fixing issues with melting temp calcs and display, updating menu utils

package.json

@@ -4,7 +4,7 @@
   "license": "MIT",
   "scripts": {
     "postinstall": "patch-package",
-    "prepare": "husky install",
+    "prepare": "husky",
     "e2e": "nx affected --base=master --head=HEAD -t e2e",
     "test": "nx affected -t test"
   },

packages/bio-parsers/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/bio-parsers",
-  "version": "0.4.18",
+  "version": "0.4.19",
   "type": "module",
   "dependencies": {
     "@gmod/gff": "^1.2.1",

packages/ove/cypress/e2e/statusBar.spec.js

@@ -14,14 +14,17 @@ describe("statusBar", function () {
     cy.tgToggle("showMoleculeType", false);
     cy.get(`[data-test="veStatusBar-type"]`).should("not.exist");
   });
-  it("melting temp should be an option in the menu bar", function () {
+  it("melting temp should be an option in the menu bar, neb tm should work", function () {
     cy.visit("");
     cy.selectRange(10, 30);
     cy.contains("Melting Temp").should("not.exist");
     cy.get(".tg-menu-bar").contains("View").click();
     cy.get(".bp3-menu-item").contains("Melting Temp").click();
-    cy.contains("Melting Temp: 62.69").click();
+    cy.contains("Melting Temp: 62.7").click();
     cy.get(`[value="default"][checked]`);
+    cy.contains(`NEB Tm`).click();
+    cy.contains("Melting Temp: 62.7").should("not.exist");
+    cy.contains("Melting Temp: 64.6");
   });
   it(`if viewing a linear sequence in the circular view, there should be a little warning 
   on the circular view telling the user that the sequence is linear`, () => {

packages/ove/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/ove",
-  "version": "0.5.19",
+  "version": "0.5.20",
   "main": "./src/index.js",
   "type": "module",
   "exports": {

packages/ove/src/StatusBar/MeltingTemp.js

@@ -3,7 +3,7 @@ import { Button, Icon, Popover, RadioGroup } from "@blueprintjs/core";
 
 import { calculateTm, calculateNebTm } from "@teselagen/sequence-utils";
 
-import { isString } from "lodash-es";
+import { isNumber, isString } from "lodash-es";
 import { popoverOverflowModifiers } from "@teselagen/ui";
 import useTmType from "../utils/useTmType";
 
@@ -16,13 +16,17 @@ export default function MeltingTemp({
     </Button>
   )
 }) {
+  const [primerConc /* , setPrimerConcentration */] = React.useState(0.0000005);
+  const [monovalentCationConc /* , setMonovalentCationConc */] =
+    React.useState(0.05);
   const [tmType, setTmType] = useTmType();
-  const tm = (
-    {
-      default: calculateTm,
-      neb_tm: calculateNebTm
-    }[tmType] || calculateTm
-  )((sequence || "").toLowerCase());
+  let tm = (tmType === "neb_tm" ? calculateNebTm : calculateTm)(sequence, {
+    monovalentCationConc,
+    primerConc
+  });
+  if (isNumber(tm)) {
+    tm = tm.toFixed(1);
+  }
   const hasWarning = isString(tm) && tm.length > 7 && tm;
   return (
     <WrapperToUse dataTest="veStatusBar-selection-tm">
@@ -34,7 +38,7 @@ export default function MeltingTemp({
             <a
               rel="noopener noreferrer"
               target="_blank"
-              href="https://github.com/TeselaGen/@teselagen/sequence-utils"
+              href="https://github.com/TeselaGen/tg-oss/blob/master/packages/sequence-utils/src/calculateNebTm.js"
             >
               algorithms
             </a>
@@ -43,8 +47,8 @@ export default function MeltingTemp({
             <RadioGroup
               label="Choose Tm Type:"
               options={[
-                { value: "default", label: "Default Tm" },
-                { value: "neb_tm", label: "NEB Tm" }
+                { value: "default", label: "Default Tm (Breslauer)" },
+                { value: "neb_tm", label: "NEB Tm (SantaLucia)" }
               ]}
               onChange={e => setTmType(e.target.value)}
               selectedValue={tmType}

