rgt": 25, "lft": 25, "justif": 25, "a10": 25, "i3": 25, "m16": 25, "m17": 25, "s15": 25, "s16": 25, "s17": 25, "a15": 25, "2px": [25, 26], "programat": 25, "gradual": 25, "disappear": 25, "central": 25, "ts_select": 25, "viz_ts_select": 25, "css_edge_target": 25, "sweep_loc": 25, "focal_tre": 25, "wide_tall_fmt": 25, "4e4": 25, "mouseov": 25, "hover": 25, "pseudoclass": 25, "html": [25, 26], "2e": 25, "node_label_css": 25, "hover_exampl": 25, "mut_label_css": 25, "optional_css": 25, "bold": 25, "plotbox": 25, "ccc": 25, "fcc": 25, "3e4": 25, "7e4": 25, "nodeid": 25, "position2416624621tim": 25, "01000sampl": 25, "fsampl": 25, "gsampl": 25, "hsampl": 25, "jsampl": 25, "knodeid": 25, "19nodeid": 25, "24sampl": 25, "csampl": 25, "enodeid": 25, "15sampl": 25, "dsampl": 25, "bsampl": 25, "inodeid": 25, "12sampl": 25, "asampl": 25, "lnodeid": 25, "18nodeid": 25, "20nodeid": 25, "21nodeid": 25, "25nodeid": 25, "26nodeid": 25, "27nodeid": 25, "28sampl": 25, "16nodeid": 25, "15po": 25, "24257": 25, "hpo": 25, "26806": 25, "jpo": 25, "26623": 25, "apo": 25, "25540": 25, "22nodeid": 25, "insid": 25, "img": 25, "tag": 25, "wrapper": 25, "resiz": 25, "5px": 25, "overrid": 25, "7pt": 25, "12px": [25, 26], "10pt": 25, "outsiz": 25, "canva": 25, "rescal": 25, "radic": 25, "radian": 25, "skewi": 25, "rad": 25, "shift_axi": 25, "bigger": 25, "crop": 25, "svg2": [25, 26], "inkscap": 25, "librsvg": 25, "incorrectli": 25, "chromium": 25, "clip": 25, "triangl": 25, "8px": 25, "polygon": 25, "14px": 25, "16px": 25, "hid": 25, "sophist": 25, "hierarch": 25, "a2": 25, "i1": 25, "m0": 25, "s0": 25, "rect": 25, "i2": 25, "t1": 25, "t2": [25, 26], "nest": 25, "thicker": 25, "edge_styl": 25, "n13": 25, "nd_lab": 25, "deliber": 25, "least": 25, "deep": 25, "invis": 25, "default_mut": 25, "grai": 25, "m8_mut": 25, "m8": 25, "selector": 25, "node_style1": 25, "node_style2": 25, "n15": 25, "hide_internal_symlab": 25, "show_leaf_symlab": 25, "viewer": 25, "style_str": 25, "embed": [25, 26], "myuid": 25, "00ff00": 25, "feel": 25, "free": 25, "inspir": 25, "editor": 25, "bitmap": 25, "imagemagick": 25, "configur": 25, "deleg": 25, "misalign": 25, "programm": 25, "headless": 25, "cope": 25, "menu": 25, "arrang": 25, "ungroup": 25, "o": [25, 26], "tree_str": 25, "nbsp": 25, "necessit": 25, "nomin": 25, "force_root_branch": 25, "io": 25, "make_unusual_t": 25, "stringio": 25, "1145014598813": 25, "11067965364865": 25, "75005250750382": 25, "31067154311640": 25, "57331354884652": 25, "08308317451295": 25, "load_text": 25, "pink": 25, "m2": 25, "m3": 25, "m4": 25, "circular": [25, 26], "neither": 25, "nonsampl": [25, 26], "swap_samples_t": 25, "unconnect": 25, "san": 25, "serif": 25, "make_standard_t": 25, "370009": 25, "001": 25, "thin": 25, "argwher": 25, "ediff1d": 25, "hang": 25, "centr": 25, "dddddd": 25, "hsl": 25, "max_root_tim": 25, "260": 25, "pseudo": 25, "make_introgression_t": 25, "base_s": 25, "x_shift": 25, "translatex": 25, "rightward": 25, "250px": 25, "lightgrei": 25, "dasharrai": 25, "3rd": 25, "magenta": 25, "4th": 25, "darkgrei": 25, "5th": 25, "europ": 25, "max_num_tre": 25, "underneath": 25, "compactli": 25, "clonal_mrca": 25, "most_rec": 25, "clonal": 25, "param": 25, "bool": 25, "rtype": 25, "edges_out": 25, "edges_in": 25, "is_full_length_clon": 25, "clonal_nod": 25, "isin": 25, "clonal_t": 25, "ascend": 25, "non_clonal_ancestor": 25, "deleted_edg": 25, "logical_not": 25, "remove_edg": 25, "clonal_tre": 25, "num_children": 25, "1e2": 25, "83": 25, "clone": 25, "ts_simp": 25, "9px": 25, "15px": 25, "13px": 25, "stagger": 25, "trigonometri": 25, "toler": 25, "math": 25, "make_7_tree_4_tip_t": 25, "tip_ord": 25, "minlex_postord": [25, 26], "adjust": 25, "tree_width": 25, "y_step": 25, "20px": 25, "angl": 25, "atan": 25, "ax_mv": 25, "tan": 25, "js": 25, "sucess": 25, "spr": 25, "make_full_arg_for_spr_anim": 25, "00005": 25, "6787": 25, "smc_prime": 25, "anim_svg": 25, "html_string": 25, "src": 25, "v4": 25, "getrelativexi": 25, "var": 25, "_group": 25, "createsvgpoint": 25, "ctm": 25, "getctm": 25, "matrixtransform": 25, "animate_spr": 25, "selectal": 25, "attr": 25, "source_tre": 25, "target_tre": 25, "dur": 25, "delai": 25, "datum": 25, "transform_tre": 25, "buggi": 25, "hierarchi": 25, "src_tree": 25, "alert": 25, "bad": 25, "hack": 25, "parseint": 25, "src_tree_po": 25, "target_tree_po": 25, "src_xy": 25, "target_xi": 25, "movement": 25, "svg_text": 25, "getelementbyid": 25, "innerhtml": 25, "button": 25, "onclick": 25, "position0741138132751000001418911263451315161701412789113451315161701278912143451315161701434512781013151617": 25, "outlin": 25, "graphviz": 25, "variable_edge_width": 25, "drag": 25, "trial": 25, "tradit": 25, "full_arg_t": 25, "dot": 25, "layout": 25, "graphviz_svg": 25, "networkx_graph": 25, "nx_agraph": 25, "to_agraph": 25, "agraph": 25, "nodes_at_time_0": 25, "add_subgraph": 25, "prog": 25, "upon": [25, 26], "get_graphviz_posit": 25, "get_nod": 25, "edge_label": 25, "dark": 25, "node_color": 25, "007700": 25, "font_siz": 25, "node_s": 25, "node_shap": 25, "nodelist": 25, "edgelist": 25, "draw_networkx_label": 25, "font_color": 25, "alphabet": [25, 26], "22ccff": 25, "edgecolor": 25, "draw_networkx_edg": 25, "edge_color": 25, "arrow": 25, "draw_networkx_edge_label": 25, "tricki": 25, "backend_inlin": 25, "set_matplotlib_format": 25, "size_max": 25, "max": 25, "start_siz": 25, "end_siz": 25, "popsim": 25, "consortium": 25, "yml": 25, "spec": 25, "whatis_exampl": [25, 26], "ancestral_popul": 25, "lat": 25, "landscap": 25, "summar": 26, "mathrm": 26, "genome_ord": 26, "style1": 26, "sz": 26, "189": 26, "546": 26, "357": 26, "454": 26, "interconnect": 26, "knowledg": 26, "twelv": 26, "nucleotid": 26, "987": 26, "4g": 26, "51": 26, "108": 26, "417": 26, "496": 26, "569": 26, "617": 26, "731": 26, "822": 26, "863": 26, "907": 26, "highlight": 26, "kept_edg": 26, "style3": 26, "svg1": 26, "00dd00": 26, "billion": 26, "planet": 26, "magnitud": 26, "publish": 26, "expand": 26, "pictur": 26, "1f77b4": 26, "ff7f0e": 26, "2ca02c": 26, "style2": 26, "deduc": 26, "flip": 26, "s_flag": 26, "no_flag": 26, "ts_flip": 26, "19697": 26, "12059": 26, "10172": 26, "9770": 26, "q": 26, "3795": 26, "3215": 26, "1428": 26, "1249": 26, "449": 26, "377": 26, "de": 26, "novo": 26, "perfom": 26, "jump": 26, "straight": 26}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"advanc": [0, 14], "msprime": 0, "topic": 0, "analys": [1, 2], "tree": [1, 2, 3, 6, 9, 17, 20, 21, 22, 25, 26], "sequenc": [1, 3, 6, 17, 20, 21, 22, 25, 26], "comput": [1, 9, 26], "statist": [1, 9, 15], "One": 1, "wai": 1, "multi": 1, "allel": [1, 9], "frequenc": [1, 4], "spectra": 1, "joint": 1, "branch": [1, 4, 15], "length": [1, 4, 15], "zeroth": 1, "final": 1, "entri": 1, "af": 1, "travers": [2, 3], "upward": 2, "inform": [2, 18, 23], "networkx": 2, "calcul": [2, 3], "distanc": 2, "root": [2, 5, 17], "find": 2, "nearest": 2, "neighbor": 2, "parsimoni": 2, "build": [2, 8], "tabl": [2, 13, 21, 22], "miss": 2, "data": [2, 9, 17, 21, 26], "fast": 2, "base": [2, 15, 25], "algorithm": [2, 10], "us": 2, "numba": 2, "todo": [2, 3, 7, 10, 14, 16, 17, 18, 19, 20, 25], "arg": [3, 22], "full": 3, "visual": [3, 25], "local": 3, "ariti": 3, "spr": [3, 22], "recombin": [3, 8, 22], "likelihood": 3, "simplif": [3, 8, 14, 19], "disadvantag": 3, "format": [3, 9, 25], "tskit": [3, 9, 17, 18, 23], "work": [3, 13], "graph": [3, 25], "parent": 3, "node": [3, 8, 17, 21, 22, 25], "child": 3, "other": [3, 11, 25], "analysi": [3, 15, 18, 23], "softwar": 3, "instantan": 4, "bottleneck": 4, "check": 4, "sf": 4, "against": 4, "analyt": 4, "expect": 4, "coalesc": [4, 8], "time": [4, 17], "The": [4, 17], "distribut": 4, "pairwis": 4, "approxim": 4, "site": [4, 9, 21, 22], "spectrum": 4, "margin": 4, "n": 4, "ton": 4, "multipl": [4, 17], "popul": [4, 7, 18, 21, 22], "complet": 5, "forward": [5, 8, 14], "simul": [5, 8, 14, 18, 20], "why": 5, "keep": 5, "input": 5, "i": 5, "e": 5, "initi": 5, "gener": 5, "topolog": [5, 6, 18], "gotcha": 5, "count": 6, "label": [6, 25], "shape": 6, "enumer": 6, "method": [6, 13, 17, 23], "larg": 6, "embed": 6, "over": 6, "demographi": 7, "structur": [7, 25], "migrat": 7, "constant": 7, "chang": [7, 8, 22], "rate": 7, "admixtur": 7, "split": 7, "mass": 7, "size": 7, "growth": 7, "censu": 7, "event": 7, "debug": 7, "definit": 8, "approach": 8, "setup": 8, "core": 8, "step": 8, "inherit": 8, "without": 8, "basic": 8, "exampl": [8, 25], "id": [8, 17, 23, 25], "remov": 8, "intermedi": 8, "larger": [8, 25], "ensur": 8, "more": [8, 25], "complex": 8, "get": 9, "start": 9, "process": [9, 25], "mutat": [9, 12, 14, 15, 21, 22, 25], "genotyp": 9, "window": 9, "save": 9, "export": 9, "newick": 9, "nexu": 9, "vcf": 9, "scikit": 9, "kei": [9, 26], "point": [9, 26], "cover": 9, "abov": 9, "increment": 10, "welcom": 11, "sourc": 11, "help": 11, "run": 11, "tutori": [11, 24], "code": 11, "download": 11, "datafil": 11, "introgress": 12, "locat": 12, "metadata": [13, 17, 21], "read": [13, 26], "schema": 13, "modifi": 13, "view": 13, "raw": 13, "bulk": 13, "binari": 13, "repeat": 14, "invari": 14, "interv": 14, "summari": [14, 15], "technic": 14, "note": 14, "do": 15, "you": 15, "realli": 15, "need": 15, "absenc": 15, "genet": [15, 17, 18, 26], "variat": 15, "pattern": 15, "relationship": 15, "equival": 15, "genealog": [15, 26], "measur": 15, "ar": [15, 17, 25], "less": 15, "noisi": 15, "parallel": 16, "phylogenet": 17, "hint": 17, "phylogeneticist": 17, "alwai": 17, "part": 17, "integ": 17, "edg": [17, 21, 22], "object": 17, "sampl": [17, 22, 25], "attribut": [17, 23], "must": 17, "have": 17, "multiroot": 17, "store": 17, "access": [17, 21], "infer": 18, "further": [18, 23, 26], "advantag": 20, "some": 20, "tip": [20, 23], "edit": [21, 25], "correspond": 21, "between": 21, "overview": 21, "individu": [21, 22], "column": 21, "row": 21, "turn": 21, "sort": 21, "construct": 21, "minor": 21, "major": 21, "terminolog": 22, "concept": 22, "genom": 22, "proven": 22, "ancestr": 22, "r": 23, "index": 23, "jupyt": 23, "notebook": 23, "interact": 23, "librari": 23, "develop": 24, "new": 24, "text": 25, "svg": 25, "ax": 25, "scale": 25, "plot": 25, "which": 25, "shown": 25, "style": 25, "avail": 25, "css": 25, "class": 25, "within": 25, "area": 25, "outsid": 25, "graphic": 25, "element": 25, "dynam": 25, "effect": 25, "transform": 25, "mask": 25, "subtre": 25, "restrict": 25, "about": [25, 26], "convert": 25, "orient": 25, "A": [25, 26], "standard": 25, "ts": 25, "highlight": 25, "leaf": 25, "isol": 25, "fanci": 25, "tick": 25, "gridlin": 25, "simplifi": 25, "3d": 25, "anim": 25, "represent": 25, "demograph": 25, "geographi": 25, "what": 26, "how": 26, "think": 26, "creat": 26, "network": 26, "an": 26, "effici": 26, "encod": 26, "dna": 26, "record": 26, "ancestri": 26, "framework": 26}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.todo": 2, "sphinx": 56}})
\ No newline at end of file
+Search.setIndex({"docnames": ["advanced_msprime", "analysing_tree_sequences", "analysing_trees", "args", "bottlenecks", "completing_forward_sims", "counting_topologies", "demography", "forward_sims", "getting_started", "incremental_algorithms", "intro", "introgression", "metadata", "more_forward_sims", "no_mutations", "parallelization", "phylogen", "popgen", "simplification", "simulation_overview", "tables_and_editing", "terminology_and_concepts", "tskitr", "tutorial_development", "viz", "what_is"], "filenames": ["advanced_msprime.md", "analysing_tree_sequences.md", "analysing_trees.md", "args.md", "bottlenecks.md", "completing_forward_sims.md", "counting_topologies.md", "demography.md", "forward_sims.md", "getting_started.md", "incremental_algorithms.md", "intro.md", "introgression.md", "metadata.md", "more_forward_sims.md", "no_mutations.md", "parallelization.md", "phylogen.md", "popgen.md", "simplification.md", "simulation_overview.md", "tables_and_editing.md", "terminology_and_concepts.md", "tskitr.md", "tutorial_development.md", "viz.md", "what_is.md"], "titles": ["Advanced <strong class=\"program\">msprime</strong> topics", "<em>Analysing tree sequences</em>", "Analysing trees", "ARGs as tree sequences", "Instantaneous Bottlenecks", "Completing forwards simulations", "Counting topologies", "Demography", "Building a forward simulator", "Getting started with <strong class=\"program\">tskit</strong>", "<em>Incremental algorithms</em>", "Welcome!", "Introgression", "Working with Metadata", "<em>Advanced forward simulations</em>", "Do you really need mutations?", "<em>Parallelization</em>", "<code class=\"docutils literal notranslate\"><span class=\"pre\">Tskit</span></code> for phylogenetics", "<code class=\"docutils literal notranslate\"><span class=\"pre\">Tskit</span></code> for population genetics", "<em>Simplification</em>", "Tree sequences and simulation", "Tables and editing", "Terminology &amp; concepts", "Tskit and R", "<em>Developing new tutorials</em>", "Visualization", "What is a tree sequence?"], "terms": {"These": [0, 3, 5, 6, 7, 9, 11, 12, 17, 18, 21, 25, 26], "ar": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 18, 20, 21, 22, 23, 26], "exampl": [0, 1, 2, 3, 5, 6, 7, 9, 10, 11, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 26], "how": [0, 1, 2, 3, 5, 7, 8, 9, 10, 12, 13, 15, 16, 20, 21, 23, 25], "do": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 17, 18, 20, 21, 22, 25, 26], "some": [0, 1, 2, 3, 4, 5, 7, 8, 9, 12, 13, 14, 15, 17, 21, 22, 23, 25, 26], "particular": [0, 1, 3, 7, 8, 9, 12, 17, 21, 22, 23, 25, 26], "thing": [0, 9, 12, 14, 22], "thi": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "chapter": 0, "broken": [0, 8], "down": [0, 2, 3, 8, 9, 12, 14, 18, 25, 26], "follow": [0, 1, 2, 3, 5, 7, 8, 9, 11, 12, 13, 15, 17, 20, 21, 23, 25, 26], "section": [0, 1, 3, 5, 6, 9, 12, 14, 17, 18, 21, 22, 25], "demographi": [0, 4, 6, 12, 15, 20, 25, 26], "instantan": 0, "bottleneck": [0, 7], "introgress": [0, 25], "For": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "discuss": [0, 11, 13, 14, 21, 22, 25, 26], "other": [0, 1, 2, 4, 6, 8, 9, 12, 14, 17, 18, 21, 22, 26], "you": [0, 1, 3, 5, 6, 7, 8, 9, 11, 13, 14, 17, 18, 20, 21, 22, 23, 25, 26], "might": [0, 2, 3, 6, 7, 8, 9, 12, 14, 15, 16, 17, 22, 25, 26], "also": [0, 1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "want": [0, 1, 2, 3, 5, 6, 7, 8, 12, 13, 14, 17, 18, 20, 21, 22, 25, 26], "look": [0, 8, 9, 12, 14, 15, 17, 18, 20, 21, 22, 25, 26], "forum": [0, 11], "tutori": [1, 3, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 25, 26], "work": [1, 2, 4, 5, 7, 8, 9, 11, 12, 15, 16, 21, 23, 25], "progress": [1, 8, 11], "tskit": [1, 2, 4, 5, 6, 8, 10, 11, 12, 13, 14, 15, 16, 19, 21, 22, 25, 26], "provid": [1, 2, 5, 6, 7, 8, 9, 10, 11, 15, 16, 17, 18, 21, 22, 23, 25, 26], "an": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25], "extens": [1, 16, 17, 21, 25, 26], "flexibl": [1, 3, 17, 18, 25], "interfac": [1, 16, 21, 23, 25], "popul": [1, 3, 5, 6, 8, 9, 12, 13, 14, 15, 17, 20, 23, 25, 26], "genet": [1, 3, 5, 6, 8, 9, 11, 12, 20, 22, 23], "which": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 26], "document": [1, 5, 6, 8, 13, 21, 23, 25, 26], "detail": [1, 3, 5, 8, 9, 13, 14, 17, 20, 21, 22, 25, 26], "gener": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 20, 22, 23, 25, 26], "offic": [1, 26], "aim": [1, 9, 11, 15], "give": [1, 2, 4, 6, 8, 9, 12, 15, 16, 17, 20, 21, 22, 25], "quick": [1, 9, 17, 25], "overview": [1, 17], "api": [1, 2, 7, 9, 13, 16, 17, 18, 21, 22], "us": [1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "them": [1, 2, 3, 7, 8, 9, 11, 12, 14, 15, 17, 20, 21, 22, 25, 26], "effect": [1, 3, 4, 7, 8, 9, 12, 14, 15, 16, 17, 22, 26], "first": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 21, 22, 23, 25, 26], "let": [1, 2, 6, 7, 8, 9, 23], "s": [1, 2, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "load": [1, 2, 9, 11, 13, 16, 18, 21, 22, 25, 26], "ha": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 15, 16, 17, 18, 21, 22, 23, 25, 26], "roughli": 1, "human": [1, 7, 8, 12, 15, 18, 22, 26], "paramet": [1, 2, 3, 4, 7, 8, 9, 12, 14, 15, 20, 23, 25], "10": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "thousand": [1, 9, 15, 18, 22], "sampl": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 18, 20, 21, 23, 26], "10mb": [1, 9], "chromosom": [1, 3, 5, 6, 7, 8, 9, 12, 18, 20, 21, 22, 26], "ts": [1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 23, 26], "data": [1, 3, 4, 6, 11, 12, 13, 15, 16, 18, 20, 22, 23, 25], "computing_statist": 1, "trees36599": 1, "length10000000": [1, 9], "0": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "time": [1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 21, 22, 23, 25, 26], "unitsunknown": [1, 17], "nodes10000": 1, "total": [1, 2, 4, 6, 7, 9, 12, 17, 22, 23], "size9": 1, "5": [1, 2, 3, 4, 5, 6, 7, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25, 26], "mib": [1, 9], "metadatano": [1, 7, 9, 17, 22, 23], "metadata": [1, 6, 7, 8, 9, 12, 14, 18, 22, 23, 25], "tabl": [1, 3, 5, 7, 8, 9, 12, 14, 17, 23, 25, 26], "row": [1, 7, 8, 9, 12, 13, 17, 18, 22, 23], "size": [1, 2, 3, 4, 6, 8, 9, 12, 14, 15, 17, 18, 20, 22, 23, 25, 26], "edg": [1, 2, 3, 5, 7, 8, 9, 14, 23, 25, 26], "157894": 1, "4": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25, 26], "8": [1, 2, 3, 4, 7, 9, 12, 15, 17, 18, 21, 22, 23, 25, 26], "individu": [1, 3, 5, 7, 8, 9, 11, 13, 14, 15, 17, 18, 23, 25], "24": [1, 2, 9, 15, 17, 18], "byte": [1, 7, 9, 13, 17, 21, 22, 23], "migrat": [1, 9, 12, 17, 18, 21, 22, 23, 26], "mutat": [1, 2, 3, 4, 7, 8, 17, 20, 23, 26], "38778": 1, "1": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 23, 25, 26], "node": [1, 2, 4, 5, 6, 7, 9, 12, 14, 18, 23, 26], "44864": 1, "2": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "16": [1, 2, 5, 7, 8, 9, 17, 18, 22, 23, 25], "proven": [1, 7, 9, 13, 17, 21, 23], "kib": [1, 7, 9, 22, 23], "site": [1, 2, 3, 6, 7, 11, 12, 13, 14, 15, 17, 18, 23, 25, 26], "946": 1, "7": [1, 2, 3, 5, 7, 8, 9, 12, 14, 15, 17, 18, 22, 23, 25, 26], "36": [1, 9, 17], "6": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 17, 18, 21, 22, 23, 25, 26], "39": [1, 2, 9, 12, 17, 18], "segreg": 