Troubleshooting Docker Image on Singularity

[jamesriddellv]

Hi PPR-Meta team. I am trying to run PPR-Meta on a supercomputing cluster and make it easy for others in my group to run the software on their fasta files. I pulled the docker image using singularity and it successfully built the .sif file using singularity pull docker://shufangwu/ppr-meta:1.0, but when executing it on the example.fna file I ended up with a lot of text containing spaces and of zero size in my directory. When checking the job management output file, it contained these error messages for every line in the example.fna file:

/nfs/turbo/lsa-duhaimem/Lake_Michigan_JGI_viral_metaGs/ppr-meta/PPR-Meta/example.fna: 22498: /nfs/turbo/lsa-duhaimem/Lake_Michigan_JGI_viral_metaGs/ppr-meta/PPR-Meta/example.fna: GGCTTCGTTGGCGCCAAGCTGGCCGGGATGTA: not found

Could you please help me figure out what is causing this behavior? The program itself seems to be executing but I'm not sure why it fails, and why there are so many "ghost" files that are filling the directory.

Example of these "ghost" files in my directory:

chromosome101_source=Escherichia coli strain PA45B chromosome
chromosome102_source=Phaeobacter piscinae strain P23 chromosome
chromosome103_source=Ralstonia solanacearum strain SEPPX05 chromosome
chromosome104_source=Pediococcus acidilactici strain SRCM100424 chromosome
chromosome105_source=Bordetella pertussis strain H489
chromosome106_source=Lactobacillus johnsonii strain UMNLJ22
chromosome107_source=Streptococcus agalactiae strain SG-M4 chromosome
chromosome108_source=Sagittula sp. P11 chromosome
chromosome109_source=Cystobacter fuscus strain DSM 52655 chromosome
chromosome110_source=Porphyrobacter HT-58-2 strain HT-58-2 chromosome
chromosome111_source=Acetobacter sp. SLV-7
chromosome112_source=Pseudomonas sp. MYb193 chromosome

Thank you!

[xanadu314]

Hi PPR-Meta team. I am trying to run PPR-Meta on a supercomputing cluster and make it easy for others in my group to run the software on their fasta files. I pulled the docker image using singularity and it successfully built the .sif file using singularity pull docker://shufangwu/ppr-meta:1.0, but when executing it on the example.fna file I ended up with a lot of text containing spaces and of zero size in my directory. When checking the job management output file, it contained these error messages for every line in the example.fna file:

/nfs/turbo/lsa-duhaimem/Lake_Michigan_JGI_viral_metaGs/ppr-meta/PPR-Meta/example.fna: 22498: /nfs/turbo/lsa-duhaimem/Lake_Michigan_JGI_viral_metaGs/ppr-meta/PPR-Meta/example.fna: GGCTTCGTTGGCGCCAAGCTGGCCGGGATGTA: not found

Could you please help me figure out what is causing this behavior? The program itself seems to be executing but I'm not sure why it fails, and why there are so many "ghost" files that are filling the directory.

Example of these "ghost" files in my directory:

chromosome101_source=Escherichia coli strain PA45B chromosome
chromosome102_source=Phaeobacter piscinae strain P23 chromosome
chromosome103_source=Ralstonia solanacearum strain SEPPX05 chromosome
chromosome104_source=Pediococcus acidilactici strain SRCM100424 chromosome
chromosome105_source=Bordetella pertussis strain H489
chromosome106_source=Lactobacillus johnsonii strain UMNLJ22
chromosome107_source=Streptococcus agalactiae strain SG-M4 chromosome
chromosome108_source=Sagittula sp. P11 chromosome
chromosome109_source=Cystobacter fuscus strain DSM 52655 chromosome
chromosome110_source=Porphyrobacter HT-58-2 strain HT-58-2 chromosome
chromosome111_source=Acetobacter sp. SLV-7
chromosome112_source=Pseudomonas sp. MYb193 chromosome

Thank you!

Hello!
Have you installed Matlab MCR ?
I have a error:
Singularity> ./PPR_Meta example.fna test.csv
./PPR_Meta: error while loading shared libraries: libmwlaunchermain.so: cannot open shared object file: No such file or directory