1, "we": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "d": [1, 3, 4, 15, 17, 18, 21, 25, 26], "now": [1, 2, 5, 6, 7, 8, 9, 12, 13, 14, 18, 21, 23, 26], "like": [1, 3, 4, 6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 25, 26], "dataset": [1, 12, 16, 17, 18, 20, 22, 25, 26], "refer": [1, 3, 5, 8, 9, 12, 14, 17, 21, 22, 26], "defin": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 15, 17, 18, 21, 22, 23, 25, 26], "respect": [1, 5, 8, 14, 17, 21, 25], "singl": [1, 2, 3, 4, 6, 7, 8, 9, 12, 16, 17, 18, 21, 22, 23, 25, 26], "set": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 22, 23, 25, 26], "one": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 16, 17, 21, 22, 23, 25, 26], "divers": [1, 4, 8, 9, 12, 15, 18, 23, 25], "treesequ": [1, 3, 6, 8, 9, 10, 13, 17, 18, 21, 22, 23, 25], "method": [1, 2, 3, 5, 7, 8, 9, 10, 15, 18, 20, 21, 22, 25, 26], "print": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "averag": [1, 6, 9, 12, 15], "per": [1, 3, 5, 7, 8, 9, 14, 25], "unit": [1, 4, 8, 12, 17, 23], "3g": 1, "tell": [1, 3, 15, 22, 25], "across": [1, 15, 16, 17, 21, 22, 25], "whole": [1, 4, 12, 18, 22, 26], "return": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 21, 22, 23, 25], "number": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "ll": [1, 2, 7, 8, 9, 13, 21, 22, 23], "usual": [1, 5, 8, 9, 12, 15, 18, 22], "window": [1, 3, 15, 17, 18, 25], "along": [1, 2, 3, 8, 9, 14, 15, 17, 18, 21, 22, 25, 26], "genom": [1, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 18, 20, 21, 23, 25, 26], "argument": [1, 5, 7, 25], "np": [1, 3, 4, 5, 7, 8, 9, 12, 14, 15, 21, 25, 26], "linspac": [1, 9, 15], "sequence_length": [1, 3, 6, 7, 8, 9, 12, 13, 14, 15, 18, 21, 22, 23, 25], "num": [1, 9, 15], "sep": 1, "n": [1, 2, 3, 5, 6, 7, 8, 9, 13, 15, 18, 21, 22, 23, 25, 26], "2500000": 1, "5000000": 1, "7500000": 1, "10000000": [1, 9, 23], "00040717": 1, "00040891": 1, "00041644": 1, "00039899": 1, "The": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 21, 22, 23, 25, 26], "take": [1, 2, 3, 5, 6, 8, 9, 12, 15, 17, 20, 21, 22, 23, 25], "numpi": [1, 3, 4, 5, 7, 8, 9, 11, 12, 14, 15, 16, 17, 21, 25, 26], "arrai": [1, 2, 3, 4, 7, 8, 9, 12, 14, 15, 17, 21, 23, 25, 26], "specifi": [1, 2, 4, 6, 7, 8, 9, 13, 17, 20, 21, 22, 25], "breakpoint": [1, 3, 8, 14, 22, 26], "here": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "creat": [1, 2, 3, 5, 6, 7, 8, 9, 10, 13, 15, 17, 19, 21, 22, 25], "four": [1, 6, 21], "equal": [1, 4, 7, 8, 13, 14, 15, 21, 22], "space": [1, 6, 16, 20, 22, 25], "megabas": [1, 3, 15, 26], "contain": [1, 3, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25], "k": [1, 12, 25, 26], "element": [1, 6, 7, 17, 18, 21], "becaus": [1, 3, 5, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 25, 26], "have": [1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 18, 20, 21, 22, 25, 26], "ask": [1, 9, 12], "valu": [1, 2, 3, 4, 5, 6, 7, 9, 14, 17, 20, 21, 22, 25, 26], "rather": [1, 3, 5, 6, 8, 9, 12, 15, 16, 17, 21, 22, 25, 26], "than": [1, 2, 3, 6, 7, 8, 9, 12, 15, 16, 17, 21, 22, 23, 25, 26], "see": [1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26], "output": [1, 2, 3, 5, 7, 8, 9, 17, 18, 20, 25], "dimens": [1, 9, 21, 22], "full": [1, 8, 9, 13, 20, 21, 22, 25, 26], "descript": [1, 2, 5, 7, 9, 13, 21, 22], "determin": [1, 4, 21, 22], "suppos": [1, 7], "within": [1, 3, 8, 9, 11, 12, 14, 17, 18, 23, 26], "specif": [1, 2, 3, 7, 9, 17, 18, 20, 21, 22, 25, 26], "subset": [1, 6, 9, 12], "can": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "sample_set": [1, 6, 15, 18], "A": [1, 2, 3, 4, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 21, 22, 23], "100": [1, 3, 5, 6, 7, 8, 12, 14, 15, 21, 22, 25], "00041007806060604034": 1, "ve": [1, 5, 7, 9, 12, 13, 14, 21, 25], "hundr": [1, 8, 26], "As": [1, 3, 5, 6, 7, 9, 11, 12, 15, 17, 18, 21, 25, 26], "ani": [1, 3, 4, 5, 6, 7, 8, 13, 14, 17, 21, 22, 25, 26], "again": [1, 2, 4, 6, 8, 9, 21], "multipl": [1, 3, 7, 8, 9, 10, 16, 18, 21, 22, 25, 26], "same": [1, 2, 3, 5, 6, 7, 8, 9, 10, 12, 13, 14, 17, 21, 22, 25, 26], "list": [1, 2, 3, 6, 7, 8, 9, 11, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "b": [1, 4, 5, 6, 7, 13, 17, 21, 22, 23, 25, 26], "200": [1, 6, 7, 8, 9, 13, 14, 25], "c": [1, 2, 3, 4, 6, 8, 9, 11, 15, 16, 17, 18, 21, 23, 25, 26], "300": [1, 2, 3, 8, 12, 22, 25], "00041008": 1, "00040893": 1, "00040853": 1, "concurr": 1, "three": [1, 2, 3, 4, 6, 7, 12, 21, 22], "differ": [1, 2, 3, 4, 6, 7, 8, 9, 10, 12, 14, 15, 17, 18, 21, 22, 23, 25, 26], "therefor": [1, 3, 5, 6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 25], "In": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "input": [1, 2, 21], "rule": 1, "shape": [1, 9, 25], "3": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 18, 21, 22, 23, 25], "00041199": 1, "00040542": 1, "00040588": 1, "00040889": 1, "00041216": 1, "00041419": 1, "00041636": 1, "00041463": 1, "0004128": 1, "00040307": 1, "0004035": 1, "00040126": 1, "our": [1, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 21, 22, 23, 26], "2d": 1, "column": [1, 7, 8, 13, 18], "each": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "mani": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 14, 15, 16, 17, 18, 20, 21, 22, 23, 25, 26], "compar": [1, 3, 5, 6, 12, 15, 20, 21, 22, 25, 26], "diverg": [1, 4, 7, 12, 15, 17], "between": [1, 3, 5, 7, 8, 9, 10, 12, 14, 15, 16, 17, 18, 22, 23, 25, 26], "two": [1, 3, 4, 5, 6, 7, 8, 9, 12, 15, 17, 18, 20, 21, 22, 25], "0004059772800000012": 1, "float": [1, 22, 23, 25], "point": [1, 2, 3, 7, 8, 14, 15, 20, 21, 22, 23, 25], "result": [1, 2, 3, 4, 5, 8, 9, 11, 12, 14, 15, 17, 22, 25, 26], "befor": [1, 2, 3, 4, 6, 7, 8, 12, 14, 21], "00040787": 1, "00040481": 1, "00041219": 1, "00039904": 1, "power": [1, 4, 8, 9, 12, 15, 18, 23, 26], "featur": [1, 17, 25, 26], "stat": [1, 17, 18], "simultan": [1, 4], "index": [1, 4, 6, 9, 17, 21, 25], "00040598": 1, "00040943": 1, "pair": [1, 4, 8, 18, 22, 26], "interest": [1, 4, 7, 9, 12, 13, 15, 18, 22, 26], "combin": [1, 2, 3, 5, 6, 18, 20, 21, 22, 25, 26], "00040834": 1, "00041207": 1, "00041464": 1, "00040267": 1, "correspond": [1, 2, 3, 9, 15, 25, 26], "chosen": [1, 8, 9, 21, 25], "If": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 15, 18, 20, 21, 22, 23, 25, 26], "1d": 1, "interpret": [1, 3, 7, 13, 16, 22], "remov": [1, 5, 9, 12, 13, 16, 17, 18, 21, 23, 25], "empti": [1, 13, 17, 18, 21, 25], "outer": 1, "It": [1, 2, 3, 6, 7, 8, 9, 11, 14, 15, 17, 20, 21, 22, 23, 25, 26], "import": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "note": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 13, 17, 18, 21, 22, 23, 25, 26], "don": [1, 2, 9, 12, 13, 22, 25, 26], "t": [1, 2, 3, 4, 5, 7, 8, 9, 12, 13, 15, 17, 21, 22, 23, 25, 26], "onli": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 21, 22, 23, 25, 26], "explicitli": [1, 15, 17, 25], "keep": [1, 3, 8, 14, 21, 22, 23, 25], "wish": [1, 3, 7, 8, 11, 16, 21, 26], "pleas": [1, 5, 11, 14], "spectrum": [1, 9, 15, 18], "fundament": [1, 3, 4, 9, 26], "tool": [1, 8, 9, 18, 21, 25], "approach": [1, 2, 4, 5, 10, 12, 15, 17, 20, 26], "simul": [1, 2, 3, 4, 6, 7, 9, 12, 15, 16, 17, 21, 22, 23, 25, 26], "from": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "ipython": [1, 4, 6, 25], "displai": [1, 3, 4, 6, 17, 18, 22, 23, 25], "draw_svg": [1, 2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 17, 18, 21, 22, 23, 25, 26], "idpositionancestral_statemetadata": [1, 21], "00": [1, 3, 6, 13, 25], "300436430": 1, "322207940": 1, "20": [1, 2, 3, 4, 8, 9, 12, 13, 15, 17, 18, 21, 22, 23, 25], "365070270": 1, "30": [1, 7, 8, 9, 12, 17, 18, 22, 25], "509402550": 1, "40": [1, 3, 8, 9, 17, 21, 25], "513271370": 1, "50": [1, 4, 7, 8, 12, 14, 17, 21, 23, 25], "514008610": 1, "60": [1, 3, 21, 25], "547961100": 1, "70": [1, 3, 7, 12, 22, 25], "759294040": 1, "80": [1, 3, 7, 23, 25], "805918000": 1, "90": [1, 3, 12, 23], "923242080": 1, "easi": [1, 7, 8, 17, 18, 21, 22, 25], "allele_frequency_spectrum": [1, 4, 9, 15, 18], "polaris": [1, 4, 9, 15], "true": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "span_normalis": [1, 4], "fals": [1, 3, 4, 8, 9, 13, 14, 21, 25], "singleton": [1, 4, 9, 21], "six": [1, 3, 22], "doubleton": [1, 4], "ton": 1, "doe": [1, 3, 4, 6, 7, 13, 16, 17, 22, 25], "below": [1, 2, 3, 4, 6, 7, 8, 9, 14, 15, 17, 18, 21, 22, 23, 25, 26], "why": [1, 2, 3, 7, 9, 16], "know": [1, 2, 5, 6, 7, 9, 12, 15, 17, 21, 22, 23, 25, 26], "ancestr": [1, 2, 3, 5, 7, 9, 11, 12, 17, 18, 21, 25, 26], "deriv": [1, 4, 7, 12, 18, 21], "state": [1, 2, 3, 7, 9, 21, 22, 25], "get": [1, 2, 5, 7, 8, 12, 13, 14, 16, 17, 18, 22, 23, 25, 26], "fold": [1, 9], "simpl": [1, 3, 4, 5, 7, 8, 9, 12, 13, 15, 16, 17, 18, 21, 25, 26], "count": [1, 8, 9, 12, 14, 17, 18, 23, 26], "default": [1, 2, 3, 5, 6, 7, 8, 9, 14, 15, 17, 21, 25, 26], "divid": [1, 7], "so": [1, 2, 3, 5, 6, 7, 8, 9, 12, 14, 15, 17, 21, 22, 23, 25, 26], "thei": [1, 2, 3, 4, 5, 6, 8, 12, 14, 17, 18, 21, 22, 25, 26], "actual": [1, 9, 12, 15, 20, 21, 22, 25, 26], "perform": [1, 2, 7, 9, 10, 13, 14, 15, 16, 17, 21, 25, 26], "half": [1, 17, 21], "abov": [1, 2, 3, 4, 5, 7, 8, 13, 14, 15, 17, 18, 21, 22, 25, 26], "tripleton": [1, 4], "node_colour": [1, 2, 25], "blue": [1, 2, 3, 4, 6, 7, 12, 25, 26], "green": [1, 2, 6, 7, 12, 18, 25], "style": [1, 2, 3, 6, 7, 12, 18, 22, 23, 26], "f": [1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "sym": [1, 2, 3, 6, 7, 12, 18, 25, 26], "fill": [1, 2, 3, 6, 7, 8, 12, 18, 21, 25, 26], "v": [1, 2, 3, 9, 12, 18, 21, 25], "item": [1, 2, 3, 4, 6, 7, 12, 18, 25], "join": [1, 2, 3, 5, 6, 7, 9, 12, 18, 25, 26], "mark": [1, 3, 9, 17, 21, 22, 25, 26], "either": [1, 3, 4, 6, 9, 12, 14, 21, 22, 23, 25], "imagin": [1, 8, 22, 26], "belong": [1, 7, 9, 17, 18, 21, 22, 25, 26], "base": [1, 3, 4, 5, 7, 9, 18, 22, 23, 26], "where": [1, 2, 5, 7, 8, 9, 12, 14, 17, 20, 21, 22, 25, 26], "both": [1, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 16, 17, 20, 21, 22, 25], "present": [1, 4, 5, 8, 15, 17, 21, 22, 25, 26], "up": [1, 2, 3, 7, 9, 12, 17, 21, 22, 25, 26], "summaris": [1, 25], "occur": [1, 8, 9, 12, 14, 17, 21, 22, 25, 26], "subtend": [1, 15, 25], "given": [1, 2, 3, 7, 9, 12, 14, 17, 21, 22, 23, 25], "mode": [1, 4, 9, 15, 17], "86089166": 1, "39638988": 1, "55239269": 1, "07444286": 1, "thu": [1, 2, 4, 12, 14, 22, 25], "over": [1, 2, 3, 5, 8, 9, 12, 14, 15, 16, 18, 21, 22, 23, 25, 26], "86": 1, "signific": 1, "when": [1, 2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 21, 22, 23, 25, 26], "all": [1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 21, 22, 23, 25, 26], "33184862": 1, "30022646": 1, "252042": 1, "25": [1, 4, 9, 12, 13, 14, 17, 18, 21, 25], "what": [1, 2, 3, 5, 8, 9, 11, 12, 14, 15, 17, 20, 21, 22, 25], "33": [1, 3, 9, 14, 17, 21, 25], "signifi": 1, "By": [1, 6, 7, 8, 9, 10, 12, 14, 15, 21, 25], "includ": [1, 3, 8, 9, 11, 12, 14, 15, 18, 20, 21, 22, 23, 25], "maintain": [1, 2], "properti": [1, 3, 5, 12, 13, 14, 22, 25], "sum": [1, 2, 4, 6, 12, 25], "alwai": [1, 2, 3, 6, 9, 15, 21, 22, 25], "len": [1, 2, 4, 6, 8, 9, 12, 14, 17, 21, 25], "total_branch_length": [1, 2], "14": [1, 3, 9, 14, 17, 18, 25], "884117086717392": 1, "884117086717396": 1, "similar": [1, 3, 4, 5, 6, 11, 12, 25, 26], "still": [1, 3, 5, 6, 8, 11, 14, 15, 23, 25], "polymorph": 1, "entir": [1, 5, 6, 8, 9, 13, 15, 16, 17, 18, 20, 21, 22, 25, 26], "howev": [1, 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 22, 23, 25, 26], "fix": [1, 6, 7], "among": [1, 21], "e": [1, 2, 3, 4, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "g": [1, 2, 3, 4, 5, 6, 8, 9, 10, 12, 13, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "ones": [1, 3, 11, 21, 25], "root": [1, 3, 4, 6, 8, 9, 12, 23, 25], "There": [2, 3, 5, 6, 7, 9, 12, 17, 20, 21, 22, 26], "wai": [2, 3, 7, 8, 9, 11, 14, 15, 16, 17, 21, 22, 23, 25, 26], "most": [2, 3, 8, 9, 11, 12, 13, 15, 17, 21, 22, 25, 26], "involv": [2, 3, 6, 7, 8, 9, 12, 17, 20, 21, 22, 25, 26], "sort": [2, 3, 4, 5, 7, 8, 12, 14, 15, 17, 18, 26], "branch": [2, 3, 5, 6, 7, 8, 9, 17, 22, 25, 26], "variou": [2, 5, 9, 11, 17, 18, 21, 25], "through": [2, 3, 5, 9, 12, 14, 17, 21, 23, 25, 26], "built": [2, 3, 9, 17, 20, 21, 26], "phylogenet": [2, 23, 26], "map_mut": [2, 15, 21], "effic": [2, 8], "place": [2, 3, 12, 21, 22, 25, 26], "charact": 2, "terminolog": [2, 9, 12, 17, 26], "order": [2, 3, 5, 6, 7, 8, 9, 12, 17, 21, 22, 25, 26], "possibl": [2, 3, 5, 6, 9, 11, 14, 15, 18, 21, 22, 25, 26], "iter": [2, 3, 6, 8, 9, 14, 21, 22, 26], "tree_travers": 2, "visit": [2, 3, 18], "preorder": [2, 17], "inord": 2, "postord": [2, 17], "much": [2, 8, 9, 10, 11, 12, 21, 22, 23, 25, 26], "leav": [2, 6, 8, 12, 15, 17, 25], "out": [2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 17, 20, 21, 23, 25, 26], "comput": [2, 5, 11, 12, 18, 20, 22, 23], "length": [2, 3, 6, 8, 9, 12, 14, 17, 21, 22, 23, 25, 26], "branch_length": [2, 4, 17], "u": [2, 3, 4, 5, 6, 7, 14, 17, 18, 25, 26], "avail": [2, 12, 17], "attribut": [2, 3, 9, 13, 21, 22, 25], "applic": 2, "abl": [2, 11, 14, 15], "parent": [2, 4, 8, 13, 14, 17, 21, 22, 25, 26], "path": [2, 3, 8, 14, 25], "while": [2, 3, 4, 5, 8, 12, 14, 15, 16, 20, 22, 25], "null": [2, 4, 9, 20, 21, 25], "append": [2, 8, 9, 12, 14, 21, 25], "sometim": [2, 3, 5, 15, 22, 25, 26], "need": [2, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, 17, 18, 20, 21, 22, 23, 25, 26], "about": [2, 3, 4, 7, 9, 11, 12, 15, 17, 18, 21, 22], "done": [2, 3, 5, 7, 8, 9, 11, 12, 13, 22, 23, 25], "recurs": [2, 4], "often": [2, 3, 8, 9, 14, 15, 16, 17, 20, 21, 22, 25, 26], "more": [2, 3, 4, 5, 6, 7, 9, 12, 13, 14, 15, 17, 20, 21, 22, 23, 24], "conveni": [2, 4, 6, 8, 17, 21, 22], "effici": [2, 3, 6, 8, 9, 10, 13, 17, 18, 20, 21, 22, 23], "yield": 2, "def": [2, 3, 4, 5, 6, 8, 12, 14, 15, 25], "preorder_dist": 2, "stack": [2, 21, 25], "pop": [2, 8, 12, 14, 18], "children": [2, 3, 6, 17, 22, 25], "network": [2, 17], "analysi": [2, 6, 8, 9, 13, 17, 22, 25], "sizeabl": 2, "librari": [2, 8, 9, 11, 16, 17, 18, 22, 25, 26], "achiev": [2, 17, 21], "call": [2, 3, 5, 6, 7, 9, 13, 14, 17, 18, 21, 22, 23, 25], "as_dict_of_dict": 2, "convert": [2, 3, 9, 21, 23], "instanc": [2, 5, 6, 7, 8, 9, 12, 13, 14, 17, 20, 21, 22, 23, 25], "format": [2, 11, 17, 18, 20, 21, 23, 26], "graph": [2, 11, 22, 26], "nx": [2, 3, 25], "digraph": [2, 3, 25], "revisit": 2, "depth": [2, 12], "search": [2, 3], "child": [2, 5, 6, 8, 14, 17, 21, 22, 25, 26], "_": [2, 5, 8, 14], "edge_df": 2, "sourc": [2, 3, 7, 9, 12, 25, 26], "orient": 2, "revers": [2, 3, 9, 12, 26], "similarli": [2, 9, 13, 18], "pre": [2, 11, 25], "well": [2, 3, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 21, 22, 25, 26], "run": [2, 5, 6, 7, 8, 9, 12, 14, 15, 20, 22, 23], "shortest_path_length": 2, "bit": [2, 9, 14, 15, 25], "instead": [2, 3, 5, 6, 8, 13, 17, 18, 21, 22, 25, 26], "write": [2, 9, 11, 13, 14], "own": [2, 8, 10, 11, 14, 17, 18, 22, 25], "code": [2, 3, 7, 8, 9, 14, 15, 16, 17, 21, 25, 26], "draw": [2, 3, 7, 9, 12, 17, 22, 23, 25], "start": [2, 4, 6, 7, 8, 11, 12, 14, 17, 18, 21, 22, 23, 25, 26], "were": [2, 22, 25, 26], "different_time_sampl": 2, "y_axi": [2, 3, 4, 6, 8, 12, 17, 18, 21, 22, 23, 25, 26], "time_scal": [2, 6, 12, 22, 25], "rank": [2, 6, 17, 25], "00539877826333": 2, "17": [2, 3, 5, 9, 17, 18, 25], "833492457579652": 2, "35": [2, 9, 14, 17], "apart": [2, 3, 20, 25], "even": [2, 3, 5, 8, 9, 14, 17, 20, 21, 22, 25, 26], "though": [2, 3, 8, 22], "almost": [2, 15], "closer": 2, "easier": [2, 8, 14, 21, 22, 25], "treat": [2, 3, 7, 9, 14, 22, 23, 25], "undirect": 2, "annot": [2, 3, 25], "0053987782633306836": 2, "1719063206836786": 2, "field": [2, 13, 17, 18, 21], "weight": [2, 6, 15, 25], "shortest": 2, "collect": [2, 12, 14, 18, 20, 21, 22, 25], "itertool": [2, 3], "dictionari": [2, 8], "repres": [2, 3, 5, 8, 9, 17, 21, 22, 25, 26], "matrix": [2, 7, 9, 23, 26], "dist_dod": 2, "defaultdict": [2, 12], "dict": [2, 3, 8, 13, 14, 18, 21, 25], "target": [2, 3, 25], "extract": [2, 7, 9, 12, 18, 21, 25], "nearest_neighbor_of": 2, "min": [2, 3, 18, 25], "kei": [2, 6, 8, 13, 14, 21], "rang": [2, 3, 4, 5, 6, 8, 9, 14, 15, 18, 20, 25, 26], "zip": [2, 6, 8, 12, 14, 17, 18, 21, 25, 26], "allel": [2, 3, 15, 18, 21, 22, 25, 26], "colour": [2, 3, 6, 7, 12, 18, 25, 26], "possess": [2, 9, 22], "posit": [2, 3, 8, 9, 12, 14, 15, 17, 18, 21, 22, 25, 26], "caus": [2, 5, 13, 22, 25], "variat": [2, 3, 4, 9, 12, 17, 20, 21, 26], "parsimony_simpl": 2, "red": [2, 3, 4, 6, 7, 12, 18, 21, 22, 25], "genotyp": [2, 3, 21, 23], "j": [2, 4, 5, 26], "enumer": [2, 3, 4, 9, 12, 15, 21, 26], "explan": [2, 7, 22, 25], "discret": [2, 4, 5, 7, 8, 22], "observ": [2, 3, 12, 15, 20, 21, 26], "classic": [2, 3, 9], "ancestral_st": [2, 9, 17, 21, 22, 25, 26], "mut": [2, 3, 12, 21, 22, 25, 26], "derived_st": [2, 17, 21, 22, 25, 26], "case": [2, 3, 5, 7, 8, 12, 14, 15, 17, 18, 21, 22, 23, 25], "conclud": 2, "quit": [2, 5, 6, 7, 9, 12, 14, 25], "reason": [2, 3, 5, 6, 7, 8, 16, 17, 20, 21, 22, 25], "wa": [2, 3, 5, 7, 8, 13, 15, 21, 22, 25, 26], "show": [2, 3, 4, 5, 7, 8, 9, 11, 12, 14, 15, 16, 18, 21, 22, 23, 25, 26], "updat": [2, 9, 16, 26], "advantag": [2, 5, 18, 25], "identifi": [2, 3, 6, 9, 12, 14, 17, 20, 21, 25], "pickl": [2, 16], "parsimony_map": 2, "500": [2, 3, 6, 7, 8, 12, 14, 18, 21, 25, 26], "modifi": [2, 7, 8, 17, 21, 25], "ad": [2, 5, 7, 8, 12, 13, 14, 15, 20, 21, 22, 25], "To": [2, 3, 6, 7, 8, 9, 12, 13, 15, 17, 20, 21, 22, 23, 25], "locat": [2, 3, 7, 9, 13, 18, 21, 22, 25, 26], "infer": [2, 3, 4, 9, 15, 20, 22, 26], "associ": [2, 3, 6, 8, 13, 16, 17, 21, 22, 23, 25, 26], "convent": [2, 8, 9, 15, 21, 25], "encod": [2, 3, 13, 17, 18, 21, 22], "open": [2, 11, 25], "rb": 2, "file": [2, 9, 11, 13, 15, 17, 18, 21, 22, 23, 25, 26], "save": [2, 7, 8, 12, 26], "variant": [2, 3, 9, 18, 21, 26], "i": [2, 3, 4, 6, 8, 9, 12, 13, 14, 15, 17, 18, 21, 22, 25, 26], "po": [2, 3, 9, 14, 25], "4f": 2, "anywai": 2, "dump_tabl": [2, 12, 17, 21, 25, 26], "site_id": [2, 21], "add_row": [2, 5, 8, 13, 14, 21], "info": [2, 9], "parent_offset": 2, "mut_id": 2, "new_t": [2, 9, 17], "tree_sequ": [2, 5, 6, 8, 12, 14, 17, 21, 25, 26], "3726": 2, "4759": 2, "34": [2, 9, 17], "3178": 2, "2118": 2, "44": [2, 12, 17], "0257": 2, "48": [2, 25], "0932": 2, "68": [2, 14], "4830": 2, "69": [2, 17, 25], "4755": 2, "71": [2, 21], "2330": 2, "9": [2, 3, 4, 5, 9, 12, 13, 15, 17, 18, 22, 23, 25, 26], "9150": 2, "And": [2, 7, 8, 9, 25], "mut_label": [2, 21, 25, 26], "label": [2, 3, 4, 7, 8, 12, 17, 18, 21, 22, 23, 26], "make": [2, 3, 7, 8, 9, 13, 14, 17, 20, 21, 25, 26], "pretti": [2, 7, 8, 21, 25, 26], "chang": [2, 3, 4, 6, 9, 13, 14, 17, 18, 21, 25, 26], "older_mut": [2, 21, 25, 26], "older": [2, 3, 21, 25, 26], "prev": [2, 21, 25, 26], "els": [2, 6, 8, 9, 17, 21, 25, 26], "id": [2, 3, 5, 6, 7, 9, 12, 13, 14, 15, 18, 21, 22, 26], "mutation_label": [2, 3, 21, 25, 26], "account": [2, 6, 9, 12, 15, 17, 20], "transit": [2, 21, 25], "special": [2, 7, 22, 25], "missing_data": [2, 21], "could": [2, 8, 14, 15, 17, 18, 21, 22, 25], "anyth": [2, 9], "indic": [2, 12, 21, 25, 26], "white": [2, 25], "appli": [2, 7, 8, 12, 17, 25], "hartigan": 2, "decid": 2, "would": [2, 5, 9, 11, 12, 14, 15, 17, 20, 21, 22], "imput": 2, "littl": [2, 3, 4, 6], "surpris": [2, 9], "consid": [2, 4, 10, 15, 17, 21], "msprime": [2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 15, 17, 18, 20, 21, 22, 23, 25], "random_se": [2, 3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 17, 21, 23, 25], "42": [2, 8, 14, 17, 21, 23, 25], "put": [2, 12, 14, 22, 25], "expect": [2, 3, 7, 8, 9, 12, 14, 15, 20, 21, 23, 25], "rememb": 2, "minimis": 2, "mai": [2, 3, 4, 5, 7, 8, 9, 12, 13, 14, 15, 16, 17, 21, 25, 26], "add": [2, 3, 7, 8, 9, 13, 14, 15, 17, 20, 21, 23, 24, 25], "few": [2, 8, 12, 13, 15, 20, 22, 23, 25, 26], "speed": [2, 6, 17, 18, 22, 26], "dynam": [2, 26], "program": [2, 9, 11, 25, 26], "good": [2, 4, 7, 14, 15, 20, 25], "issu": [2, 10, 11, 12, 14, 16, 17, 19, 20, 25], "63": [2, 7, 18], "At": [3, 8, 9, 12, 21], "its": [3, 4, 8, 9, 13, 17, 18, 21, 22, 25], "heart": 3, "consist": [3, 6, 7, 8, 17, 21, 22, 25], "connect": [3, 8, 15, 21, 22, 25], "succinct": [3, 11, 17, 18, 26], "equival": [3, 6, 7, 8, 12, 17, 21, 23, 25], "direct": [3, 11, 13, 17, 22, 23, 25], "addition": [3, 9, 18, 21], "exist": [3, 5, 8, 9, 11, 12, 13, 15, 17, 18, 21, 22, 25, 26], "tightli": 3, "concept": [3, 8, 14, 17, 26], "preprint": 3, "further": [3, 7, 12, 14, 17, 21, 22, 25], "origin": [3, 5, 7, 9, 12, 13, 15, 21, 22, 25, 26], "narrow": 3, "definit": [3, 12, 17, 21, 25], "restrict": [3, 6], "term": [3, 6, 17, 22], "neutral": [3, 9, 14, 15, 20, 26], "coalesc": [3, 5, 7, 9, 12, 22, 25], "process": [3, 5, 8, 12, 15, 16, 22, 26], "crossov": [3, 8, 14], "structur": [3, 16, 17, 22, 26], "griffith": [3, 4], "marjoram": 3, "1997": 3, "describ": [3, 6, 8, 9, 14, 15, 18, 21, 22, 25, 26], "genealog": [3, 4, 8, 9, 11, 14, 18, 21, 22], "evolv": [3, 17], "via": [3, 7, 8, 9, 12, 13, 16, 17, 18, 21, 23, 25], "inherit": [3, 5, 17, 20, 21, 22, 25, 26], "just": [3, 7, 8, 11, 12, 13, 17, 21, 22, 25, 26], "addit": [3, 7, 11, 12, 13, 15, 17, 21, 25], "event": [3, 4, 5, 8, 9, 12, 21, 22, 25], "store": [3, 8, 11, 13, 14, 18, 21, 22, 23, 25, 26], "analys": [3, 7, 9, 15, 17, 18, 22, 26], "sim_ancestri": [3, 4, 5, 6, 7, 8, 9, 12, 15, 21, 23, 25], "record_full_arg": [3, 25], "option": [3, 8, 9, 12, 14, 15, 17, 21, 25], "doc": [3, 21, 25], "diploid": [3, 4, 5, 8, 9, 14, 15, 18, 21, 22], "1e4": [3, 15, 23, 25], "recombination_r": [3, 5, 7, 8, 9, 12, 14, 15, 21, 23, 25], "1e": [3, 7, 8, 9, 12, 15, 23, 25], "population_s": [3, 5, 7, 8, 9, 25], "1e3": [3, 21, 23], "333": 3, "ts_arg": 3, "discrete_genom": [3, 21], "nb": [3, 12, 17, 21, 25], "strict": [3, 8, 12, 25], "hudson": 3, "uniqu": [3, 8, 14, 22, 25], "continu": [3, 7, 8, 20, 26], "under": [3, 4, 9, 11, 12, 14, 17, 18, 20, 25, 26], "model": [3, 4, 5, 6, 7, 8, 9, 12, 14, 15, 18, 20, 22, 25, 26], "num_nod": [3, 17, 22, 25, 26], "num_edg": [3, 22], "num_tre": [3, 6, 8, 9, 11, 21, 22, 23, 25], "18": [3, 4, 5, 9, 17, 18, 21], "mu": [3, 14, 15], "sim_mut": [3, 9, 12, 15, 17, 21, 23, 25], "rate": [3, 5, 6, 8, 9, 12, 14, 15, 17, 18, 20, 21, 23, 25], "888": [3, 13], "str": [3, 4, 6, 8, 13, 21, 22, 25], "variabl": [3, 14, 15, 17, 18, 22, 23, 25, 26], "record": [3, 4, 5, 7, 8, 12, 13, 14, 17, 21, 22], "gamet": [3, 14], "mean": [3, 4, 5, 6, 7, 8, 9, 14, 16, 17, 21, 22, 25], "captur": [3, 4, 8, 17], "transmiss": [3, 5, 8], "left": [3, 5, 8, 9, 12, 14, 17, 21, 22, 25, 26], "vs": [3, 14, 25], "right": [3, 5, 8, 9, 12, 14, 17, 18, 21, 22, 25, 26], "timepoint": 3, "node_is_re_ev": 3, "ortho": [3, 25], "viz": [3, 18, 25, 26], "separ": [3, 6, 7, 8, 9, 17, 21, 22, 26], "slash": 3, "normal": [3, 8, 15, 22, 25, 26], "plot": [3, 4, 6, 7, 8, 9, 12, 14, 15, 17, 18, 21, 22, 23, 26], "guarante": [3, 21], "split": [3, 12, 16, 22, 25, 26], "lineag": [3, 4, 7, 8, 12, 14, 15, 17, 22, 25], "common": [3, 4, 7, 8, 9, 15, 17, 21, 25, 26], "ancestor": [3, 7, 8, 9, 12, 15, 17, 21, 22, 25, 26], "Such": [3, 9, 15], "drawn": [3, 6, 7, 25], "horizont": [3, 25], "vertic": [3, 25], "line": [3, 8, 9, 13, 21, 22, 25], "tskit_arg_visualis": 3, "javascript": [3, 25], "requir": [3, 4, 5, 6, 8, 11, 13, 14, 15, 21, 22, 23, 25], "config": [3, 25], "d3": [3, 25], "http": [3, 5, 6, 11, 12, 17, 19, 25], "d3j": [3, 25], "org": [3, 5, 6, 12, 25], "v7": [3, 25], "function": [3, 4, 6, 8, 9, 12, 14, 15, 18, 20, 23, 25], "tskit_arg_visu": [3, 25], "d3arg": [3, 25], "from_t": [3, 25], "w": [3, 5, 6, 15, 25], "h": [3, 6, 9, 18, 21, 26], "450": 3, "width": [3, 6, 25, 26], "height": [3, 5, 6, 25], "edge_typ": [3, 25], "sample_ord": [3, 25], "unlabel": [3, 6], "occurr": 3, "re_nod": 3, "nd": [3, 25], "flag": [3, 6, 7, 8, 9, 13, 17, 21, 23, 25, 26], "ca_nod": 3, "arang": [3, 4, 5, 9, 15], "re_tim": 3, "int": [3, 5, 6, 8, 9, 12, 14, 18, 23, 25], "y": [3, 4, 12, 15, 25, 26], "axi": [3, 4, 6, 12, 21, 25, 26], "grid": [3, 4, 12, 25], "stroke": [3, 12, 18, 25, 26], "ff000033": 3, "goldenrod": 3, "600": [3, 8], "y_tick": [3, 8, 12, 18, 22, 23, 25, 26], "y_gridlin": [3, 12, 21, 22, 25], "node_label": [3, 6, 8, 12, 17, 18, 22, 25, 26], "descend": [3, 5, 15, 17, 22, 25, 26], "clear": [3, 6, 9, 12, 17, 21, 25], "seem": [3, 12, 14, 17], "unusu": [3, 9, 17, 22, 25], "affair": [3, 25], "represent": [3, 9, 13, 14, 17, 22, 23], "focu": [3, 8, 9, 15, 17, 23, 25], "ignor": [3, 4, 6, 22, 25], "inde": [3, 9, 12, 15, 21, 22, 25, 26], "simplifi": [3, 5, 6, 8, 9, 12, 14, 18, 21, 22, 23], "whose": [3, 6, 7, 8, 9, 21, 25], "tip": [3, 4, 6, 8, 9, 17, 22, 25, 26], "never": [3, 7], "compact": [3, 15], "omit": [3, 8, 15, 21, 25], "inform": [3, 4, 9, 12, 13, 15, 17, 21, 22, 25, 26], "topolog": [3, 4, 12, 17, 21, 22, 25, 26], "oper": [3, 17, 21, 22, 23, 25], "unari": [3, 5, 8, 25], "retain": [3, 5, 8, 15, 25], "precis": [3, 5, 9], "ensur": [3, 16, 17, 21], "edit": [3, 9, 13, 17, 22, 26], "subtre": [3, 5, 22], "prune": [3, 22, 25], "regraft": [3, 22, 25], "move": [3, 7, 9, 17, 22, 25, 26], "anoth": [3, 7, 8, 9, 17, 21, 22, 25, 26], "evolut": 3, "commonli": 3, "cwr": 3, "1983": 3, "impli": [3, 21], "happen": [3, 5, 7, 8, 12, 13, 22], "588": 3, "59": 3, "ago": [3, 4, 7, 8, 26], "13": [3, 9, 17, 18, 23, 25], "2601": 3, "01": [3, 7, 21, 25], "second": [3, 5, 6, 8, 12, 13, 15, 21, 22, 26], "onto": [3, 5, 7, 9, 12, 14, 15, 17, 22], "around": [3, 8], "simpli": [3, 6, 8, 11, 12, 15, 17, 18, 21, 22, 23, 25, 26], "ocur": 3, "6516": 3, "94": 3, "middl": [3, 9, 21, 25], "last": [3, 9, 12, 13, 21, 22, 25], "led": [3, 26], "closest": [3, 12], "rel": [3, 4, 8, 12, 13, 15, 25, 26], "000": [3, 4, 7, 9], "standard": [3, 9, 15, 17, 18, 22, 26], "larg": [3, 8, 9, 12, 16, 17, 18, 22, 25, 26], "log_arg_likelihood": 3, "log": [3, 9, 12, 15, 25], "ne": [3, 12, 25], "89": 3, "68606886284756": 3, "ti": 3, "allow": [3, 5, 7, 8, 9, 11, 12, 13, 15, 16, 17, 18, 20, 21, 23, 25, 26], "diamond": 3, "trace": [3, 8], "directli": [3, 6, 8, 9, 12, 13, 14, 15, 21, 23, 25], "back": [3, 8, 9, 12, 13, 14, 17, 21, 25, 26], "fulli": [3, 5, 9, 22, 25], "remain": [3, 8, 15, 21, 26], "greater": [3, 15, 22], "lose": [3, 8], "non": [3, 4, 8, 12, 14, 21, 22, 25], "ancestri": [3, 5, 7, 8, 9, 12, 15, 17, 18, 20], "intact": 3, "been": [3, 4, 5, 8, 12, 14, 15, 16, 17, 18, 21, 22, 25, 26], "lost": 3, "reflect": [3, 8, 9, 25, 26], "recent": [3, 5, 8, 9, 12, 13, 15, 17, 21, 25, 26], "decend": [3, 25], "simultanous": 3, "unsuit": 3, "diagon": 3, "d3graph": 3, "produc": [3, 7, 8, 9, 15, 17, 18, 21, 22, 25, 26], "exact": [3, 5, 8, 22], "longer": [3, 6, 7, 8, 9, 12, 14, 21, 25, 26], "obviou": [3, 8, 9, 15], "cannot": [3, 8, 9, 14, 17, 21], "form": [3, 4, 7, 8, 11, 12, 17, 18, 20, 21, 25, 26], "pattern": [3, 6, 12, 20, 22, 26], "unchang": [3, 26], "after": [3, 8, 9, 15, 21, 23], "log_mutation_likelihood": 3, "mutation_r": [3, 6, 18], "204860594400216": 3, "main": [3, 14, 25, 26], "version": [3, 7, 9, 15, 25, 26], "firstli": [3, 12], "real": [3, 5, 6, 8, 12, 15, 22], "desir": [3, 8], "compat": 3, "secondli": [3, 12], "extra": [3, 8, 21, 25, 26], "fact": [3, 5, 6, 7, 8, 14, 21, 22, 23, 25, 26], "increas": [3, 4, 8, 12, 15, 21, 25], "come": [3, 10, 12, 21, 26], "domin": [3, 22, 25], "percentag": [3, 12], "large_sim_paramet": 3, "copi": [3, 5, 9, 13, 17, 21, 22], "1000": [3, 4, 6, 7, 8, 9, 12, 17, 22, 25, 26], "large_ts_arg": 3, "large_t": [3, 8], "2f": [3, 8, 12, 15], "1e6": 3, "num_sampl": [3, 4, 6, 9, 15, 18, 22, 23, 25], "99": [3, 25], "32": [3, 9, 17, 18, 23], "primari": [3, 12], "exclud": 3, "slim": [3, 5, 8, 9, 20], "relev": [3, 8, 18, 21, 26], "mathemat": 3, "formul": 3, "1991": 3, "lead": [3, 9, 17, 23, 25, 26], "vastli": 3, "larger": [3, 9, 12, 15, 21, 22, 26], "infeas": 3, "worth": [3, 14, 15, 17, 20, 21, 25, 26], "subtl": [3, 4, 14], "somewhat": [3, 15], "philosoph": 3, "taken": [3, 12, 22, 25], "region": [3, 8, 9, 12, 17, 18, 20, 21, 23, 25, 26], "contrast": [3, 15], "crucial": [3, 12], "interv": [3, 5, 8, 9, 12, 21, 25], "idleftrightparentchildmetadata": [3, 21], "0000000010000": 3, "0000000061": 3, "0000000063": 3, "000000006516": 3, "9401792875": 3, "36516": 3, "9401792810000": 3, "0000000085": 3, "0000000096": 3, "56516": 3, "0000000098": 3, "00000000104": 3, "94017928107": 3, "00000000110": 3, "00000000112": 3, "00000000129": 3, "110": [3, 9, 21], "000000001210": 3, "120": [3, 17, 21], "000000002601": 3, "014547981312": 3, "132601": 3, "0145479810000": 3, "000000001412": 3, "140": 3, "000000001511": 3, "152601": 3, "000000001514": 3, "160": [3, 6, 23], "014547981613": 3, "170": 3, "014547981615": 3, "technic": [3, 22], "garg": 3, "those": [3, 8, 9, 11, 12, 14, 15, 17, 18, 20, 21, 22, 23, 25, 26], "gene": [3, 8, 18], "convers": [3, 8, 12, 25], "world": [3, 11], "inferr": 3, "viral": 3, "without": [3, 4, 5, 6, 12, 15, 16, 21, 22, 25, 26], "pin": 3, "exactli": [3, 8, 22, 25], "took": [3, 6, 17], "limit": [3, 9, 17, 25, 26], "acycl": 3, "although": [3, 4, 5, 6, 8, 9, 12, 15, 17, 21, 22, 25], "natur": [3, 15, 21], "pass": [3, 5, 7, 8, 9, 12, 13, 14, 16, 21, 23, 25], "regardless": [3, 6, 12, 26], "edge_diff": [3, 10, 25], "goe": 3, "match": [3, 8, 14, 25], "necessarili": [3, 15, 17, 21], "group": [3, 6, 7, 8, 12, 18, 25], "altern": [3, 4, 6, 8, 9, 21, 25], "top": [3, 5, 8, 13, 21, 25, 26], "bottom": [3, 8, 25], "strictli": [3, 8, 22, 26], "timeasc": [3, 17], "breadth": 3, "level": [3, 8, 13, 17, 25], "ineffici": [3, 6, 9, 12], "access": [3, 9, 13, 22, 23], "vice": [3, 7], "versa": [3, 7], "edges_by_parent_timeasc": 3, "groupbi": 3, "attrgett": 3, "parent_id": [3, 17, 25], "56": 3, "0454802286223": 3, "7850821708138": 3, "142": 3, "86643656492956": 3, "236": [3, 9], "7237255340037": 3, "272": [3, 17], "05118690557765": 3, "11": [3, 6, 8, 9, 13, 17, 18, 21, 22, 25], "610": 3, "912738605865": 3, "12": [3, 4, 6, 7, 8, 9, 12, 15, 17, 18, 22, 23, 25], "1382": 3, "4658244607965": 3, "termin": [3, 9, 22], "isol": [3, 8, 17, 18], "leaf": [3, 18, 22], "slower": 3, "edges_by_child_timeasc": 3, "lexsort": 3, "edges_child": [3, 25], "nodes_tim": [3, 17, 23], "child_id": [3, 8, 14, 17], "negat": [3, 25], "algorithm": [3, 5, 9, 14, 17, 18, 26], "theori": [3, 4, 8, 14], "help": [3, 7, 8, 9, 13, 14, 15, 21, 22, 23, 24, 25], "networkx": [3, 25], "panda": [3, 18, 25], "pd": [3, 18, 25], "to_networkx_graph": [3, 25], "interval_list": [3, 25], "intervals_list": [3, 25], "otherwis": [3, 21, 25], "edges_par": [3, 25], "edges_left": [3, 18, 25], "edges_right": [3, 25], "from_pandas_edgelist": [3, 25], "datafram": [3, 18, 25], "edge_attr": [3, 25], "create_us": [3, 25], "multidigraph": [3, 25], "gg": [3, 25], "mave": [3, 25], "new": [3, 6, 7, 8, 9, 11, 12, 13, 14, 21, 22, 25, 26], "contai": [3, 25], "adjac": [3, 9, 10, 22, 25, 26], "edict": [3, 25], "ilist": [3, 25], "add_edg": [3, 25], "set_node_attribut": [3, 25], "assert": [3, 8, 12, 14, 21, 25], "is_directed_acyclic_graph": 3, "should": [3, 9, 11, 12, 13, 14, 15, 16, 17, 20, 21, 25], "dag": 3, "simplest": [3, 8, 12, 17, 26], "layer": 3, "topological_gener": 3, "multipartite_layout": 3, "subset_kei": 3, "align": [3, 17], "draw_networkx": 3, "argweav": 3, "kwarg": [3, 13], "implement": [3, 4, 8, 11, 14, 16, 25, 26], "re": [3, 6, 14, 15, 26], "konrad": [4, 12], "lohs": [4, 12], "jerom": [4, 12], "kelleh": [4, 12, 22], "demograph": [4, 7, 12], "histori": [4, 5, 7, 8, 12, 14, 18, 21, 22, 26], "assum": [4, 8, 12, 21, 25], "n_e": [4, 12], "step": [4, 5, 7, 12, 21], "seri": [4, 6, 17, 18], "epoch": [4, 7, 25], "1994": 4, "marth": 4, "et": [4, 12, 22], "al": [4, 12, 22], "2004": 4, "keightlei": 4, "eyr": 4, "walker": 4, "2007": 4, "li": 4, "durbin": 4, "2011": [4, 12], "piec": [4, 8, 22, 25], "wise": 4, "constant": [4, 11, 25, 26], "reduc": [4, 8, 9, 23, 25], "fraction": [4, 7, 8, 12, 21], "t_": [4, 12], "recov": 4, "initi": [4, 7, 8, 25], "end": [4, 5, 8, 9, 12, 14, 17, 21, 22, 25, 26], "short": [4, 8, 12, 18, 22, 25, 26], "timescal": [4, 25], "durat": [4, 25], "sequenc": [4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 23], "simpler": [4, 7, 8, 20], "rightarrow": 4, "sudden": [4, 7], "burst": 4, "merger": [4, 22], "strength": [4, 7], "thought": [4, 7, 15, 21, 26], "imaginari": 4, "period": [4, 5, 8], "dure": [4, 8, 14, 20], "collaps": 4, "growth": 4, "probabl": [4, 7], "enter": 4, "attract": 4, "empir": [4, 26], "galtier": 4, "2000": [4, 6, 25], "bunnefeld": 4, "2015": 4, "develop": [4, 11, 14], "straightforward": 4, "ms": [4, 7, 17], "instant": 4, "select": [4, 9, 11, 14, 20, 25, 26], "sweep": [4, 9, 25], "unlik": [4, 7, 17, 21], "durret": 4, "scheinsberg": 4, "affect": [4, 7, 12, 14, 25, 26], "exchang": [4, 7], "consequ": [4, 7], "underw": 4, "2n": [4, 8], "sinc": [4, 7, 8, 9, 12, 15, 17, 21, 22, 25], "obtain": [4, 6, 8, 9, 17, 18, 22], "scale": [4, 5, 12, 14, 18, 22, 26], "2n_e": 4, "matplotlib": [4, 8, 9, 11, 12, 15, 18, 20, 25], "pyplot": [4, 8, 9, 12, 15, 18, 25], "plt": [4, 8, 9, 12, 15, 18, 25], "svg": [4, 6, 7, 9], "run_bott_sim": 4, "num_samp": 4, "num_rep": 4, "none": [4, 5, 6, 8, 9, 12, 13, 14, 15, 18, 21, 22, 25], "seed": [4, 5, 14, 15, 18, 25], "123": [4, 6, 15, 21, 25], "add_popul": [4, 7, 12, 25], "initial_s": [4, 6, 7, 12, 25], "add_instantaneous_bottleneck": 4, "sampleset": [4, 12, 25], "ploidi": [4, 5, 6, 8, 12, 15, 25], "haploid": [4, 5, 12, 18, 21], "num_repl": [4, 8, 15], "bottt": 4, "bottb": 4, "400": [4, 7, 8, 25], "sever": [4, 5, 8, 14, 16, 17, 18, 20, 21, 25, 26], "2016": [4, 12], "exp": 4, "p": [4, 5, 6, 7, 12, 15, 18, 25, 26], "15": [4, 9, 17, 18, 21, 22, 25], "expsfsbottln": 4, "7722266": 4, "17689752": 4, "05087588": 4, "replic": [4, 8, 12, 15, 16], "close": [4, 7, 9, 12, 18, 26], "fit": [4, 13, 20], "nrep": 4, "10_000": [4, 9, 18], "nsamp": 4, "sim": [4, 8, 14], "blist": 4, "zero": [4, 5, 6, 7, 8, 9, 12, 23, 25], "rep_index": 4, "af": [4, 9, 12, 15, 18], "fig": [4, 9, 15, 18], "ax": [4, 18], "subplot": [4, 9, 15, 18], "bar_width": 4, "opac": [4, 25], "expsf": 4, "bar": [4, 9, 12, 15, 18], "alpha": 4, "simsf": 4, "surviv": 4, "paircoalbott": 4, "tree": [4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 23], "tmrca": [4, 8, 15], "rep": 4, "next": [4, 8, 9, 21, 22, 25, 26], "bottblist": 4, "dat": 4, "prob": 4, "mrca": [4, 9, 12, 15, 17, 25, 26], "bottt2": 4, "dat2": 4, "prob2": 4, "expprob": 4, "expprob2": 4, "expmean": 4, "expmean2": 4, "brown": 4, "ls": [4, 15, 18], "lw": [4, 12], "theoret": [4, 8, 15], "marker": 4, "navi": 4, "xlabel": [4, 8, 9, 12, 15, 18], "ylabel": [4, 8, 9, 15, 18], "legend": [4, 12, 18], "maxima": 4, "sprob": 4, "coaldi": 4, "10000": [4, 9, 12, 23, 25, 26], "coaldisfilt": 4, "probtest": 4, "tlist": 4, "coalepx1": 4, "coalepx2": 4, "color": [4, 12, 18, 25], "black": [4, 18, 25], "linewidth": [4, 9], "hist": [4, 8, 12], "bin": [4, 8], "densiti": [4, 8], "substanti": [4, 8, 12], "summari": [4, 17, 23, 25, 26], "basi": [4, 15, 17], "modern": [4, 12, 20, 26], "sweepfind": 4, "dfe": 4, "dadi": 4, "absenc": [4, 17], "linkag": 4, "lossless": 4, "measur": [4, 8, 9, 12, 17, 22, 26], "f_": [4, 15, 18], "st": [4, 15, 18], "tajima": [4, 15, 18, 26], "etc": [4, 9, 13, 14, 15, 17, 18, 23, 25], "achaz": 4, "2009": 4, "depend": [4, 8, 12, 15, 21, 25], "chen": 4, "diffus": 4, "equat": 4, "gutenkunst": 4, "composit": 4, "likelihood": [4, 20], "excoffi": 4, "2002": 4, "bottsf": 4, "5_000": 4, "datalist": 4, "With": [4, 7, 15, 18, 21, 25], "becom": [4, 7, 8, 12, 23, 26], "increasingli": [4, 12], "skew": [4, 25], "leftmost": [4, 22], "complex": [4, 9, 14, 20], "class": [4, 14, 21], "monoton": 4, "relationship": [4, 14, 17, 18, 22, 25, 26], "ss": 4, "pdf": [4, 25], "immedi": [4, 17, 21, 25], "nonrecombin": 4, "block": [4, 25], "discontinu": 4, "75": [4, 14, 15, 18, 25], "numrep": 4, "20_000": [4, 8, 18], "nleav": 4, "btran": 4, "tolist": 4, "x": [4, 5, 6, 21, 25, 26], "ylim": [4, 12], "instantaneousbottleneck": 4, "small": [4, 7, 8, 9, 15, 23, 25, 26], "strongli": [4, 7], "backward": [5, 7, 8, 9, 12, 20, 22, 25], "But": [5, 17, 21], "fwdpy11": [5, 8], "build": [5, 12, 14, 18, 21], "slow": [5, 20], "best": 5, "past": [5, 7, 12, 17, 23, 26], "ancient": [5, 12, 18], "recapit": [5, 8], "think": [5, 7, 14, 15, 17, 21, 22], "head": [5, 6, 8, 18], "wright": [5, 8, 14], "fisher": [5, 8, 14], "formal": [5, 6], "random": [5, 6, 8, 9, 12, 14, 15, 25], "wright_fish": 5, "l": [5, 8, 9, 14, 15, 23, 25, 26], "loci": 5, "recombin": [5, 11, 12, 14, 15, 17, 20, 21, 25, 26], "doi": 5, "1371": 5, "journal": 5, "pcbi": 5, "1006581": 5, "tablecollect": [5, 8, 13, 14, 21], "time_unit": [5, 8, 12, 14, 15, 17, 25, 26], "metadata_schema": [5, 12, 13, 21], "metadataschema": [5, 12, 13], "permissive_json": 5, "dtype": [5, 8, 9, 12, 14, 21, 25], "pp": 5, "randint": 5, "current": [5, 7, 8, 12, 14, 21, 22, 25], "keep_input_root": [5, 8, 14], "tini": [5, 26], "locu": 5, "num_loci": 5, "wf_t": 5, "ran": 5, "enough": [5, 8, 14, 15, 26], "19": [5, 9, 17, 18], "member": 5, "essenti": [5, 22], "correctli": [5, 8, 21, 25], "assembl": 5, "fragment": 5, "materi": [5, 8, 12], "condit": 5, "begin": [5, 9, 23], "examin": [5, 12, 15, 17], "segment": [5, 12, 25], "tupl": [5, 6, 8, 14, 25], "span": [5, 6, 15, 17, 18, 22, 25, 26], "minimum": 5, "initial_st": 5, "system": [5, 18, 21, 23, 25], "coalesced_t": 5, "successfulli": [5, 7, 11], "hoorai": 5, "care": [5, 9, 12, 23], "preserv": 5, "properli": [5, 14, 25], "portion": [5, 18, 26], "must": [5, 6, 7, 9, 12, 13, 14, 16, 21, 22, 23, 25, 26], "necessari": [5, 8, 11, 15, 17, 21, 23, 25, 26], "uncoalesc": [5, 8], "happili": 5, "easili": [5, 8, 9, 21, 25, 26], "practic": [5, 17], "skip": [5, 14, 25], "toi": [5, 12], "pyslim": 5, "front": 5, "slightli": [5, 7, 15, 22, 25, 26], "odd": [5, 14], "awar": 5, "old": [5, 8, 12, 16, 21, 25], "clearli": [5, 8], "redund": [5, 22], "modif": [5, 13, 21, 25], "task": [5, 9, 16, 26], "problem": [5, 8], "statist": [5, 16, 17, 18, 23, 25, 26], "inflat": 5, "overal": 5, "overestim": 5, "had": [5, 21], "alreadi": [5, 8, 23, 26], "better": [5, 6, 9, 15, 16, 20, 21], "your": [5, 7, 8, 9, 10, 11, 14, 15, 17, 18, 20, 22, 23, 25], "final_t": 5, "final": [5, 8, 12, 14, 21, 25, 26], "ident": [5, 6, 9, 15, 21, 25], "reassign": 5, "map_nod": 5, "map": [5, 8, 12, 25], "yan": [6, 20, 25], "wong": [6, 20, 25], "intend": [6, 8, 21, 25], "gentl": 6, "introduct": [6, 9, 17, 18, 22], "combinatori": 6, "treatment": 6, "offici": [6, 21], "avoid": [6, 9, 10, 16, 23, 25], "confus": [6, 8, 23, 25], "letter": [6, 9, 23, 25, 26], "generate_comb": [6, 17], "deep_tre": 6, "intern": [6, 8, 9, 17, 21, 22, 25, 26], "whether": [6, 15], "string": [6, 9, 13, 17, 21, 25, 26], "ascii_lowercas": [6, 25, 26], "str_none": 6, "prefix": [6, 23], "draw_svg_tre": 6, "x_lab_attr": 6, "150": [6, 7, 9], "xmln": 6, "www": 6, "w3": 6, "transform": [6, 18, 22], "translatei": [6, 25], "px": [6, 25], "canvas_s": [6, 18, 25], "root_svg_attribut": [6, 25, 26], "x_label": [6, 12], "getattr": 6, "all_tree_label": 6, "word": [6, 8, 9, 12, 14, 21, 22, 26], "generate_star": 6, "all_tre": 6, "generated_tre": 6, "all_tree_shap": 6, "categoris": 6, "26": [6, 9, 17, 18, 23], "shape_index": 6, "num_label": 6, "known": [6, 8, 15, 17, 20, 22, 25], "num_tip": [6, 17], "simulated_t": 6, "simulated_tre": 6, "ascii_node_label": 6, "1270": 6, "205540": 6, "unrank": 6, "appropri": [6, 8, 21, 25], "new_tre": [6, 17], "21580": 6, "grow": [6, 22], "veri": [6, 8, 9, 11, 12, 14, 15, 16, 17, 21, 22, 23, 25], "rapidli": 6, "282": 6, "137": 6, "824": 6, "perfectli": [6, 15, 22], "sai": [6, 7, 8, 12, 17, 21, 22, 25, 26], "finish": [6, 11], "death": 6, "galaxi": 6, "b2": [6, 8], "b2_index": 6, "balanc": [6, 17], "break": [6, 9, 12, 14, 18], "too": [6, 8, 14, 15, 20, 25, 26], "long": [6, 8, 9, 12, 14, 20, 22, 25], "0000000000000013": 6, "9986759016244608": 6, "9960946599243323": 6, "9958336776669476": 6, "9973695449917637": 6, "992978538300552": 6, "9927249774271467": 6, "recommend": [6, 7, 11, 25], "kc_distanc": 6, "sample_list": [6, 18, 25], "construct": [6, 13, 14], "despit": 6, "explos": 6, "classifi": 6, "count_topolog": 6, "newick_species_tre": 6, "from_species_tre": 6, "321": [6, 17, 23], "big_tre": [6, 17], "fairli": 6, "cluster": [6, 22, 25], "togeth": [6, 18, 21, 22, 25], "exclus": 6, "nearli": 6, "exhaust": 6, "choos": [6, 8], "topology_count": 6, "embedded_count": 6, "embedded_tre": 6, "number_of_inst": 6, "support": [6, 7, 9, 12, 25, 26], "neanderth": [6, 12, 25], "sister": 6, "european": [6, 25], "versu": [6, 25], "african": [6, 12, 18, 25], "increment": [6, 17, 26], "independ": [6, 15, 17, 23], "stdpopsim": [6, 18], "speci": [6, 8, 17, 18, 21], "get_speci": [6, 18], "homsap": [6, 18], "get_demographic_model": [6, 18], "outofafrica_3g09": 6, "contig": [6, 9, 18], "get_contig": [6, 18], "chr1": [6, 18], "length_multipli": 6, "0002": 6, "yri": 6, "ceu": 6, "chb": 6, "engin": [6, 18, 25], "get_engin": [6, 18], "chines": 6, "opt": [6, 13, 18, 21], "hostedtoolcach": [6, 13, 18, 21], "python": [6, 7, 8, 9, 11, 12, 13, 16, 17, 18, 21, 22, 23], "x64": [6, 13, 18, 21], "lib": [6, 13, 18, 21], "python3": [6, 11, 13, 18, 21], "packag": [6, 11, 13, 17, 18, 21, 23, 26], "catalog": [6, 18], "demographic_model": [6, 18], "py": [6, 11, 13, 18, 21], "158": [6, 18], "futurewarn": [6, 18], "deprec": [6, 18], "rais": [6, 13, 18, 21, 23], "typeerror": [6, 18], "futur": [6, 14, 18], "ser": [6, 18], "iloc": [6, 18], "extended_gf": [6, 18], "161": [6, 18], "tail": [6, 18], "6000": [6, 23], "doabl": 6, "02": [6, 7, 12, 25], "calcul": [6, 9, 10, 12, 15, 16, 17, 18, 21, 26], "datetim": [6, 8], "name": [6, 7, 9, 12, 13, 17, 18, 21, 22, 25, 26], "yellow": [6, 18, 25], "population_map": 6, "sample_popul": 6, "topology_span": 6, "embedded_topolog": 6, "4000000000000": 6, "09": 6, "944453": 6, "ntip": 6, "text": [6, 15, 18, 22, 23], "lab": [6, 12, 18, 22, 25, 26], "baselin": [6, 8, 9, 15, 18, 25], "shift": [6, 25], "super": 6, "font": [6, 12, 22, 25, 26], "7em": 6, "1f": [6, 8, 15, 26], "georgia": [7, 20], "tsambo": [7, 20], "isn": [7, 12], "particularli": [7, 15, 21, 25], "excit": 7, "One": [7, 25], "complic": 7, "exponenti": 7, "dem": 7, "idnamedescriptioninitial_sizegrowth_ratedefault_sampling_timeextra_metadata0aplot": 7, "1bplot": 7, "object": [7, 9, 13, 21, 22, 23], "inividu": 7, "forev": 7, "unless": [7, 15, 17, 25], "understand": [7, 11, 12, 13, 21], "recal": 7, "until": [7, 8, 26], "setup": [7, 25], "absolut": 7, "off": [7, 9, 12, 25], "set_migration_r": 7, "migrant": 7, "dest": [7, 12, 25], "approxim": [7, 15, 20], "yourself": 7, "type": [7, 9, 12, 13, 14, 21, 23, 25], "set_symmetric_migration_r": 7, "perhap": [7, 17], "counter": 7, "intuit": [7, 25], "05": [7, 8, 25], "141": [7, 17], "trees1": [7, 17], "length1000": [7, 17, 22], "unitsgener": [7, 9, 22, 23], "nodes4": 7, "size2": [7, 9], "204": 7, "288": 7, "idflagspopulationindividualtimemetadata": [7, 21], "01000": [7, 21], "00000000": [7, 21], "11000": [7, 21], "21110": 7, "31110": 7, "1161": 7, "20712736": 7, "501": 7, "1336": 7, "10713452": 7, "601": 7, "1590": 7, "71203375": 7, "notic": [7, 17, 22], "jupyt": [7, 9, 11, 25], "notebook": [7, 9, 11, 16, 17, 25], "colour_map": [7, 12], "col": [7, 12], "enabl": [7, 18, 25], "sens": [7, 22], "add_migration_rate_chang": 7, "prior": [7, 8, 14], "matrixaba00": 7, "05b0": 7, "020event": 7, "timetypeparameterseffect100migr": 7, "changesourc": 7, "01backward": 7, "readi": [7, 11], "63461": 7, "diagram": [7, 21, 26], "add_admixtur": 7, "suppli": 7, "particip": 7, "proport": [7, 8, 9, 12, 15, 25], "ancestralpop0": 7, "growth_rat": 7, "ancestralpop1": 7, "admixedpop": 7, "haplotyp": [7, 9, 18, 21, 25, 26], "admix": [7, 12, 18], "trigger": 7, "activ": [7, 25], "inact": 7, "beyond": 7, "idnamedescriptioninitial_sizegrowth_ratedefault_sampling_timeextra_metadata0ancestralpop0plot": 7, "1ancestralpop1plot": 7, "2admixedpopplot": 7, "matrixancestralpop0ancestralpop1admixedpopancestralpop000": 7, "050ancestralpop10": 7, "0200admixedpop000ev": 7, "timetypeparameterseffect50admixturederiv": 7, "x27": 7, "proba": 7, "error": [7, 13, 21, 23, 25], "read": [7, 17, 21, 22, 23, 25], "life": 7, "cycl": 7, "situat": [7, 20], "add_population_split": 7, "did": [7, 12], "quantiti": [7, 15], "ancestralpopul": 7, "2ancestralpopulationplot": 7, "001e": 7, "timetypeparameterseffect100popul": 7, "splitderiv": 7, "ancestralpopulationmov": 7, "familiar": 7, "add_mass_migr": [7, 12, 25], "mention": 7, "specialis": 7, "safer": 7, "destin": [7, 12], "timetypeparameterseffect50mass": 7, "migrationsourc": 7, "3lineag": 7, "forward": [7, 9, 20, 22], "view": [7, 25], "receiv": 7, "add_population_parameters_chang": 7, "250": [7, 9, 23, 25, 26], "sort_ev": 7, "pop1_growth": 7, "earli": 7, "ie": 7, "local": [7, 8, 12, 13, 15, 17, 22, 25, 26], "add_censu": 7, "350": [7, 25], "112": 7, "node_is_cen_ev": 7, "seen": [7, 12, 21, 22, 25], "mistak": 7, "spot": [7, 8, 22], "debugg": 7, "readabl": [7, 25], "habit": 7, "demographydebugg": 7, "my_histori": 7, "generationspopul": 7, "startendgrowth_ratea": 7, "0event": 7, "350timetypeparameterseffect350censusinsert": 7, "lineagesepoch": 7, "inf": 7, "scratch": [8, 21], "track": [8, 12, 14, 20, 21, 22, 25], "pedigre": [8, 21], "clariti": [8, 9, 21, 22, 25, 26], "purpos": [8, 9, 15], "condens": [8, 17], "complet": [8, 9, 14, 20, 21], "try": [8, 9, 13, 21], "highli": [8, 12, 17, 18, 25, 26], "capabl": [8, 25], "websit": [8, 18], "illustr": [8, 12, 15, 18, 20, 22, 23, 25], "principl": [8, 26], "lie": 8, "behind": [8, 10, 22], "willing": 8, "book": [8, 14], "themselv": [8, 12, 21, 22], "birth": [8, 21], "integ": [8, 9, 13, 14, 22, 23], "assign": [8, 13, 21, 23], "sequenti": [8, 9, 12, 21], "wf": [8, 14], "notion": 8, "reach": 8, "dai": [8, 18, 26], "subsequ": [8, 14, 17, 25], "previou": [8, 14, 21, 25], "aid": 8, "minim": [8, 12, 14], "export": [8, 23], "immut": [8, 17, 21], "default_rng": [8, 14], "50_000": [8, 14], "kb": [8, 9, 12, 14, 15, 23], "repeat": [8, 17], "pick": [8, 15, 25], "add_inheritance_path": [8, 14], "later": [8, 9, 15, 21, 25], "lower": [8, 12], "languag": [8, 9], "reli": [8, 17, 25], "alloc": [8, 17, 21], "visualis": [8, 25], "unsimplifi": [8, 14], "default_node_flag": 8, "node_is_sampl": [8, 21, 26], "make_diploid": [8, 14], "parent_individu": [8, 14], "being": [8, 14, 16, 25], "individual_id": [8, 14], "new_popul": [8, 14], "prev_pop": [8, 14], "maternal_genome_id": 8, "paternal_genome_id": 8, "cach": 8, "prev_individu": [8, 14], "int32": [8, 9, 14, 21], "replac": [8, 12, 14, 17, 21, 25], "self": [8, 13, 21], "mother_and_fath": [8, 14], "choic": [8, 14, 15], "child_genom": [8, 14], "parent_genom": [8, 14], "initialise_popul": [8, 14], "simplic": [8, 18, 21], "mother": 8, "father": 8, "hermaphrodit": 8, "repeatedli": [8, 9], "next_popul": 8, "routin": [8, 17, 21], "forward_wf": [8, 14], "num_diploid": [8, 14], "seq_len": [8, 14], "global": [8, 14, 15, 16], "focal": [8, 22], "parent_nod": 8, "child_nod": 8, "randomli": [8, 9, 22], "21_000": 8, "inherit_from": [8, 14], "1st": [8, 25], "2nd": 8, "mosaic": 8, "hotspot": 8, "redefin": 8, "uniform": 8, "poisson": [8, 14], "num_recombin": [8, 14], "concaten": 8, "b1": [8, 17], "b3": 8, "bn": 8, "switch": [8, 14, 15], "infinit": [8, 14, 15, 22], "alter": 8, "test": [8, 14, 20, 21], "appear": [8, 14, 21, 25], "pervers": 8, "toward": 8, "graphics_param": 8, "y_label": [8, 12, 25, 26], "21": [8, 9, 17, 18], "1200": [8, 12, 25], "extinct": [8, 14], "made": [8, 12, 25], "shown": [8, 11, 21, 22, 26], "typic": [8, 25, 26], "contribut": [8, 11, 12, 22], "current_day_genom": 8, "simplified_t": 8, "keep_unari": 8, "filter_nod": [8, 25], "part": [8, 11, 21, 22, 25, 26], "renumb": 8, "youngest": 8, "oldest": [8, 17], "meant": [8, 18, 25], "kept": 8, "unneed": 8, "rho": [8, 15], "bp": [8, 12], "07": 8, "50000": [8, 25], "symbol_s": [8, 25], "someth": [8, 9, 15, 21, 22, 25], "manag": [8, 21], "visual": [8, 9, 21, 22, 26], "far": [8, 9, 12, 25], "dramat": 8, "disk": [8, 17, 22], "storag": [8, 11, 17, 26], "memori": [8, 9, 15, 16, 17, 22, 23], "gen": [8, 12], "ten": [8, 26], "500_000": 8, "dead": 8, "nbyte": [8, 15, 17], "1024": [8, 17], "mb": [8, 9, 12, 17, 18], "factor": [8, 12, 25], "79": [8, 17], "113": 8, "320": 8, "57": 8, "improv": 8, "carri": [8, 14, 17], "regular": [8, 14], "figur": [8, 14, 20, 25], "figsiz": [8, 9, 15, 18, 25], "stair": [8, 9, 15, 18], "num_root": 8, "as_arrai": [8, 22], "hand": [8, 17, 21, 25], "10n": 8, "4n": [8, 14], "varianc": [8, 14], "big": [8, 14], "margin": [8, 22, 25], "distribut": [8, 12, 14, 21, 26], "faster": [8, 9, 26], "5e": 8, "cours": [8, 15], "henc": [8, 16], "prohibit": [8, 15], "matter": 8, "distanc": [8, 15, 17], "betweem": 8, "undefin": 8, "techniqu": [8, 25], "fast": [8, 15, 17, 18, 20], "trick": 8, "learn": [8, 9, 11, 18], "user": [9, 17, 25], "who": 9, "basic": [9, 11, 14, 15, 17, 21, 22, 25], "five": 9, "throughout": [9, 25], "pointer": [9, 21, 22], "written": 9, "r": [9, 11, 13, 25, 26], "notabl": 9, "rust": 9, "softwar": [9, 11, 20, 25], "twenti": 9, "throw": [9, 17], "pop_siz": 9, "seq_length": 9, "10_000_000": 9, "sweep_model": 9, "sweepgenicselect": 9, "start_frequ": 9, "0001": 9, "end_frequ": 9, "9999": 9, "dt": 9, "standardcoalesc": 9, "1234": 9, "repeatabilti": 9, "finit": 9, "juke": 9, "cantor": 9, "snp": [9, 18], "4321": 9, "trees11167": 9, "nodes40": 9, "36372": 9, "584": 9, "13568": 9, "490": [9, 21], "7342": 9, "224": [9, 23], "13554": 9, "330": 9, "idiom": [9, 21], "underli": [9, 13, 15, 17, 18, 21, 22, 23, 26], "encount": [9, 17, 21, 22], "661": 9, "3116": 9, "4451": 9, "4673": 9, "5020": 9, "11166": 9, "9999635": 9, "loop": [9, 14, 21, 26], "outsid": [9, 14], "eat": 9, "aslist": 9, "snippet": 9, "stop": 9, "That": [9, 12, 21, 22, 25], "check": [9, 14, 21, 23, 25], "elaps": 9, "has_multiple_root": 9, "6g": 9, "sec": [9, 17], "11167": 9, "0101852": 9, "find": [9, 12, 15, 20, 22, 25, 26], "found": [9, 12, 14, 17, 25], "mrca_tim": 9, "yscale": [9, 12], "design": [9, 16, 17, 18], "rapid": 9, "pull": 9, "swept_tre": 9, "5_000_000": 9, "nth": [9, 25], "at_index": [9, 25], "intvl": 9, "wide": [9, 18, 25], "room": [9, 25], "5382": 9, "4998293": 9, "5033047": 9, "signatur": 9, "expans": [9, 26], "excess": [9, 12], "simplif": [9, 21, 25], "smaller": [9, 12, 17, 21], "x_lim": [9, 12, 25, 26], "reduced_t": [9, 23], "5kb": 9, "5000": [9, 25, 26], "higher": [9, 12, 22], "frequenc": [9, 14, 15, 18], "numer": [9, 23, 25, 26], "meaning": [9, 17, 25], "perman": 9, "attach": [9, 25], "incorpor": [9, 22, 26], "automat": [9, 13, 25], "entitl": [9, 17], "realli": [9, 14, 17, 20], "itself": [9, 14, 15, 21, 25, 26], "nevertheless": [9, 12, 15, 25], "num_mut": [9, 12, 21, 22, 23], "num_sit": [9, 18, 21, 26], "nmut": 9, "bincount": [9, 21], "13540": 9, "2275": 9, "2287": 9, "2658": 9, "3789": 9, "4043": 9, "9694": 9, "11023": 9, "11780": 9, "11853": 9, "11890": 9, "11999": 9, "12023": 9, "12096": 9, "12310": 9, "miss": [9, 15, 17, 18, 26], "set_printopt": 9, "optimis": 9, "less": [9, 12, 17], "resid": [9, 22, 26], "samp_id": 9, "22": [9, 17, 18, 21], "23": [9, 17, 18], "27": [9, 17, 18], "28": [9, 12, 17, 18, 25], "29": [9, 17, 18, 23], "31": [9, 17, 18, 21], "37": [9, 17], "38": [9, 17], "jc69": 9, "indel": 9, "nor": 9, "relat": [9, 12, 21, 22], "titl": [9, 12, 18, 25], "unpolaris": 9, "unpolar": 9, "doesn": [9, 13, 25], "polar": 9, "estim": [9, 15, 18], "influenc": [9, 20], "nois": [9, 15], "ax1": [9, 15], "ax2": [9, 15], "ncol": [9, 15, 18], "afs1": [9, 15], "set_titl": [9, 15, 18], "restricted_t": 9, "keep_interv": [9, 21], "5e6": 9, "afs2": [9, 15], "5mb": 9, "On": [9, 13], "delet": [9, 21, 23, 25], "unsurprisingli": 9, "vari": 9, "\u03c0": 9, "wherea": [9, 22, 23], "10kb": [9, 18], "1_000": [9, 12, 15], "set_ylabel": [9, 15], "set_xlabel": [9, 15], "set_xlim": 9, "4e3": 9, "6e3": 9, "set_yscal": [9, 15], "set_ylim": 9, "drop": 9, "noisi": 9, "signal": [9, 12], "dump": [9, 13], "suffix": 9, "my_tree_sequ": 9, "interchang": [9, 17, 20], "interoper": [9, 18], "small_t": 9, "135": 9, "5614": 9, "805": 9, "3587": 9, "2945": 9, "281": 9, "290": 9, "004": 9, "836": 9, "139": 9, "168": 9, "2655": 9, "277": 9, "641": 9, "955": 9, "2162": 9, "570": 9, "61457": 9, "489": [9, 17, 21], "8362": 9, "020": 9, "1757": 9, "640": 9, "6604": 9, "380": 9, "58845": 9, "274": [9, 17], "act": 9, "trim": [9, 14, 18, 21, 23], "blank": 9, "cut": [9, 18], "as_nexu": 9, "include_align": 9, "taxa": 9, "ntax": 9, "taxlabel": 9, "n0": [9, 23, 25], "n1": [9, 23, 25], "n2": [9, 23, 25], "n3": 9, "n4": [9, 25], "n5": 9, "n6": 9, "n7": [9, 25], "n8": 9, "n9": [9, 25], "t0": [9, 25], "t661": 9, "50834": 9, "692": 9, "48222": 9, "477": 9, "t3116": 9, "20242": 9, "950": 9, "17630": 9, "736": 9, "t4451": 9, "5076": 9, "55250": 9, "945": 9, "52638": 9, "730": 9, "t5076": 9, "7049": 9, "21090": 9, "493": 9, "18478": 9, "278": 9, "t7049": 9, "7995": 9, "8736": 9, "6123": 9, "895": 9, "t7995": 9, "8742": 9, "5358": 9, "852": 9, "3003": 9, "t8742": 9, "9279": 9, "6741": 9, "465": 9, "4129": 9, "t9279": 9, "sy": [9, 17], "write_vcf": 9, "stdout": 9, "fileformat": 9, "vcfv4": 9, "filter": [9, 25], "gt": 9, "chrom": 9, "ref": 9, "alt": 9, "qual": 9, "tsk_0": 9, "tsk_1": 9, "tsk_2": 9, "tsk_3": 9, "tsk_4": 9, "310": 9, "890": [9, 13], "1052": 9, "1375": 9, "1918": 9, "4921": 9, "5050": 9, "5132": 9, "5531": 9, "7204": 9, "8930": 9, "9800": 9, "integr": [9, 17], "downstream": [9, 13], "unfortun": 9, "slight": 9, "mismatch": 9, "haplotypearrai": 9, "genotype_matrix": [9, 23], "n_variant": 9, "n_haplotyp": 9, "lt": 9, "0123456789000110010001110011011120011001000": 9, "90011001000100010000000111100110111": 9, "sckit": 9, "suit": [9, 18, 20], "pairwis": [9, 15, 16], "nativ": [9, 16, 23], "ac": 9, "count_allel": 9, "mean_pairwise_differ": 9, "46666667": 9, "home": 9, "messag": 9, "rough": [9, 22], "distinct": 9, "complement": 9, "delete_interv": [9, 21, 23], "prefer": [9, 15, 26], "fst": [9, 15, 18], "explain": [10, 15, 21, 26], "philosophi": 10, "content": [10, 13, 19, 21, 24], "233": [10, 14], "toolkit": [11, 17, 18, 22], "advanc": 11, "ecosystem": 11, "suggest": [11, 12, 17, 20, 26], "yet": [11, 15, 25], "ital": 11, "github": [11, 12, 17, 19, 25], "page": [11, 17, 25, 26], "video": 11, "public": [11, 18, 25], "friendli": 11, "commun": 11, "question": [11, 21], "tsinfer": [11, 18], "experi": [11, 14], "instal": [11, 23], "importantli": [11, 14, 21], "txt": 11, "shortcut": 11, "m": [11, 12, 25, 26], "pip": 11, "dev": [11, 12, 17, 19, 25], "reticul": [11, 23], "irkernel": 11, "command": 11, "installspec": 11, "directori": 11, "link": [11, 17, 20], "onc": [11, 12, 17, 21, 26], "script": [11, 25], "cell": [11, 13, 17, 21, 25], "magic": [11, 23], "great": [12, 26], "admixtur": [12, 26], "archaic": 12, "hominin": 12, "2010": 12, "geneticist": 12, "sankararaman": 12, "tract": 12, "heurist": 12, "recipi": 12, "quantifi": 12, "durand": 12, "clock": 12, "calibr": 12, "date": [12, 13], "admixur": 12, "sankararamanm": 12, "earlier": [12, 25], "shorter": [12, 20], "harder": 12, "detect": [12, 22], "poulat": 12, "share": [12, 16, 17, 21, 25, 26], "difficult": [12, 16, 25], "distinguish": [12, 26], "incomplet": [12, 17], "il": 12, "loos": 12, "motiv": 12, "africa": [12, 18, 25], "eurasia": [12, 25], "categori": 12, "ii": 12, "eurasian": [12, 18, 25], "iii": 12, "unambigu": 12, "due": [12, 15, 17, 25], "20mb": 12, "run_simul": 12, "kya": [12, 25], "unrealist": [12, 25], "merg": [12, 21, 25], "record_migr": [12, 25], "diff": [12, 25], "0f": [12, 15], "0mb": 12, "go": [12, 13, 14, 21, 23], "get_migrating_tract": 12, "neanderthal_id": 12, "migrating_tract": 12, "get_coalescing_tract": 12, "coalescing_tract": 12, "tract_left": 12, "mrca_pop": 12, "elif": 12, "get_eur_nea_tract": 12, "within_nea": 12, "eur_nea": 12, "denot": 12, "went": 12, "third": [12, 22, 25, 26], "migrating_l": 12, "migrating_tot": 12, "within_nea_tot": 12, "nea_eur_closest": 12, "373730": 12, "165617": 12, "4475561": 12, "0186865": 12, "00828085": 12, "22377805": 12, "accord": [12, 14, 25], "consider": [12, 25, 26], "300kya": 12, "50kya": 12, "year": [12, 25], "histogram": 12, "nea": 12, "eur": [12, 18], "firm": 12, "conclus": 12, "stand": 12, "confirm": 12, "assess": [12, 20], "outweigh": 12, "vast": [12, 15], "major": [12, 20, 22, 26], "orang": 12, "longest": 12, "intersect": 12, "longest_tract": 12, "argmax": 12, "upper": 12, "within_long": 12, "logical_or": 12, "logical_and": [12, 25], "eur_nea_long": 12, "hline": 12, "c0": 12, "c1": 12, "c2": 12, "breakdown": 12, "ytick": 12, "178kb": 12, "lot": 12, "chunk": 12, "reliabl": 12, "guid": 12, "rout": [12, 25], "hard": [12, 22, 25], "aros": 12, "impos": 12, "gather": 12, "get_mutation_popul": 12, "node_migr": 12, "mutation_popul": 12, "mig": 12, "migat": 12, "pypi": 12, "intervaltre": 12, "25kb": 12, "css": 12, "tick": [12, 26], "cccccc": 12, "85": [12, 25, 26], "25_000": [12, 25], "log_tim": [12, 18, 22, 25], "eu": 12, "moreov": [12, 21, 25], "comprehens": 12, "dataclass": 12, "high": [12, 20], "shouldn": [12, 15], "mess": [12, 25], "com": [12, 17, 19, 25], "codec": [12, 13], "json": [12, 13, 21], "extant_t": 12, "num_introgressed_mut": 12, "extant": [12, 14], "entiti": [13, 14, 17], "conform": 13, "metaschema": 13, "demonstr": [13, 17, 26], "decod": [13, 21], "ers0001": 13, "pcr": 13, "constraint": [13, 25], "table_metadata_schema": 13, "additionalproperti": 13, "ena": 13, "boolean": 13, "prettili": 13, "asdict": [13, 21], "indent": 13, "minor": 13, "valid": [13, 17, 21], "held": 13, "constructor": 13, "arbitrari": [13, 17, 22], "basic_schema": 13, "complex_schema": 13, "overwrit": [13, 21], "against": [13, 25, 26], "row_id": 13, "bob1234": 13, "accident": 13, "proper": 13, "validationerror": 13, "traceback": [13, 21], "683": 13, "validate_and_encode_row": [13, 21], "682": 13, "_validate_row": 13, "684": 13, "except": [13, 20, 21], "jsonschema": 13, "432": 13, "arg": [13, 18, 25, 26], "431": [13, 14], "iter_error": 13, "fail": 13, "ordereddict": 13, "metadatavalidationerror": 13, "individualt": [13, 21], "889": [13, 25], "empty_valu": 13, "891": 13, "ll_tabl": [13, 21], "892": 13, "893": 13, "685": 13, "686": 13, "encode_row": 13, "attempt": [13, 21, 22], "newkei": 13, "unexpect": 13, "mean_coverag": 13, "timestamp": 13, "ideal": [13, 22], "reconstruct": 13, "schema_dict": 13, "new_id": 13, "abc123": 13, "individual_t": 13, "nraw": 13, "packset_metadata": [13, 21], "set_column": [13, 21, 25], "append_column": 13, "prepar": 13, "metadata_column": 13, "etho1234": 13, "richard1235": 13, "albert1236": 13, "encoded_metadata_column": 13, "md": [13, 25], "md_offset": 13, "pack_byt": 13, "metadata_offset": [13, 21], "idflagslocationparentsmetadata": [13, 21], "Or": [13, 17, 18, 21, 23], "disabl": [13, 25], "custom": [13, 25], "hidden": [14, 25, 26], "break_po": 14, "return_count": 14, "left_posit": 14, "insert": 14, "right_posit": 14, "garbag": 14, "rid": 14, "forc": [14, 23, 25, 26], "reckon": 14, "remap": 14, "simplify_t": 14, "node_map": 14, "nodes_individu": 14, "remapped_pop": 14, "node1": 14, "node2": 14, "saniti": 14, "simplification_interv": 14, "simplify_mod": 14, "current_nod": 14, "800": [14, 17, 18, 25, 26], "critic": [14, 17], "mind": [14, 21], "compon": [14, 15], "determinist": 14, "satisfi": 14, "hold": 14, "test_interv": 14, "sure": [14, 21, 23], "ts_test": 14, "ignore_proven": 14, "101": 14, "134": 14, "167": 14, "266": 14, "299": 14, "332": 14, "365": 14, "398": 14, "464": 14, "497": [14, 23], "bug": 14, "encapsul": 14, "correct": [14, 25], "predict": [14, 15, 20, 26], "analyt": 14, "crude": 14, "catch": 14, "million": [14, 17, 18, 22, 26], "offspr": 14, "persist": [14, 22, 25], "aris": 14, "theta": 14, "twice": [14, 15], "uniformli": 14, "coeffici": 14, "synonym": 14, "sell": 14, "abil": [14, 15, 26], "plu": [14, 22], "neat": 14, "rest": [14, 17, 18, 22, 25], "port": 14, "workbook": 14, "primarili": [14, 15, 20, 25], "deal": [14, 17, 21, 22, 23, 26], "sensibl": [14, 17], "asid": 15, "studi": [15, 20, 22], "Of": 15, "wonder": 15, "cpu": [15, 16, 17], "inconsequenti": 15, "mutationless": 15, "1_000_000": [15, 17], "n_subpop": 15, "subpop_s": 15, "migration_r": 15, "deme": [15, 25], "ts_no_mut": 15, "pop_": 15, "subpop": 15, "island_model": 15, "ts_mutat": [15, 25], "456": [15, 21], "151": 15, "overlaid": [15, 21, 22, 25], "overlai": [15, 25], "fair": 15, "cost": 15, "remaind": 15, "focuss": [15, 25], "degre": 15, "descent": [15, 22], "identif": [15, 25], "nearest": 15, "neighbour": 15, "elsewher": 15, "1mb": 15, "sample_a": 15, "sample_b": 15, "av_tmrca": 15, "cover": [15, 21, 22, 25, 26], "pop_0": 15, "pop_1": 15, "42396": 15, "realist": [15, 20], "paper": [15, 20], "dualiti": 15, "patterson": 15, "6f": 15, "000840": 15, "low": 15, "framework": [15, 17, 18, 23], "ab_dist": 15, "av": 15, "previous": [15, 16, 21, 25], "multipli": 15, "84793": 15, "000848": 15, "stochast": 15, "evid": [15, 25, 26], "matplotlib_inlin": [15, 25], "n_rep": 15, "ts_rep": 15, "ts_mutated_rep": 15, "decreas": 15, "exagger": 15, "comparison": [15, 20], "fst_genealog": 15, "fst_genetic_var": 15, "crow": 15, "aoki": 15, "1984": 15, "pna": 15, "81": 15, "6073": 15, "eqn": 15, "fst_theori": 15, "scatter": 15, "axhlin": 15, "grei": [15, 25], "center": 15, "introduc": [15, 17, 21], "ultim": [15, 22], "goal": 15, "smooth": 15, "uneven": 15, "subject": [15, 20, 25], "1kb": 15, "sharei": 15, "especi": [15, 20, 21], "carefulli": 15, "accur": 15, "descriptor": 15, "thread": 16, "multiprocess": 16, "modul": 16, "offer": 16, "resourc": 16, "usag": 16, "lightweight": 16, "intens": [16, 25], "undertaken": 16, "cpython": 16, "lock": 16, "execut": 16, "bytecod": 16, "parallelis": 16, "nasti": 16, "pitfal": 16, "releas": 16, "gil": 16, "expens": 16, "proce": 16, "recreat": [16, 22], "stackoverflow": 16, "post": 16, "filenam": 16, "subprocess": 16, "transfer": 16, "evolutionari": [17, 18, 22, 26], "comb": 17, "pectin": 17, "129": 17, "70018196105957": 17, "1000000": 17, "97": [17, 18], "wall": 17, "2372": 17, "issuecom": 17, "1298518380": 17, "2628": 17, "solv": [17, 25], "huge": [17, 25, 26], "traversed_nod": 17, "travers": [17, 26], "1999999": 17, "\u00b5s": 17, "b1_index": 17, "39272472286399": 17, "74": [17, 25], "ns": 17, "67": [17, 18], "newick": [17, 23], "2187": 17, "xxx": [17, 25], "mainli": 17, "tsconvert": 17, "from_newick": 17, "unifi": 17, "phylogeni": 17, "hybrid": [17, 26], "correl": [17, 22, 26], "seven": 17, "background": [17, 25, 26], "clade": [17, 25], "nice": [17, 23, 25], "roll": 17, "node_object": 17, "nodes5": 17, "size942": 17, "264": 17, "511": 17, "heavili": 17, "tend": [17, 25], "node_id": [17, 25], "parent_arrai": 17, "is_leaf": 17, "emphasis": 17, "edge_id": 17, "coordin": [17, 18, 21, 25], "numba": 17, "n_id": [17, 25], "levelord": 17, "colless": 17, "imbal": 17, "colless_index": 17, "squar": [17, 21, 22, 25], "is_sampl": [17, 25, 26], "n_is_sampl": 17, "bootstrap": 17, "awai": [17, 25], "implicit": 17, "cladogram": 17, "uncalibr": 17, "implic": 17, "tempor": 17, "imposs": [17, 22], "extend": [17, 25, 26], "unknown": [17, 21, 22, 25], "turn": [17, 25], "target_node_1": 17, "target_node_2": 17, "2627": 17, "mix": [17, 18], "path_length": 17, "branch_dist": 17, "unlink": 17, "seq": 17, "keep_edg": [17, 25], "replace_with": [17, 25], "erased_t": 17, "empty_tre": 17, "strang": 17, "corner": 17, "demo": 17, "bring": [17, 18], "popgen": 17, "kc": 17, "metric": 17, "93": 17, "mutated_t": [17, 26], "3e": 17, "mutated_tre": 17, "47": 17, "77": 17, "87": 17, "91": [17, 25], "115": 17, "116": 17, "117": 17, "126": 17, "130": 17, "143": 17, "203": 17, "230": 17, "247": 17, "317": 17, "335": 17, "355": 17, "364": 17, "382": 17, "426": 17, "430": 17, "433": 17, "516": 17, "523": 17, "540": 17, "623": 17, "671": 17, "711": 17, "737": 17, "742": 17, "752": 17, "803": 17, "819": 17, "842": 17, "849": 17, "861": 17, "913": 17, "922": 17, "41": [17, 22], "965": 17, "975": 17, "43": [17, 25], "979": 17, "988": 17, "45": 17, "997": 17, "missing_data_charact": [17, 26], "ggt": 17, "gga": 17, "gat": [17, 21], "aat": 17, "shine": 17, "adequ": 17, "pervas": 17, "undergon": 17, "enorm": 17, "edge_id_above_node_4": 17, "left_coord_for_edg": 17, "reset": [17, 25], "coord": 17, "multi_t": 17, "side": [17, 25], "lack": 17, "presenc": 17, "dna": [18, 21, 22], "jointli": 18, "core": 18, "scalabl": [18, 25], "interact": [18, 25], "homo": 18, "sapien": 18, "asian": 18, "american": 18, "demesdraw": [18, 25, 26], "schemat": [18, 25, 26], "americanadmixture_4b11": 18, "tube": [18, 25], "to_dem": 18, "gca": 18, "kilobas": 18, "afr": 18, "asia": 18, "20000": [18, 26], "inspect": [18, 25], "breviti": 18, "id0": 18, "position1348": 18, "samples32": 18, "alleles2": [18, 21], "78": 18, "datafals": 18, "missingtru": 18, "id1": 18, "position2062": 18, "id2": 18, "position3046": 18, "sample_id": 18, "cccacgcgcggtacaatctttgtgaccgttagagcttta": 18, "cccaaacgcagtacaacgtcagggaccgttagagcttgg": 18, "acaacgcgcgttacaatctttgtgaccgttagagctttg": 18, "cccaaacgcagtacaacctcagggaccgttagagcttta": 18, "cccaaacctagtaaaacctcatggcccgttagtgcgctt": 18, "acaacgcgcggtacaatctttgtaaccgttagagcttta": 18, "acaacgcgcggtacaatctttgtaaccgttagagctttg": 18, "acaacgcgcggtacaatctttgtaagcgttagagctttg": 18, "aaaacgcgcggtacaatctttgtaaccgtaagagctttg": 18, "acaacgcgcggtacaatctttgtaaccgtaagagctttg": 18, "acaacgcgcggtacaatctttgtaaccggtagagctttg": 18, "acaacgcgcggtacaatctttgtaaccgttaaagctttg": 18, "acatcgcgcggtacaatctttgtaaccgttaaagctttg": 18, "acaacgcgcggtacaatctttgtaaccctaagagttttg": 18, "acaacgcgcggtacaatctttgtgacggttagagctttg": 18, "acaacgcgcggtccgatctttgtaagcgttagagctttg": 18, "acaacgcgcggcacaatctttgtaaccggtagagctttg": 18, "cccaaacgcagtacaacctcagggaccgtttgtgcgctt": 18, "acaacgcgcggtacactctttgtaaccgtaagagctttg": 18, "accaaatgcagtacaaccacagggaccgttagatcttta": 18, "pop_id": 18, "2_000": 18, "f_st": 18, "grab": 18, "cyan": [18, 25], "rotat": [18, 22, 25], "anchor": [18, 22, 25], "90deg": [18, 22, 25], "translat": [18, 22, 25], "6px": [18, 22, 25], "capit": 18, "520": 18, "30_000": 18, "vcf": [18, 26], "7500": 18, "project": [18, 25], "108mb": 18, "110mb": 18, "edar": 18, "compress": [18, 22, 26], "tszip": 18, "decompress": 18, "unified_genealogy_2q_108mb": 18, "tsz": 18, "encompass": [18, 26], "chr": 18, "rs3827760": 18, "edar_gene_bound": 18, "108_894_471": 18, "108_989_220": 18, "focal_vari": 18, "id9378": 18, "position108897145": 18, "samples836": 18, "384": 18, "46": 18, "452": 18, "54": 18, "east": 18, "num_popul": [18, 22], "pop_names_region": 18, "bantukenya": 18, "bantusouthafrica": 18, "biaka": 18, "cambodian": 18, "east_asia": 18, "62": [18, 22], "uygur": 18, "eastasia": 18, "xibo": 18, "64": [18, 25], "yi": 18, "65": 18, "yoruba": 18, "66": 18, "denisovan": 18, "rgn": 18, "edar_t": 18, "tajimas_d": 18, "amount": [18, 25], "plot_data": 18, "axvspan": 18, "lightgrai": 18, "axvlin": 18, "scikit": 18, "geograph": [18, 21, 25], "brief": 18, "taster": 18, "research": 18, "52": [19, 21], "peter": 20, "ralph": 20, "explor": 20, "histor": [20, 21], "scenario": 20, "benchmark": 20, "evalu": 20, "methodolog": 20, "accuraci": 20, "inferenti": 20, "train": 20, "eg": 20, "bayesian": 20, "potenti": [20, 22, 25], "impract": 20, "focus": 20, "fwdpy": 20, "capac": 20, "benefit": [20, 26], "afterward": 20, "extrapol": 20, "curv": 20, "minut": 20, "hour": 20, "104": 20, "bulk": 21, "eight": 21, "tables_exampl": 21, "live": [21, 26], "nodet": 21, "21010": 21, "30020": 21, "15000000": 21, "60000000": 21, "80000000": 21, "ag": [21, 25, 26], "contemporari": 21, "edget": 21, "0208030": 21, "1208032": 21, "2010041": 21, "302042": 21, "48010042": 21, "5208043": 21, "68010050": 21, "78010054": 21, "802060": 21, "902064": 21, "tables_example_mut": 21, "depict": [21, 25], "cross": [21, 25], "sitet": 21, "015a": 21, "142g": 21, "260t": 21, "mutationt": 21, "idsitenodetimederived_stateparentmetadata": 21, "0040": 21, "90000000g": 21, "1110": 21, "40000000a": 21, "2230": 21, "55000000c": 21, "3200": [21, 26], "10000000t2": 21, "agt": 21, "ggc": 21, "migrationt": 21, "provenancet": 21, "populationt": 21, "idmetadata": 21, "gbr": [21, 22], "british": [21, 22, 25], "england": [21, 22], "scotland": [21, 22], "visibl": [21, 25, 26], "topic": 21, "002": 21, "alic": [21, 25], "102": 21, "bob": [21, 22, 25], "carol": 21, "referenc": 21, "matern": 21, "patern": 21, "indivividu": 21, "famili": [21, 25, 26], "sibl": 21, "schema": 21, "nequival": 21, "new_tabl": 21, "everi": [21, 22, 25, 26], "node_t": 21, "25000000": 21, "40000000": 21, "85000000": 21, "05000000": 21, "valueerror": 21, "488": [21, 22], "baset": 21, "__setattr__": 21, "486": 21, "487": 21, "1210": 21, "1177": 21, "1178": 21, "1179": 21, "1207": 21, "1208": 21, "1209": 21, "_check_required_arg": 21, "1211": 21, "1212": 21, "1213": 21, "1214": 21, "1215": 21, "1216": 21, "1217": 21, "1218": 21, "1219": 21, "1220": 21, "brace": 21, "raw": 21, "nodetablerow": 21, "slice": [21, 25], "01010": 21, "10020": 21, "sitetablerow": 21, "enforc": 21, "frozeninstanceerror": 21, "entri": [21, 22], "replacement_row": 21, "new_po": 21, "new_site_id": 21, "feed": 21, "015c": 21, "310gb": 21, "nonsens": 21, "constitu": 21, "nondecreas": 21, "altered_t": 21, "won": 21, "tickmark": [21, 25, 26], "ever": 21, "extrem": 21, "construction_exampl": 21, "alia": 21, "edge_t": 21, "00100020": 21, "10100021": 21, "20100042": 21, "30100043": 21, "atgc": 21, "barrier": 21, "delete_sit": [21, 26], "certain": [21, 25, 26], "union": 21, "strip": 21, "sites_with_a_singleton_allel": 21, "non_missing_genotyp": 21, "ts_new": 21, "109": 21, "saw": 21, "individualtablerow": 21, "robert": 21, "edited_t": 21, "rag": 21, "suffic": 21, "packset_": 21, "surnam": 21, "new_metadata": 21, "smith": 21, "validated_metadata": 21, "parsimoni": [21, 26], "placement": [21, 26], "recurr": [21, 25], "reus": 21, "anc_stat": 21, "compute_mutation_par": 21, "compute_mutation_tim": 21, "parsimonious_t": 21, "fewer": [21, 25], "v1": [21, 25], "v2": 21, "alleles1": 21, "verifi": 21, "154": 21, "hope": 22, "piqu": 22, "serv": [22, 25], "download": [22, 25], "datafil": 22, "biolog": [22, 26], "workaround": [22, 25], "multi": [22, 23], "contigu": 22, "organ": 22, "convention": 22, "moment": [22, 25], "symbol": [22, 25, 26], "duplic": [22, 26], "emphas": 22, "307": 22, "567": 22, "uk": 22, "biobank": 22, "uncompress": 22, "gigabyt": 22, "rare": 22, "explictli": 22, "rightarrow1": 22, "rightarrow10": 22, "rightarrow8": 22, "rightmost": [22, 25], "relianc": 22, "first_tre": 22, "parent_of_7": 22, "children_of_7": 22, "childen": 22, "autosom": 22, "spatial": [22, 26], "ada": 22, "cat": 22, "num_individu": 22, "mate": 22, "nan": 22, "unknown_tim": [22, 25], "751": 22, "homozyg": 22, "heterozyg": 22, "coupl": [22, 23], "suffici": 22, "bother": 22, "silent": 22, "monomorph": 22, "bifurc": 22, "coalec": 22, "polytomi": 22, "coales": 22, "physic": 22, "literatur": 22, "concentr": 22, "undetect": 22, "logic": 22, "realis": 22, "outcom": 22, "2019": 22, "screen": 22, "plain": [22, 25], "trees3": 22, "nodes6": 22, "size3": 22, "166": 22, "53": 22, "344": [22, 23], "255": 22, "session": 23, "haven": [23, 25], "render": [23, 25], "414": 23, "No": [23, 25], "ye": 23, "954": 23, "6kb": 23, "bare": 23, "digit": 23, "Will": 23, "coerc": 23, "prepend": [23, 25], "0l": 23, "attent": 23, "paid": 23, "root_id": 23, "4634393266485": 23, "ts_mut": 23, "000720238095238095": 23, "matric": 23, "00010000": 23, "00000010": 23, "00100000": 23, "00110110": 23, "01110110": 23, "01111111": 23, "00001001": 23, "00001000": 23, "allele_frequ": 23, "rowmean": 23, "1250": 23, "6250": 23, "8750": 23, "125": 23, "repr_html": 23, "obj": 23, "_repr_html_": 23, "repr_svg": 23, "svgstring": 23, "__str__": 23, "nicer": 23, "tabular": 23, "trees6": 23, "length6000": 23, "nodes8": 23, "size6": 23, "136": 23, "568": 23, "341": 23, "inlin": [23, 25], "popular": 23, "ap": 23, "nexu": 23, "tempfil": 23, "write_nexu": 23, "warn": 23, "as_newick": 23, "downward": [23, 25], "srt": 23, "adj": 23, "Be": 23, "ascii": 25, "unicod": 25, "vector": 25, "50kb": 25, "subdivis": 25, "markdown": 25, "menubar": 25, "ts_tini": 25, "viz_ts_tini": 25, "ts_small": 25, "viz_ts_smal": 25, "ts_full": 25, "viz_ts_ful": 25, "brows": 25, "reproduc": 25, "draw_text": 25, "unspecifi": 25, "chri": 25, "dora": 25, "11428": 25, "11144": 25, "9753": 25, "6204": 25, "3893": 25, "3378": 25, "92": 25, "2076": 25, "1941": 25, "72": 25, "1439": 25, "9855": 25, "13901": 25, "21285": 25, "23424": 25, "25213": 25, "30463": 25, "46237": 25, "Being": 25, "vectoris": 25, "suitabl": 25, "svg_size": 25, "svg_string": 25, "x_scale": 25, "treewis": 25, "wrap": 25, "circl": 25, "hide": 25, "apolog": 25, "reader": 25, "spell": 25, "eas": 25, "imag": 25, "unconvent": 25, "linear": 25, "shade": [25, 26], "obscur": 25, "overlap": 25, "advis": 25, "slighli": 25, "x_limit": 25, "15000": [25, 26], "evenli": 25, "y_tick_po": 25, "3000": 25, "4000": 25, "third_tre": 25, "bunch": 25, "faint": 25, "shrink": 25, "wide_fmt": 25, "stylesheet": 25, "node_label_styl": 25, "omit_sit": 25, "chevron": 25, "342": 25, "viz_ts_small_mut": 25, "site_descr": 25, "13963": 25, "619": 25, "6499091610359": 25, "370": 25, "24979591084764": 25, "6295": 25, "all_edge_mut": 25, "fall": 25, "terribl": 25, "intuitu": 25, "nd_label": 25, "manipul": 25, "cascad": 25, "sheet": 25, "programmat": 25, "css_string": 25, "clearer": 25, "p0": 25, "p1": 25, "p2": 25, "divis": 25, "substructur": 25, "hood": 25, "579": 25, "rgt": 25, "lft": 25, "justif": 25, "a10": 25, "i3": 25, "m16": 25, "m17": 25, "s15": 25, "s16": 25, "s17": 25, "a15": 25, "2px": [25, 26], "programat": 25, "gradual": 25, "disappear": 25, "central": 25, "ts_select": 25, "viz_ts_select": 25, "css_edge_target": 25, "sweep_loc": 25, "focal_tre": 25, "wide_tall_fmt": 25, "4e4": 25, "mouseov": 25, "hover": 25, "pseudoclass": 25, "html": [25, 26], "2e": 25, "node_label_css": 25, "hover_exampl": 25, "mut_label_css": 25, "optional_css": 25, "bold": 25, "plotbox": 25, "ccc": 25, "fcc": 25, "3e4": 25, "7e4": 25, "nodeid": 25, "position2416624621tim": 25, "01000sampl": 25, "fsampl": 25, "gsampl": 25, "hsampl": 25, "jsampl": 25, "knodeid": 25, "19nodeid": 25, "24sampl": 25, "csampl": 25, "enodeid": 25, "15sampl": 25, "dsampl": 25, "bsampl": 25, "inodeid": 25, "12sampl": 25, "asampl": 25, "lnodeid": 25, "18nodeid": 25, "20nodeid": 25, "21nodeid": 25, "25nodeid": 25, "26nodeid": 25, "27nodeid": 25, "28sampl": 25, "16nodeid": 25, "15po": 25, "24257": 25, "hpo": 25, "26806": 25, "jpo": 25, "26623": 25, "apo": 25, "25540": 25, "22nodeid": 25, "insid": 25, "img": 25, "tag": 25, "wrapper": 25, "resiz": 25, "5px": 25, "overrid": 25, "7pt": 25, "12px": [25, 26], "10pt": 25, "outsiz": 25, "canva": 25, "rescal": 25, "radic": 25, "radian": 25, "skewi": 25, "rad": 25, "shift_axi": 25, "bigger": 25, "crop": 25, "svg2": [25, 26], "inkscap": 25, "librsvg": 25, "incorrectli": 25, "chromium": 25, "clip": 25, "triangl": 25, "8px": 25, "polygon": 25, "14px": 25, "16px": 25, "hid": 25, "sophist": 25, "hierarch": 25, "a2": 25, "i1": 25, "m0": 25, "s0": 25, "rect": 25, "i2": 25, "t1": 25, "t2": [25, 26], "nest": 25, "thicker": 25, "edge_styl": 25, "n13": 25, "nd_lab": 25, "deliber": 25, "least": 25, "deep": 25, "invis": 25, "default_mut": 25, "grai": 25, "m8_mut": 25, "m8": 25, "selector": 25, "node_style1": 25, "node_style2": 25, "n15": 25, "hide_internal_symlab": 25, "show_leaf_symlab": 25, "viewer": 25, "style_str": 25, "embed": [25, 26], "myuid": 25, "00ff00": 25, "feel": 25, "free": 25, "inspir": 25, "editor": 25, "bitmap": 25, "imagemagick": 25, "configur": 25, "deleg": 25, "misalign": 25, "programm": 25, "headless": 25, "cope": 25, "menu": 25, "arrang": 25, "ungroup": 25, "o": [25, 26], "tree_str": 25, "nbsp": 25, "necessit": 25, "nomin": 25, "force_root_branch": 25, "io": 25, "make_unusual_t": 25, "stringio": 25, "1145014598813": 25, "11067965364865": 25, "75005250750382": 25, "31067154311640": 25, "57331354884652": 25, "08308317451295": 25, "load_text": 25, "pink": 25, "m2": 25, "m3": 25, "m4": 25, "circular": [25, 26], "neither": 25, "nonsampl": [25, 26], "swap_samples_t": 25, "unconnect": 25, "san": 25, "serif": 25, "make_standard_t": 25, "370009": 25, "001": 25, "thin": 25, "argwher": 25, "ediff1d": 25, "hang": 25, "centr": 25, "dddddd": 25, "hsl": 25, "max_root_tim": 25, "260": 25, "pseudo": 25, "make_introgression_t": 25, "base_s": 25, "x_shift": 25, "translatex": 25, "rightward": 25, "250px": 25, "lightgrei": 25, "dasharrai": 25, "3rd": 25, "magenta": 25, "4th": 25, "darkgrei": 25, "5th": 25, "europ": 25, "max_num_tre": 25, "underneath": 25, "compactli": 25, "clonal_mrca": 25, "most_rec": 25, "clonal": 25, "param": 25, "bool": 25, "rtype": 25, "edges_out": 25, "edges_in": 25, "is_full_length_clon": 25, "clonal_nod": 25, "isin": 25, "clonal_t": 25, "ascend": 25, "non_clonal_ancestor": 25, "deleted_edg": 25, "logical_not": 25, "remove_edg": 25, "clonal_tre": 25, "num_children": 25, "1e2": 25, "83": 25, "clone": 25, "ts_simp": 25, "9px": 25, "15px": 25, "13px": 25, "stagger": 25, "trigonometri": 25, "toler": 25, "math": 25, "make_7_tree_4_tip_t": 25, "tip_ord": 25, "minlex_postord": [25, 26], "adjust": 25, "tree_width": 25, "y_step": 25, "20px": 25, "angl": 25, "atan": 25, "ax_mv": 25, "tan": 25, "js": 25, "sucess": 25, "spr": 25, "make_full_arg_for_spr_anim": 25, "00005": 25, "6787": 25, "smc_prime": 25, "anim_svg": 25, "html_string": 25, "src": 25, "v4": 25, "getrelativexi": 25, "var": 25, "_group": 25, "createsvgpoint": 25, "ctm": 25, "getctm": 25, "matrixtransform": 25, "animate_spr": 25, "selectal": 25, "attr": 25, "source_tre": 25, "target_tre": 25, "dur": 25, "delai": 25, "datum": 25, "transform_tre": 25, "buggi": 25, "hierarchi": 25, "src_tree": 25, "alert": 25, "bad": 25, "hack": 25, "parseint": 25, "src_tree_po": 25, "target_tree_po": 25, "src_xy": 25, "target_xi": 25, "movement": 25, "svg_text": 25, "getelementbyid": 25, "innerhtml": 25, "button": 25, "onclick": 25, "position0741138132751000001418911263451315161701412789113451315161701278912143451315161701434512781013151617": 25, "outlin": 25, "graphviz": 25, "variable_edge_width": 25, "drag": 25, "trial": 25, "tradit": 25, "full_arg_t": 25, "dot": 25, "layout": 25, "graphviz_svg": 25, "networkx_graph": 25, "nx_agraph": 25, "to_agraph": 25, "agraph": 25, "nodes_at_time_0": 25, "add_subgraph": 25, "prog": 25, "upon": [25, 26], "get_graphviz_posit": 25, "get_nod": 25, "edge_label": 25, "dark": 25, "node_color": 25, "007700": 25, "font_siz": 25, "node_s": 25, "node_shap": 25, "nodelist": 25, "edgelist": 25, "draw_networkx_label": 25, "font_color": 25, "alphabet": [25, 26], "22ccff": 25, "edgecolor": 25, "draw_networkx_edg": 25, "edge_color": 25, "arrow": 25, "draw_networkx_edge_label": 25, "tricki": 25, "backend_inlin": 25, "set_matplotlib_format": 25, "size_max": 25, "max": 25, "start_siz": 25, "end_siz": 25, "popsim": 25, "consortium": 25, "yml": 25, "spec": 25, "whatis_exampl": [25, 26], "ancestral_popul": 25, "lat": 25, "landscap": 25, "summar": 26, "mathrm": 26, "genome_ord": 26, "style1": 26, "sz": 26, "189": 26, "546": 26, "357": 26, "454": 26, "interconnect": 26, "knowledg": 26, "twelv": 26, "nucleotid": 26, "987": 26, "4g": 26, "51": 26, "108": 26, "417": 26, "496": 26, "569": 26, "617": 26, "731": 26, "822": 26, "863": 26, "907": 26, "highlight": 26, "kept_edg": 26, "style3": 26, "svg1": 26, "00dd00": 26, "billion": 26, "planet": 26, "magnitud": 26, "publish": 26, "expand": 26, "pictur": 26, "1f77b4": 26, "ff7f0e": 26, "2ca02c": 26, "style2": 26, "deduc": 26, "flip": 26, "s_flag": 26, "no_flag": 26, "ts_flip": 26, "19697": 26, "12059": 26, "10172": 26, "9770": 26, "q": 26, "3795": 26, "3215": 26, "1428": 26, "1249": 26, "449": 26, "377": 26, "de": 26, "novo": 26, "perfom": 26, "jump": 26, "straight": 26}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"advanc": [0, 14], "msprime": 0, "topic": 0, "analys": [1, 2], "tree": [1, 2, 3, 6, 9, 17, 20, 21, 22, 25, 26], "sequenc": [1, 3, 6, 17, 20, 21, 22, 25, 26], "comput": [1, 9, 26], "statist": [1, 9, 15], "One": 1, "wai": 1, "multi": 1, "allel": [1, 9], "frequenc": [1, 4], "spectra": 1, "joint": 1, "branch": [1, 4, 15], "length": [1, 4, 15], "zeroth": 1, "final": 1, "entri": 1, "af": 1, "travers": [2, 3], "upward": 2, "inform": [2, 18, 23], "networkx": 2, "calcul": [2, 3], "distanc": 2, "root": [2, 5, 17], "find": 2, "nearest": 2, "neighbor": 2, "parsimoni": 2, "build": [2, 8], "tabl": [2, 13, 21, 22], "miss": 2, "data": [2, 9, 17, 21, 26], "fast": 2, "base": [2, 15, 25], "algorithm": [2, 10], "us": 2, "numba": 2, "todo": [2, 3, 7, 10, 14, 16, 17, 18, 19, 20, 25], "arg": [3, 22], "full": 3, "visual": [3, 25], "local": 3, "ariti": 3, "spr": [3, 22], "recombin": [3, 8, 22], "likelihood": 3, "simplif": [3, 8, 14, 19], "disadvantag": 3, "format": [3, 9, 25], "tskit": [3, 9, 17, 18, 23], "work": [3, 13], "graph": [3, 25], "parent": 3, "node": [3, 8, 17, 21, 22, 25], "child": 3, "other": [3, 11, 25], "analysi": [3, 15, 18, 23], "softwar": 3, "instantan": 4, "bottleneck": 4, "check": 4, "sf": 4, "against": 4, "analyt": 4, "expect": 4, "coalesc": [4, 8], "time": [4, 17], "The": [4, 17], "distribut": 4, "pairwis": 4, "approxim": 4, "site": [4, 9, 21, 22], "spectrum": 4, "margin": 4, "n": 4, "ton": 4, "multipl": [4, 17], "popul": [4, 7, 18, 21, 22], "complet": 5, "forward": [5, 8, 14], "simul": [5, 8, 14, 18, 20], "why": 5, "keep": 5, "input": 5, "i": 5, "e": 5, "initi": 5, "gener": 5, "topolog": [5, 6, 18], "gotcha": 5, "count": 6, "label": [6, 25], "shape": 6, "enumer": 6, "method": [6, 13, 17, 23], "larg": 6, "embed": 6, "over": 6, "demographi": 7, "structur": [7, 25], "migrat": 7, "constant": 7, "chang": [7, 8, 22], "rate": 7, "admixtur": 7, "split": 7, "mass": 7, "size": 7, "growth": 7, "censu": 7, "event": 7, "debug": 7, "definit": 8, "approach": 8, "setup": 8, "core": 8, "step": 8, "inherit": 8, "without": 8, "basic": 8, "exampl": [8, 25], "id": [8, 17, 23, 25], "remov": 8, "intermedi": 8, "larger": [8, 25], "ensur": 8, "more": [8, 25], "complex": 8, "get": 9, "start": 9, "process": [9, 25], "mutat": [9, 12, 14, 15, 21, 22, 25], "genotyp": 9, "window": 9, "save": 9, "export": 9, "newick": 9, "nexu": 9, "vcf": 9, "scikit": 9, "kei": [9, 26], "point": [9, 26], "cover": 9, "abov": 9, "increment": 10, "welcom": 11, "sourc": 11, "help": 11, "run": 11, "tutori": [11, 24], "code": 11, "download": 11, "datafil": 11, "introgress": 12, "locat": 12, "metadata": [13, 17, 21], "read": [13, 26], "schema": 13, "modifi": 13, "view": 13, "raw": 13, "bulk": 13, "binari": 13, "repeat": 14, "invari": 14, "interv": 14, "summari": [14, 15], "technic": 14, "note": 14, "do": 15, "you": 15, "realli": 15, "need": 15, "absenc": 15, "genet": [15, 17, 18, 26], "variat": 15, "pattern": 15, "relationship": 15, "equival": 15, "genealog": [15, 26], "measur": 15, "ar": [15, 17, 25], "less": 15, "noisi": 15, "parallel": 16, "phylogenet": 17, "hint": 17, "phylogeneticist": 17, "alwai": 17, "part": 17, "integ": 17, "edg": [17, 21, 22], "object": 17, "sampl": [17, 22, 25], "attribut": [17, 23], "must": 17, "have": 17, "multiroot": 17, "store": 17, "access": [17, 21], "infer": 18, "further": [18, 23, 26], "advantag": 20, "some": 20, "tip": [20, 23], "edit": [21, 25], "correspond": 21, "between": 21, "overview": 21, "individu": [21, 22], "column": 21, "row": 21, "turn": 21, "sort": 21, "construct": 21, "minor": 21, "major": 21, "terminolog": 22, "concept": 22, "genom": 22, "proven": 22, "ancestr": 22, "r": 23, "index": 23, "jupyt": 23, "notebook": 23, "interact": 23, "librari": 23, "develop": 24, "new": 24, "text": 25, "svg": 25, "ax": 25, "scale": 25, "plot": 25, "which": 25, "shown": 25, "style": 25, "avail": 25, "css": 25, "class": 25, "within": 25, "area": 25, "outsid": 25, "graphic": 25, "element": 25, "dynam": 25, "effect": 25, "transform": 25, "mask": 25, "subtre": 25, "restrict": 25, "about": [25, 26], "convert": 25, "orient": 25, "A": [25, 26], "standard": 25, "ts": 25, "highlight": 25, "leaf": 25, "isol": 25, "fanci": 25, "tick": 25, "gridlin": 25, "simplifi": 25, "3d": 25, "anim": 25, "represent": 25, "demograph": 25, "geographi": 25, "what": 26, "how": 26, "think": 26, "creat": 26, "network": 26, "an": 26, "effici": 26, "encod": 26, "dna": 26, "record": 26, "ancestri": 26, "framework": 26}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.todo": 2, "sphinx": 56}})
\ No newline at end of file
diff --git a/tskitr.html b/tskitr.html
index fe92dae..a01b9b6 100644
--- a/tskitr.html
+++ b/tskitr.html
@@ -418,7 +418,7 @@ <h2> Contents </h2>
 ╟───────────┼────┼─────────┼────────────╢
 ║Populations│   1│224 Bytes│         Yes║
 ╟───────────┼────┼─────────┼────────────╢
-║Provenances│   1│953 Bytes│          No║
+║Provenances│   1│954 Bytes│          No║
 ╟───────────┼────┼─────────┼────────────╢
 ║Sites      │   0│ 16 Bytes│          No║
 ╚═══════════╧════╧═════════╧════════════╝
diff --git a/viz.html b/viz.html
index 8e842c5..6a707f6 100644
--- a/viz.html
+++ b/viz.html
@@ -1386,66 +1386,66 @@ <h4>Tree orientation<a class="headerlink" href="#tree-orientation" title="Permal
 </div>
 </details>
 <div class="cell_output docutils container">
-<div class="output text_html"><pre style='display: inline-block'>          14   
-        ┏━━┻━━┓
-       13     ┃
-     ┏━━┻━━━┓ ┃
-    12      ┃ ┃
-  ┏━━┻━━┓   ┃ ┃
-  ┃    11   ┃ ┃
-  ┃    ┏┻━┓ ┃ ┃
- 10    ┃  ┃ ┃ ┃
-┏━┻┓   ┃  ┃ ┃ ┃
-┃  9   ┃  ┃ ┃ ┃
-┃ ┏┻┓  ┃  ┃ ┃ ┃
-┃ ┃ ┃  8  ┃ ┃ ┃
-┃ ┃ ┃ ┏┻┓ ┃ ┃ ┃
-0 4 7 2 5 6 3 1
-</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>             ┏━━━━0
-             ┃     
-        ┏━━10┫ ┏━━4
-        ┃    ┗9┫   
-        ┃      ┗━━7
-     ┏12┫          
-     ┃  ┃        ┏2
-     ┃  ┃  ┏━━━━8┫ 
-  ┏13┫  ┗11┫     ┗5
-  ┃  ┃     ┃       
-  ┃  ┃     ┗━━━━━━6
-14┫  ┃             
-  ┃  ┗━━━━━━━━━━━━3
-  ┃                
-  ┗━━━━━━━━━━━━━━━1
-</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>0 4 7 2 5 6 3 1
-┃ ┃ ┃ ┗┳┛ ┃ ┃ ┃
-┃ ┃ ┃  8  ┃ ┃ ┃
-┃ ┗┳┛  ┃  ┃ ┃ ┃
-┃  9   ┃  ┃ ┃ ┃
-┗━┳┛   ┃  ┃ ┃ ┃
- 10    ┃  ┃ ┃ ┃
-  ┃    ┗┳━┛ ┃ ┃
-  ┃    11   ┃ ┃
-  ┗━━┳━━┛   ┃ ┃
-    12      ┃ ┃
-     ┗━━┳━━━┛ ┃
-       13     ┃
-        ┗━━┳━━┛
-          14   
-</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>0━━━━┓             
+<div class="output text_html"><pre style='display: inline-block'>       14      
+   ┏━━━━┻━━━┓  
+  13        ┃  
+┏━━┻━━┓     ┃  
+┃    12     ┃  
+┃   ┏━┻━┓   ┃  
+┃   ┃   ┃  11  
+┃   ┃   ┃ ┏━┻┓ 
+┃   ┃   ┃ ┃ 10 
+┃   ┃   ┃ ┃ ┏┻┓
+┃   9   ┃ ┃ ┃ ┃
+┃ ┏━┻┓  ┃ ┃ ┃ ┃
+┃ ┃  8  ┃ ┃ ┃ ┃
+┃ ┃ ┏┻┓ ┃ ┃ ┃ ┃
+0 1 3 4 5 2 6 7
+</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>     ┏━━━━━━━━━━━━0
      ┃             
-4━━┓ ┣10━━┓        
-   ┣9┛    ┃        
-7━━┛      ┃        
-          ┣12┓     
-2┓        ┃  ┃     
- ┣8━━━━┓  ┃  ┃     
-5┛     ┣11┛  ┣13┓  
-       ┃     ┃  ┃  
-6━━━━━━┛     ┃  ┃  
-             ┃  ┣14
-3━━━━━━━━━━━━┛  ┃  
+     ┃         ┏━━1
+  ┏13┫         ┃   
+  ┃  ┃  ┏━━━━━9┫ ┏3
+  ┃  ┃  ┃      ┗8┫ 
+  ┃  ┗12┫        ┗4
+  ┃     ┃          
+14┫     ┗━━━━━━━━━5
+  ┃                
+  ┃       ┏━━━━━━━2
+  ┃       ┃        
+  ┗━━━━━11┫  ┏━━━━6
+          ┗10┫     
+             ┗━━━━7
+</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>0 1 3 4 5 2 6 7
+┃ ┃ ┗┳┛ ┃ ┃ ┃ ┃
+┃ ┃  8  ┃ ┃ ┃ ┃
+┃ ┗━┳┛  ┃ ┃ ┃ ┃
+┃   9   ┃ ┃ ┃ ┃
+┃   ┃   ┃ ┃ ┗┳┛
+┃   ┃   ┃ ┃ 10 
+┃   ┃   ┃ ┗━┳┛ 
+┃   ┃   ┃  11  
+┃   ┗━┳━┛   ┃  
+┃    12     ┃  
+┗━━┳━━┛     ┃  
+  13        ┃  
+   ┗━━━━┳━━━┛  
+       14      
+</pre>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<pre style='display: inline-block'>0━━━━━━━━━━━━┓     
+             ┃     
+1━━┓         ┃     
+   ┃         ┣13┓  
+3┓ ┣9━━━━━┓  ┃  ┃  
+ ┣8┛      ┃  ┃  ┃  
+4┛        ┣12┛  ┃  
+          ┃     ┃  
+5━━━━━━━━━┛     ┣14
                 ┃  
-1━━━━━━━━━━━━━━━┛  
+2━━━━━━━┓       ┃  
+        ┃       ┃  
+6━━━━┓  ┣11━━━━━┛  
+     ┣10┛          
+7━━━━┛             
 </pre></div></div>
 </div>
 </section>
@@ -2405,7 +2405,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
 
 .saving .message {
     display: none;
-}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_2840873883'class='d3arg' style='min-width:590px; min-height:655px;'></div><script>var line = d3.line();
+}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_3920492240'class='d3arg' style='min-width:590px; min-height:655px;'></div><script>var line = d3.line();
 var step = d3.line().curve(d3.curveStep);
 var stepAfter = d3.line().curve(d3.curveStepAfter);
 var stepBefore = d3.line().curve(d3.curveStepBefore);
@@ -2417,14 +2417,14 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     var subset = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18];
     var evenly_distributed_positions = [100.0, 157.14285714285714, 214.28571428571428, 271.42857142857144, 328.57142857142856, 385.7142857142857, 442.8571428571429, 500.0];
 
-    var dashboard = d3.select("#arg_2840873883").append("div").attr("class", "dashboard");
+    var dashboard = d3.select("#arg_3920492240").append("div").attr("class", "dashboard");
     
     var clipboard = dashboard.append("button")
         .on("click", function() {
             navigator.clipboard.writeText("{'arg': {'nodes': [{'id': 0, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [10], 'parent_of': [], 'label': '0', 'fx': 100.0, 'fy': 450.0, 'y': 450.0}, {'id': 1, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [8], 'parent_of': [], 'label': '1', 'fx': 271.42857142857144, 'fy': 450.0, 'y': 450.0}, {'id': 2, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [8], 'parent_of': [], 'label': '2', 'fx': 328.57142857142856, 'fy': 450.0, 'y': 450.0}, {'id': 3, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [13, 14, 16], 'parent_of': [], 'label': '3', 'fx': 214.28571428571428, 'fy': 450.0, 'y': 450.0}, {'id': 4, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '4', 'fx': 442.8571428571429, 'fy': 450.0, 'y': 450.0}, {'id': 5, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '5', 'fx': 500.0, 'fy': 450.0, 'y': 450.0}, {'id': 6, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '6', 'fx': 157.14285714285714, 'fy': 450.0, 'y': 450.0}, {'id': 7, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '7', 'fx': 385.7142857142857, 'fy': 450.0, 'y': 450.0}, {'id': 8, 'flag': 0, 'time': 0.00523931699745691, 'time_01': 0.9989390987325849, 'logtime_01': 0.9967279882217678, 'rank_01': 0.9090909090909091, 'child_of': [10], 'parent_of': [1, 2], 'label': '8', 'x': 300.0, 'fy': 413.6363636363636, 'y': 413.6363636363636}, {'id': 9, 'flag': 0, 'time': 0.017557818091816682, 'time_01': 0.9964447443291382, 'logtime_01': 0.9891016456244728, 'rank_01': 0.8181818181818181, 'child_of': [15, 17, 18], 'parent_of': [4, 5], 'label': '9', 'x': 300.0, 'fy': 377.27272727272725, 'y': 377.27272727272725}, {'id': 10, 'flag': 0, 'time': 0.09416924140000202, 'time_01': 0.98093181466186, 'logtime_01': 0.9436497714987854, 'rank_01': 0.7272727272727273, 'child_of': [12, 15], 'parent_of': [0, 8], 'label': '10', 'x': 300.0, 'fy': 340.90909090909093, 'y': 340.90909090909093}, {'id': 11, 'flag': 0, 'time': 0.1024650871470267, 'time_01': 0.9792520015733276, 'logtime_01': 0.9389203243971302, 'rank_01': 0.6363636363636364, 'child_of': [12, 14, 16], 'parent_of': [6, 7], 'label': '11', 'x': 300.0, 'fy': 304.5454545454545, 'y': 304.5454545454545}, {'id': 12, 'flag': 0, 'time': 0.12175435946697583, 'time_01': 0.9753461463899743, 'logtime_01': 0.9280597072431825, 'rank_01': 0.5454545454545454, 'child_of': [13, 16], 'parent_of': [10, 11], 'label': '12', 'x': 300.0, 'fy': 268.18181818181813, 'y': 268.18181818181813}, {'id': 13, 'flag': 0, 'time': 0.39582244241347575, 'time_01': 0.9198505203957684, 'logtime_01': 0.7911905451922276, 'rank_01': 0.4545454545454546, 'child_of': [17, 18], 'parent_of': [3, 12], 'label': '13', 'x': 300.0, 'fy': 231.81818181818184, 'y': 231.81818181818184}, {'id': 14, 'flag': 0, 'time': 0.8565089125241158, 'time_01': 0.8265668232538372, 'logtime_01': 0.6126050290609146, 'rank_01': 0.36363636363636365, 'child_of': [17], 'parent_of': [3, 11], 'label': '14', 'x': 300.0, 'fy': 195.45454545454547, 'y': 195.45454545454547}, {'id': 15, 'flag': 0, 'time': 1.0352810563867096, 'time_01': 0.7903675258846593, 'logtime_01': 0.5550396185408524, 'rank_01': 0.2727272727272727, 'child_of': [17], 'parent_of': [9, 10], 'label': '15', 'x': 300.0, 'fy': 159.09090909090907, 'y': 159.09090909090907}, {'id': 16, 'flag': 0, 'time': 2.033597596813773, 'time_01': 0.5882199399427213, 'logtime_01': 0.3051352725610018, 'rank_01': 0.18181818181818177, 'child_of': [17], 'parent_of': [3, 11, 12], 'label': '16', 'x': 300.0, 'fy': 122.7272727272727, 'y': 122.7272727272727}, {'id': 17, 'flag': 0, 'time': 3.30638247068103, 'time_01': 0.3304956818976572, 'logtime_01': 0.0857657633683675, 'rank_01': 0.09090909090909083, 'child_of': [], 'parent_of': [9, 13, 14, 15, 16], 'label': '17', 'x': 300.0, 'fy': 86.36363636363633, 'y': 86.36363636363633}, {'id': 18, 'flag': 0, 'time': 4.9385528685650755, 'time_01': 0.0, 'logtime_01': -0.11545696884408474, 'rank_01': 0.0, 'child_of': [], 'parent_of': [9, 13], 'label': '18', 'x': 300.0, 'fy': 50.0, 'y': 50.0}], 'links': [{'source': 10, 'target': 0, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 8, 'region_fraction': 1.0}, {'source': 8, 'target': 1, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 2, 'region_fraction': 1.0}, {'source': 8, 'target': 2, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 1, 'region_fraction': 1.0}, {'source': 13, 'target': 3, 'bounds': '0.0-224.0', 'alt_parent': '', 'alt_child': 12, 'region_fraction': 0.224}, {'source': 14, 'target': 3, 'bounds': '835.0-1000.0', 'alt_parent': '', 'alt_child': 11, 'region_fraction': 0.165}, {'source': 16, 'target': 3, 'bounds': '224.0-835.0', 'alt_parent': '', 'alt_child': 11, 'region_fraction': 0.611}, {'source': 9, 'target': 4, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 5, 'region_fraction': 1.0}, {'source': 9, 'target': 5, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 1.0}, {'source': 11, 'target': 6, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 7, 'region_fraction': 1.0}, {'source': 11, 'target': 7, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 6, 'region_fraction': 1.0}, {'source': 10, 'target': 8, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 0, 'region_fraction': 1.0}, {'source': 15, 'target': 9, 'bounds': '763.0-1000.0', 'alt_parent': '', 'alt_child': 10, 'region_fraction': 0.237}, {'source': 17, 'target': 9, 'bounds': '145.0-763.0', 'alt_parent': '', 'alt_child': 13, 'region_fraction': 0.618}, {'source': 18, 'target': 9, 'bounds': '0.0-145.0', 'alt_parent': '', 'alt_child': 13, 'region_fraction': 0.145}, {'source': 12, 'target': 10, 'bounds': '0.0-763.0', 'alt_parent': '', 'alt_child': 11, 'region_fraction': 0.763}, {'source': 15, 'target': 10, 'bounds': '763.0-1000.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.237}, {'source': 12, 'target': 11, 'bounds': '0.0-763.0', 'alt_parent': '', 'alt_child': 10, 'region_fraction': 0.763}, {'source': 14, 'target': 11, 'bounds': '835.0-1000.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 0.165}, {'source': 16, 'target': 11, 'bounds': '763.0-835.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 0.072}, {'source': 13, 'target': 12, 'bounds': '0.0-224.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 0.224}, {'source': 16, 'target': 12, 'bounds': '224.0-763.0', 'alt_parent': '', 'alt_child': 3, 'region_fraction': 0.539}, {'source': 17, 'target': 13, 'bounds': '145.0-224.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.079}, {'source': 18, 'target': 13, 'bounds': '0.0-145.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.145}, {'source': 17, 'target': 14, 'bounds': '835.0-1000.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.165}, {'source': 17, 'target': 15, 'bounds': '763.0-1000.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.237}, {'source': 17, 'target': 16, 'bounds': '224.0-835.0', 'alt_parent': '', 'alt_child': 9, 'region_fraction': 0.611}], 'breakpoints': [{'start': 0, 'stop': 145.0, 'x_pos_01': 0.0, 'width_01': 0.145, 'x_pos': 50.0, 'width': 72.5}, {'start': 145.0, 'stop': 224.0, 'x_pos_01': 0.145, 'width_01': 0.079, 'x_pos': 122.5, 'width': 39.5}, {'start': 224.0, 'stop': 763.0, 'x_pos_01': 0.224, 'width_01': 0.539, 'x_pos': 162.0, 'width': 269.5}, {'start': 763.0, 'stop': 835.0, 'x_pos_01': 0.763, 'width_01': 0.072, 'x_pos': 431.5, 'width': 36.0}, {'start': 835.0, 'stop': 1000.0, 'x_pos_01': 0.835, 'width_01': 0.165, 'x_pos': 467.5, 'width': 82.5}]}, 'width': 550, 'height': 575, 'y_axis': {'include_labels': 'true', 'ticks': [450.0, 413.6363636363636, 377.27272727272725, 340.90909090909093, 304.5454545454545, 268.18181818181813, 231.81818181818184, 195.45454545454547, 159.09090909090907, 122.7272727272727, 86.36363636363633, 50.0], 'text': [0, 0, 0, 0, 0, 0, 0, 1, 1, 2, 3, 5], 'max_min': [450.0, 50.0], 'scale': 'rank'}, 'tree_highlighting': 'true', 'edge_type': 'line', 'variable_edge_width': 'true', 'subset_nodes': [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18], 'include_node_labels': 'true', 'evenly_distributed_positions': [100.0, 157.14285714285714, 214.28571428571428, 271.42857142857144, 328.57142857142856, 385.7142857142857, 442.8571428571429, 500.0]}".replace(/'nodes': .*'links'/, "'nodes': " + JSON.stringify(graph.nodes) + ", 'links'").replaceAll("'", '"'));
-            d3.select("#arg_2840873883 .copymessage").style("visibility", "visible");
+            d3.select("#arg_3920492240 .copymessage").style("visibility", "visible");
             setTimeout( function() {
-                d3.select("#arg_2840873883 .copymessage").style("visibility", "hidden");
+                d3.select("#arg_3920492240 .copymessage").style("visibility", "hidden");
             }, 1000);
         });
     clipboard.append("svg") //<!--! Font Awesome Free 6.4.2 by @fontawesome - https://fontawesome.com License - https://fontawesome.com/license (Commercial License) Copyright 2023 Fonticons, Inc. -->
@@ -2438,8 +2438,8 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     var reheat = dashboard.append("button")
         .on("click", function(event) {
             if (!event.active) simulation.alphaTarget(0.3).restart();       
-            var order = d3.selectAll("#arg_2840873883 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_2840873883 .node").classed("unfix", function(d) {
+            var order = d3.selectAll("#arg_3920492240 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_3920492240 .node").classed("unfix", function(d) {
                 if (d.flag != 1) {
                     delete d.fx;
                 } else {
@@ -2456,8 +2456,8 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     
     var evenly_distribute = dashboard.append("button")
         .on("click", function() {
-            var order = d3.selectAll("#arg_2840873883 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_2840873883 .sample").classed("distribute", function(d) {
+            var order = d3.selectAll("#arg_3920492240 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_3920492240 .sample").classed("distribute", function(d) {
                 d.fx = evenly_distributed_positions[order.indexOf(d.id)];
             });
         });
@@ -2468,7 +2468,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         .attr("d", "M504.3 273.6c4.9-4.5 7.7-10.9 7.7-17.6s-2.8-13-7.7-17.6l-112-104c-7-6.5-17.2-8.2-25.9-4.4s-14.4 12.5-14.4 22l0 56-192 0 0-56c0-9.5-5.7-18.2-14.4-22s-18.9-2.1-25.9 4.4l-112 104C2.8 243 0 249.3 0 256s2.8 13 7.7 17.6l112 104c7 6.5 17.2 8.2 25.9 4.4s14.4-12.5 14.4-22l0-56 192 0 0 56c0 9.5 5.7 18.2 14.4 22s18.9 2.1 25.9-4.4l112-104z")
     evenly_distribute.append("span").attr("class", "tip desc").text("Space Samples");
 
-    var svg = d3.select("#arg_2840873883").append("svg")
+    var svg = d3.select("#arg_3920492240").append("svg")
         .attr("width", 550)
         .attr("height", 575)
         .style("padding-top", "10px");
@@ -2549,7 +2549,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('stroke', '#1eebb1')
                     .style("cursor", "pointer");
-                d3.select("#arg_2840873883 .breakpoints")
+                d3.select("#arg_3920492240 .breakpoints")
                     .selectAll("rect")
                         .filter(function(j) {
                             return d.bounds.split(" ").some(function(region) {
@@ -2563,7 +2563,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('stroke', '#053e4e')
                     .style("cursor", "default")
-                d3.select("#arg_2840873883 .breakpoints").selectAll("rect")
+                d3.select("#arg_3920492240 .breakpoints").selectAll("rect")
                     .style("fill", "#053e4e")
             });
     }
@@ -2576,7 +2576,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         .enter()
         .append("circle")
         .attr("id", function(d) {
-            return String(2840873883) + "_node" + d.id
+            return String(3920492240) + "_node" + d.id
         })
         .attr("class", function(d) {
             var classy = ""
@@ -2637,7 +2637,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         if ("y_axis.scale" == "time" | "y_axis.scale" == "log_time") {
             vnub = 0;
         }
-        var alt_child = document.getElementById(String(2840873883) + "_node" + d.alt_child);
+        var alt_child = document.getElementById(String(3920492240) + "_node" + d.alt_child);
         if (alt_child != null) {
             var alt_child_x = alt_child.getAttribute("cx");
             var alt_child_y = alt_child.getAttribute("cy");
@@ -2704,7 +2704,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 }
             }
         }
-        var alt_parent = document.getElementById(String(2840873883) + "_node" + d.alt_parent);
+        var alt_parent = document.getElementById(String(3920492240) + "_node" + d.alt_parent);
         if (alt_parent != null) {
             var alt_parent_x = alt_parent.getAttribute("cx");
             var alt_parent_y = alt_parent.getAttribute("cy");
@@ -2883,7 +2883,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
             if (d.flag == 131072 || d.parent_of.length == 0 || d.child_of.length == 0) {
                 return "c";
             } else if (d.child_of.length == 1) {
-                var parent = document.getElementById(String(2840873883) + "_node" + d.child_of[0])
+                var parent = document.getElementById(String(3920492240) + "_node" + d.child_of[0])
                 if (parent != null) {
                     var parent_x = parent.getAttribute("cx");
                     if (parent_x > d.x) {
@@ -2973,7 +2973,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('fill', '#1eebb1')
                     .style("cursor", "pointer");
-                var highlight_links = d3.select("#arg_2840873883 .links")
+                var highlight_links = d3.select("#arg_3920492240 .links")
                     .selectAll("g")
                         .filter(function(j) {
                             return j.bounds.split(" ").some(function(region) {
@@ -2998,10 +2998,10 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                     .style('fill', '#053e4e')
                     .style("cursor", "default");
                 //if (true) {
-                    d3.selectAll("#arg_2840873883 .link")
+                    d3.selectAll("#arg_3920492240 .link")
                         .style("stroke", "#053e4e");
                 //} else {
-                //    d3.selectAll("#arg_2840873883 .link")
+                //    d3.selectAll("#arg_3920492240 .link")
                 //        .style("stroke", "#053e4e")
                 //        .style("stroke-width", 3);
                 //};     
@@ -3181,7 +3181,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
 
 .saving .message {
     display: none;
-}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_5622989795'class='d3arg' style='min-width:590px; min-height:655px;'></div><script>var line = d3.line();
+}</style><script src='https://d3js.org/d3.v7.min.js'></script><div id='arg_4900784883'class='d3arg' style='min-width:590px; min-height:655px;'></div><script>var line = d3.line();
 var step = d3.line().curve(d3.curveStep);
 var stepAfter = d3.line().curve(d3.curveStepAfter);
 var stepBefore = d3.line().curve(d3.curveStepBefore);
@@ -3193,14 +3193,14 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     var subset = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 25, 27, 28, 29, 31, 32];
     var evenly_distributed_positions = [100.0, 157.14285714285714, 214.28571428571428, 271.42857142857144, 328.57142857142856, 385.7142857142857, 442.8571428571429, 500.0];
 
-    var dashboard = d3.select("#arg_5622989795").append("div").attr("class", "dashboard");
+    var dashboard = d3.select("#arg_4900784883").append("div").attr("class", "dashboard");
     
     var clipboard = dashboard.append("button")
         .on("click", function() {
             navigator.clipboard.writeText("{'arg': {'nodes': [{'id': 0, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [10], 'parent_of': [], 'label': '0', 'fx': 157.14285714285714, 'fy': 450.0, 'y': 450.0}, {'id': 1, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [8], 'parent_of': [], 'label': '1', 'fx': 214.28571428571428, 'fy': 450.0, 'y': 450.0}, {'id': 2, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [8], 'parent_of': [], 'label': '2', 'fx': 271.42857142857144, 'fy': 450.0, 'y': 450.0}, {'id': 3, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [17], 'parent_of': [], 'label': '3', 'fx': 100.0, 'fy': 450.0, 'y': 450.0}, {'id': 4, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '4', 'fx': 442.8571428571429, 'fy': 450.0, 'y': 450.0}, {'id': 5, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [9], 'parent_of': [], 'label': '5', 'fx': 500.0, 'fy': 450.0, 'y': 450.0}, {'id': 6, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '6', 'fx': 328.57142857142856, 'fy': 450.0, 'y': 450.0}, {'id': 7, 'flag': 1, 'time': 0.0, 'time_01': 1.0, 'logtime_01': 1.0, 'rank_01': 1.0, 'child_of': [11], 'parent_of': [], 'label': '7', 'fx': 385.7142857142857, 'fy': 450.0, 'y': 450.0}, {'id': 8, 'flag': 0, 'time': 0.00523931699745691, 'time_01': 0.9984443191777483, 'logtime_01': 0.9956965043456049, 'rank_01': 0.9473684210526316, 'child_of': [10], 'parent_of': [1, 2], 'label': '8', 'x': 300.0, 'fy': 428.94736842105266, 'y': 428.94736842105266}, {'id': 9, 'flag': 0, 'time': 0.017557818091816682, 'time_01': 0.9947866561807043, 'logtime_01': 0.9856659988184764, 'rank_01': 0.8947368421052632, 'child_of': [21], 'parent_of': [4, 5], 'label': '9', 'x': 300.0, 'fy': 407.89473684210526, 'y': 407.89473684210526}, {'id': 10, 'flag': 0, 'time': 0.09416924140000202, 'time_01': 0.9720388586979789, 'logtime_01': 0.9258856691493427, 'rank_01': 0.8421052631578947, 'child_of': [12], 'parent_of': [0, 8], 'label': '10', 'x': 300.0, 'fy': 386.84210526315786, 'y': 386.84210526315786}, {'id': 11, 'flag': 0, 'time': 0.1024650871470267, 'time_01': 0.9695756200469736, 'logtime_01': 0.919665289630825, 'rank_01': 0.7894736842105263, 'child_of': [14], 'parent_of': [6, 7], 'label': '11', 'x': 300.0, 'fy': 365.7894736842105, 'y': 365.7894736842105}, {'id': 12, 'flag': 131072, 'time': 0.11568803951902568, 'time_01': 0.965649403437318, 'logtime_01': 0.9098465900873469, 'rank_01': 0.736842105263158, 'child_of': [14], 'parent_of': [10], 'x_pos_reference': 10, 'label': '12/13', 'x': 300.0, 'fy': 344.7368421052632, 'y': 344.7368421052632}, {'id': 14, 'flag': 0, 'time': 0.12175435946697583, 'time_01': 0.96384816529707, 'logtime_01': 0.9053809221242646, 'rank_01': 0.6842105263157895, 'child_of': [15], 'parent_of': [11, 12], 'label': '14', 'x': 300.0, 'fy': 323.6842105263158, 'y': 323.6842105263158}, {'id': 15, 'flag': 131072, 'time': 0.308460674409082, 'time_01': 0.9084105130821528, 'logtime_01': 0.7785915434792432, 'rank_01': 0.631578947368421, 'child_of': [20], 'parent_of': [14], 'x_pos_reference': 14, 'label': '15/16', 'x': 300.0, 'fy': 302.63157894736844, 'y': 302.63157894736844}, {'id': 17, 'flag': 0, 'time': 0.39582244241347575, 'time_01': 0.8824706764300845, 'logtime_01': 0.7253645028602671, 'rank_01': 0.5789473684210527, 'child_of': [23], 'parent_of': [3, 12], 'label': '17', 'x': 300.0, 'fy': 281.57894736842104, 'y': 281.57894736842104}, {'id': 18, 'flag': 131072, 'time': 0.6941217594839495, 'time_01': 0.7938983439900809, 'logtime_01': 0.5658617484880195, 'rank_01': 0.5263157894736843, 'child_of': [24], 'parent_of': [15], 'x_pos_reference': 15, 'label': '18/19', 'x': 300.0, 'fy': 260.52631578947376, 'y': 260.52631578947376}, {'id': 20, 'flag': 262144, 'time': 0.8577976766058426, 'time_01': 0.7452989778027361, 'logtime_01': 0.48990938765448055, 'rank_01': 0.4736842105263158, 'child_of': [23], 'parent_of': [15, 18], 'x_pos_reference': 15, 'label': '20', 'x': 300.0, 'fy': 239.47368421052633, 'y': 239.47368421052633}, {'id': 21, 'flag': 131072, 'time': 1.0255837873540103, 'time_01': 0.6954791950223049, 'logtime_01': 0.4187014623755223, 'rank_01': 0.42105263157894735, 'child_of': [28], 'parent_of': [9], 'x_pos_reference': 9, 'label': '21/22', 'x': 300.0, 'fy': 218.42105263157893, 'y': 218.42105263157893}, {'id': 23, 'flag': 0, 'time': 1.0987444051668527, 'time_01': 0.6737560257369251, 'logtime_01': 0.38948136747010653, 'rank_01': 0.368421052631579, 'child_of': [24], 'parent_of': [17, 20], 'label': '23', 'x': 300.0, 'fy': 197.3684210526316, 'y': 197.3684210526316}, {'id': 24, 'flag': 0, 'time': 1.2059022164118993, 'time_01': 0.6419382617059832, 'logtime_01': 0.34847153657098406, 'rank_01': 0.3157894736842106, 'child_of': [25], 'parent_of': [18, 23], 'label': '24', 'x': 300.0, 'fy': 176.31578947368425, 'y': 176.31578947368425}, {'id': 25, 'flag': 131072, 'time': 1.5998364961174132, 'time_01': 0.5249695796310361, 'logtime_01': 0.21315492775386224, 'rank_01': 0.26315789473684215, 'child_of': [27], 'parent_of': [24], 'x_pos_reference': 24, 'label': '25/26', 'x': 300.0, 'fy': 155.26315789473688, 'y': 155.26315789473688}, {'id': 27, 'flag': 0, 'time': 1.721772254949798, 'time_01': 0.4887638830384604, 'logtime_01': 0.17540848049470925, 'rank_01': 0.21052631578947367, 'child_of': [28], 'parent_of': [21, 25], 'label': '27', 'x': 300.0, 'fy': 134.21052631578948, 'y': 134.21052631578948}, {'id': 28, 'flag': 0, 'time': 2.0490896096414075, 'time_01': 0.3915753884825759, 'logtime_01': 0.08188802035833243, 'rank_01': 0.1578947368421053, 'child_of': [29], 'parent_of': [21, 27], 'label': '28', 'x': 300.0, 'fy': 113.15789473684212, 'y': 113.15789473684212}, {'id': 29, 'flag': 131072, 'time': 2.087239695481809, 'time_01': 0.38024769883562837, 'logtime_01': 0.07164791621979116, 'rank_01': 0.10526315789473695, 'child_of': [32], 'parent_of': [28], 'x_pos_reference': 28, 'label': '29/30', 'x': 300.0, 'fy': 92.10526315789478, 'y': 92.10526315789478}, {'id': 31, 'flag': 0, 'time': 2.349570553333265, 'time_01': 0.3023552779642755, 'logtime_01': 0.0044847425546915565, 'rank_01': 0.052631578947368474, 'child_of': [32], 'parent_of': [25, 29], 'label': '31', 'x': 300.0, 'fy': 71.0526315789474, 'y': 71.0526315789474}, {'id': 32, 'flag': 0, 'time': 3.367861146397306, 'time_01': 0.0, 'logtime_01': -0.2141153912966347, 'rank_01': 0.0, 'child_of': [], 'parent_of': [29, 31], 'label': '32', 'x': 300.0, 'fy': 50.0, 'y': 50.0}], 'links': [{'source': 10, 'target': 0, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 8, 'region_fraction': 1.0}, {'source': 8, 'target': 1, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 2, 'region_fraction': 1.0}, {'source': 8, 'target': 2, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 1, 'region_fraction': 1.0}, {'source': 17, 'target': 3, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 12, 'region_fraction': 1.0}, {'source': 9, 'target': 4, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 5, 'region_fraction': 1.0}, {'source': 9, 'target': 5, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 4, 'region_fraction': 1.0}, {'source': 11, 'target': 6, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 7, 'region_fraction': 1.0}, {'source': 11, 'target': 7, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 6, 'region_fraction': 1.0}, {'source': 10, 'target': 8, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 0, 'region_fraction': 1.0}, {'source': 21, 'target': 9, 'bounds': '0.0-166.0 166.0-1000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 12, 'target': 10, 'bounds': '0.0-763.0 763.0-1000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 14, 'target': 11, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 12, 'region_fraction': 1.0}, {'source': 14, 'target': 12, 'bounds': '0.0-763.0', 'alt_parent': 17, 'alt_child': 11, 'region_fraction': 0.763}, {'source': 17, 'target': 12, 'bounds': '763.0-1000.0', 'alt_parent': 14, 'alt_child': 3, 'region_fraction': 0.237}, {'source': 15, 'target': 14, 'bounds': '0.0-461.0 461.0-1000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 20, 'target': 15, 'bounds': '0.0-461.0', 'alt_parent': 18, 'alt_child': 18, 'region_fraction': 0.461}, {'source': 18, 'target': 15, 'bounds': '461.0-533.0 533.0-1000.0', 'alt_parent': 20, 'alt_child': '', 'region_fraction': 0.539}, {'source': 23, 'target': 17, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 20, 'region_fraction': 1.0}, {'source': 24, 'target': 18, 'bounds': '461.0-533.0', 'alt_parent': 20, 'alt_child': 23, 'region_fraction': 0.072}, {'source': 20, 'target': 18, 'bounds': '533.0-1000.0', 'alt_parent': 24, 'alt_child': 15, 'region_fraction': 0.467}, {'source': 23, 'target': 20, 'bounds': '0.0-461.0 533.0-1000.0', 'alt_parent': '', 'alt_child': 17, 'region_fraction': 0.928}, {'source': 28, 'target': 21, 'bounds': '0.0-166.0', 'alt_parent': 27, 'alt_child': 27, 'region_fraction': 0.166}, {'source': 27, 'target': 21, 'bounds': '166.0-1000.0', 'alt_parent': 28, 'alt_child': 25, 'region_fraction': 0.834}, {'source': 24, 'target': 23, 'bounds': '0.0-1000.0', 'alt_parent': '', 'alt_child': 18, 'region_fraction': 1.0}, {'source': 25, 'target': 24, 'bounds': '0.0-726.0 726.0-1000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 1.0}, {'source': 27, 'target': 25, 'bounds': '0.0-726.0', 'alt_parent': 31, 'alt_child': 21, 'region_fraction': 0.726}, {'source': 31, 'target': 25, 'bounds': '726.0-1000.0', 'alt_parent': 27, 'alt_child': 29, 'region_fraction': 0.274}, {'source': 28, 'target': 27, 'bounds': '0.0-166.0 726.0-1000.0', 'alt_parent': '', 'alt_child': 21, 'region_fraction': 0.44}, {'source': 29, 'target': 28, 'bounds': '726.0-804.0 804.0-1000.0', 'alt_parent': '', 'alt_child': '', 'region_fraction': 0.274}, {'source': 32, 'target': 29, 'bounds': '726.0-804.0', 'alt_parent': 31, 'alt_child': 31, 'region_fraction': 0.078}, {'source': 31, 'target': 29, 'bounds': '804.0-1000.0', 'alt_parent': 32, 'alt_child': 25, 'region_fraction': 0.196}, {'source': 32, 'target': 31, 'bounds': '726.0-804.0', 'alt_parent': '', 'alt_child': 29, 'region_fraction': 0.078}], 'breakpoints': [{'start': 0, 'stop': 166.0, 'x_pos_01': 0.0, 'width_01': 0.166, 'x_pos': 50.0, 'width': 83.0}, {'start': 166.0, 'stop': 461.0, 'x_pos_01': 0.166, 'width_01': 0.295, 'x_pos': 133.0, 'width': 147.5}, {'start': 461.0, 'stop': 533.0, 'x_pos_01': 0.461, 'width_01': 0.072, 'x_pos': 280.5, 'width': 36.0}, {'start': 533.0, 'stop': 726.0, 'x_pos_01': 0.533, 'width_01': 0.193, 'x_pos': 316.5, 'width': 96.5}, {'start': 726.0, 'stop': 763.0, 'x_pos_01': 0.726, 'width_01': 0.037, 'x_pos': 413.0, 'width': 18.5}, {'start': 763.0, 'stop': 804.0, 'x_pos_01': 0.763, 'width_01': 0.041, 'x_pos': 431.5, 'width': 20.5}, {'start': 804.0, 'stop': 1000.0, 'x_pos_01': 0.804, 'width_01': 0.196, 'x_pos': 452.0, 'width': 98.0}]}, 'width': 550, 'height': 575, 'y_axis': {'include_labels': 'true', 'ticks': [450.0, 428.94736842105266, 407.89473684210526, 386.84210526315786, 365.7894736842105, 344.7368421052632, 323.6842105263158, 302.63157894736844, 281.57894736842104, 260.52631578947376, 239.47368421052633, 218.42105263157893, 197.3684210526316, 176.31578947368425, 155.26315789473688, 134.21052631578948, 113.15789473684212, 92.10526315789478, 71.0526315789474, 50.0], 'text': [0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 3], 'max_min': [450.0, 50.0], 'scale': 'rank'}, 'tree_highlighting': 'true', 'edge_type': 'ortho', 'variable_edge_width': 'false', 'subset_nodes': [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 17, 18, 20, 21, 23, 24, 25, 27, 28, 29, 31, 32], 'include_node_labels': 'true', 'evenly_distributed_positions': [100.0, 157.14285714285714, 214.28571428571428, 271.42857142857144, 328.57142857142856, 385.7142857142857, 442.8571428571429, 500.0]}".replace(/'nodes': .*'links'/, "'nodes': " + JSON.stringify(graph.nodes) + ", 'links'").replaceAll("'", '"'));
-            d3.select("#arg_5622989795 .copymessage").style("visibility", "visible");
+            d3.select("#arg_4900784883 .copymessage").style("visibility", "visible");
             setTimeout( function() {
-                d3.select("#arg_5622989795 .copymessage").style("visibility", "hidden");
+                d3.select("#arg_4900784883 .copymessage").style("visibility", "hidden");
             }, 1000);
         });
     clipboard.append("svg") //<!--! Font Awesome Free 6.4.2 by @fontawesome - https://fontawesome.com License - https://fontawesome.com/license (Commercial License) Copyright 2023 Fonticons, Inc. -->
@@ -3214,8 +3214,8 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     var reheat = dashboard.append("button")
         .on("click", function(event) {
             if (!event.active) simulation.alphaTarget(0.3).restart();       
-            var order = d3.selectAll("#arg_5622989795 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_5622989795 .node").classed("unfix", function(d) {
+            var order = d3.selectAll("#arg_4900784883 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_4900784883 .node").classed("unfix", function(d) {
                 if (d.flag != 1) {
                     delete d.fx;
                 } else {
@@ -3232,8 +3232,8 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
     
     var evenly_distribute = dashboard.append("button")
         .on("click", function() {
-            var order = d3.selectAll("#arg_5622989795 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
-            d3.selectAll("#arg_5622989795 .sample").classed("distribute", function(d) {
+            var order = d3.selectAll("#arg_4900784883 .sample").data().sort((a, b) => d3.ascending(a.x, b.x)).map(a => a.id);;
+            d3.selectAll("#arg_4900784883 .sample").classed("distribute", function(d) {
                 d.fx = evenly_distributed_positions[order.indexOf(d.id)];
             });
         });
@@ -3244,7 +3244,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         .attr("d", "M504.3 273.6c4.9-4.5 7.7-10.9 7.7-17.6s-2.8-13-7.7-17.6l-112-104c-7-6.5-17.2-8.2-25.9-4.4s-14.4 12.5-14.4 22l0 56-192 0 0-56c0-9.5-5.7-18.2-14.4-22s-18.9-2.1-25.9 4.4l-112 104C2.8 243 0 249.3 0 256s2.8 13 7.7 17.6l112 104c7 6.5 17.2 8.2 25.9 4.4s14.4-12.5 14.4-22l0-56 192 0 0 56c0 9.5 5.7 18.2 14.4 22s18.9 2.1 25.9-4.4l112-104z")
     evenly_distribute.append("span").attr("class", "tip desc").text("Space Samples");
 
-    var svg = d3.select("#arg_5622989795").append("svg")
+    var svg = d3.select("#arg_4900784883").append("svg")
         .attr("width", 550)
         .attr("height", 575)
         .style("padding-top", "10px");
@@ -3325,7 +3325,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('stroke', '#1eebb1')
                     .style("cursor", "pointer");
-                d3.select("#arg_5622989795 .breakpoints")
+                d3.select("#arg_4900784883 .breakpoints")
                     .selectAll("rect")
                         .filter(function(j) {
                             return d.bounds.split(" ").some(function(region) {
@@ -3339,7 +3339,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('stroke', '#053e4e')
                     .style("cursor", "default")
-                d3.select("#arg_5622989795 .breakpoints").selectAll("rect")
+                d3.select("#arg_4900784883 .breakpoints").selectAll("rect")
                     .style("fill", "#053e4e")
             });
     }
@@ -3352,7 +3352,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         .enter()
         .append("circle")
         .attr("id", function(d) {
-            return String(5622989795) + "_node" + d.id
+            return String(4900784883) + "_node" + d.id
         })
         .attr("class", function(d) {
             var classy = ""
@@ -3413,7 +3413,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
         if ("y_axis.scale" == "time" | "y_axis.scale" == "log_time") {
             vnub = 0;
         }
-        var alt_child = document.getElementById(String(5622989795) + "_node" + d.alt_child);
+        var alt_child = document.getElementById(String(4900784883) + "_node" + d.alt_child);
         if (alt_child != null) {
             var alt_child_x = alt_child.getAttribute("cx");
             var alt_child_y = alt_child.getAttribute("cy");
@@ -3480,7 +3480,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 }
             }
         }
-        var alt_parent = document.getElementById(String(5622989795) + "_node" + d.alt_parent);
+        var alt_parent = document.getElementById(String(4900784883) + "_node" + d.alt_parent);
         if (alt_parent != null) {
             var alt_parent_x = alt_parent.getAttribute("cx");
             var alt_parent_y = alt_parent.getAttribute("cy");
@@ -3659,7 +3659,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
             if (d.flag == 131072 || d.parent_of.length == 0 || d.child_of.length == 0) {
                 return "c";
             } else if (d.child_of.length == 1) {
-                var parent = document.getElementById(String(5622989795) + "_node" + d.child_of[0])
+                var parent = document.getElementById(String(4900784883) + "_node" + d.child_of[0])
                 if (parent != null) {
                     var parent_x = parent.getAttribute("cx");
                     if (parent_x > d.x) {
@@ -3749,7 +3749,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                 d3.select(this)
                     .style('fill', '#1eebb1')
                     .style("cursor", "pointer");
-                var highlight_links = d3.select("#arg_5622989795 .links")
+                var highlight_links = d3.select("#arg_4900784883 .links")
                     .selectAll("g")
                         .filter(function(j) {
                             return j.bounds.split(" ").some(function(region) {
@@ -3774,10 +3774,10 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
                     .style('fill', '#053e4e')
                     .style("cursor", "default");
                 //if (false) {
-                    d3.selectAll("#arg_5622989795 .link")
+                    d3.selectAll("#arg_4900784883 .link")
                         .style("stroke", "#053e4e");
                 //} else {
-                //    d3.selectAll("#arg_5622989795 .link")
+                //    d3.selectAll("#arg_4900784883 .link")
                 //        .style("stroke", "#053e4e")
                 //        .style("stroke-width", 3);
                 //};     
@@ -3965,7 +3965,7 @@ <h4>Ticks, labels, and gridlines<a class="headerlink" href="#ticks-labels-and-gr
 </div>
 </details>
 <div class="cell_output docutils container">
-<img alt="_images/095acb303c5e6009d1cbdff6b8bac5aa81ac3381e17e5d1d175408fb7bdef0ac.svg" src="_images/095acb303c5e6009d1cbdff6b8bac5aa81ac3381e17e5d1d175408fb7bdef0ac.svg" /></div>
+<img alt="_images/26c997c8903e9db9ec71f105e08e00ad5fc59d8472dc82b5c2884baa32c9b360.svg" src="_images/26c997c8903e9db9ec71f105e08e00ad5fc59d8472dc82b5c2884baa32c9b360.svg" /></div>
 </div>
 </section>
 <section id="geography">
diff --git a/what_is.html b/what_is.html
index 89e2a3a..7c2d487 100644
--- a/what_is.html
+++ b/what_is.html
@@ -395,7 +395,7 @@ <h2> Contents </h2>
 <a class="reference internal" href="#plot-storing-everyone"><span class="std std-ref">further</span></a> <a class="reference internal" href="#plot-incremental-calculation"><span class="std std-ref">down</span></a> this tutorial.</p>
 <div class="cell tag_remove-input docutils container">
 <div class="cell_output docutils container">
-<img alt="_images/9879460663347f6185ecf3730bfe94621c5658e37655eb26a1fe3e56eee3d9e4.svg" src="_images/9879460663347f6185ecf3730bfe94621c5658e37655eb26a1fe3e56eee3d9e4.svg" /></div>
+<img alt="_images/d59f0e212d1906e9016ab86b181618f53e021707cf1af4a31a1a121077c4d6e7.svg" src="_images/d59f0e212d1906e9016ab86b181618f53e021707cf1af4a31a1a121077c4d6e7.svg" /></div>
 </div>
 <section id="how-to-think-about-tree-sequences">
 <h2>How to think about tree sequences<a class="headerlink" href="#how-to-think-about-tree-sequences" title="Permalink to this heading">#</a></h2>
@@ -580,7 +580,7 @@ <h2>How to think about tree sequences<a class="headerlink" href="#how-to-think-a
 several orders of magnitude faster to process than other storage formats.</p>
 <div class="cell tag_remove-input docutils container" id="plot-storing-everyone">
 <div class="cell_output docutils container">
-<img alt="_images/1d3f4a6ee25ec7c943da4f5e776f802489a0c8952031423d66debc6b99d74613.svg" src="_images/1d3f4a6ee25ec7c943da4f5e776f802489a0c8952031423d66debc6b99d74613.svg" /></div>
+<img alt="_images/465817323bc87e4d4ee8c4ba961d4fd0a4efc5e1363f04f6046dc1fbb52b8d7d.svg" src="_images/465817323bc87e4d4ee8c4ba961d4fd0a4efc5e1363f04f6046dc1fbb52b8d7d.svg" /></div>
 </div>
 </section>
 <section id="a-record-of-genetic-ancestry">
@@ -610,7 +610,7 @@ <h2>How to think about tree sequences<a class="headerlink" href="#how-to-think-a
 one), where limited migration is occuring from A to B.</p>
 <div class="cell tag_remove-input docutils container">
 <div class="cell_output docutils container">
-<img alt="_images/16e48cdc7a977659f4eaad079ea83de8bfa1a1174384dae0402a3d682d6c8adf.svg" src="_images/16e48cdc7a977659f4eaad079ea83de8bfa1a1174384dae0402a3d682d6c8adf.svg" /></div>
+<img alt="_images/b3beea434b2bfb3f38f481eea7255126f65e9daf72048e4ed5e4231fb94e4ba5.svg" src="_images/b3beea434b2bfb3f38f481eea7255126f65e9daf72048e4ed5e4231fb94e4ba5.svg" /></div>
 </div>
 <p>A major benefit of “tree sequence thinking” is the close relationship between the
 tree sequence and the underlying biological processes that produced the genetic
@@ -724,7 +724,7 @@ <h2>How to think about tree sequences<a class="headerlink" href="#how-to-think-a
 (from <a class="reference external" href="https://www.genetics.org/content/215/3/779#F9">here</a>):</p>
 <div class="cell tag_remove-input docutils container" id="plot-incremental-calculation">
 <div class="cell_output docutils container">
-<img alt="_images/1e427c57996ac534fd414f12e4408f8cf5e23257c82d46ec280fae036efaa032.svg" src="_images/1e427c57996ac534fd414f12e4408f8cf5e23257c82d46ec280fae036efaa032.svg" /></div>
+<img alt="_images/1324c46357b2edf9082347c3456ba3349d8cec29c065ab8a91a59b4798af4aad.svg" src="_images/1324c46357b2edf9082347c3456ba3349d8cec29c065ab8a91a59b4798af4aad.svg" /></div>
 </div>
 <p>The <strong class="program">tskit</strong> library has <a class="reference internal" href="analysing_tree_sequences.html#sec-analysing-tree-sequences"><span class="std std-ref">extensive support</span></a>
 for these sorts of population genetic calculations. It provides efficient methods for