packages/sequence-utils/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/sequence-utils",
-  "version": "0.3.24",
+  "version": "0.3.25",
   "type": "module",
   "dependencies": {
     "bson-objectid": "^2.0.4",

packages/sequence-utils/src/calculateNebTm.js

@@ -9,8 +9,7 @@ import calculatePercentGc from "./calculatePercentGC";
 // primer concentration & monovalent cation concentration in M
 export default function calculateNebTm(
   sequence,
-  primerConc,
-  { monovalentCationConc } = {}
+  { monovalentCationConc = 0.05, primerConc = 0.0000005 } = {}
 ) {
   try {
     const checkForDegenerateBases = /[^atgc]/i.test(sequence);

packages/sequence-utils/src/calculateNebTm.test.js

@@ -1,31 +1,40 @@
 import assert from "assert";
-import calculateTm from "./calculateNebTm";
+import calculateNebTm from "./calculateNebTm";
+// import calculateTm from "./calculateTm";
 
 describe("calculate Tm based on SantaLucia 1998 & Owczarzy 2004", () => {
   it("should return the melting temperature of a given sequence, if no degenerate bases are present", () => {
     const options = {
       // 50 mM KCl in Q5 protocol
-      monovalentCationConc: 0.05
+      monovalentCationConc: 0.05,
+      primerConc: 0.0000005
     };
+    // console.log(`calculateNebTm("AGCGGATAACAATTTCACACAGGA", options),:`,calculateNebTm("AGCGGATAACAATTTCACACAGGA", options),)
+    // console.log(`calculateTm("AGCGGATAACAATTTCACACAGGA", options),:`,calculateTm("AGCGGATAACAATTTCACACAGGA", options),)
+    // console.log(`calculateTm("AGCGGATAnbACdAATTTCACACANNGGA", options),:`,calculateTm("AGCGGATAACAATTTCACACAGGA", options),)
     // primer concentration in Q5 protocol is 500 nM
     assert.equal(
-      calculateTm("AGCGGATAACAATTTCACACAGGA", 0.0000005, options),
+      calculateNebTm("AGCGGATAACAATTTCACACAGGA", options),
       65.8994505801345
     );
     assert.equal(
-      calculateTm("AGCGGATAACAATTTCAC", 0.0000005, options),
+      calculateNebTm("AGCGGATAACAATTTCAC", options),
       56.11037835109477
     );
     assert.equal(
-      calculateTm("AGCGGATAACAATTTcac", 0.0000005, options),
+      calculateNebTm("AGCGGATAACAATTTcac", options),
       56.11037835109477
     );
     assert.equal(
-      calculateTm("AGCGGNNN", 0.0000005, options),
+      calculateNebTm("ataataccgcgccacatagc", options),
+      65.03019485849268
+    );
+    assert.equal(
+      calculateNebTm("AGCGGNNN", options),
       "Error calculating Tm for sequence AGCGGNNN: Error: Degenerate bases prohibited in Tm calculation of sequence AGCGGNNN"
     );
     assert.equal(
-      calculateTm("AGCGGnnn", 0.0000005, options),
+      calculateNebTm("AGCGGnnn", options),
       "Error calculating Tm for sequence AGCGGnnn: Error: Degenerate bases prohibited in Tm calculation of sequence AGCGGnnn"
     );
   });

packages/sequence-utils/src/calculateTm.js

@@ -11,20 +11,26 @@ const calcTmMethods = {
 
   A: -10.8, // Helix initiation for deltaS
   R: 1.987, // Gas constant (cal/(K*mol)).
-  C: 0.5e-6, // Oligo concentration. 0.5uM is typical for PCR.
-  Na: 50e-3, // Monovalent salt concentration. 50mM is typical for PCR.
+  primerConc: 0.0000005, // Oligo concentration. 0.5uM is typical for PCR.
+  monovalentCationConc: 0.05, // Monovalent salt concentration. 50mM is typical for PCR.
 
   /**
    * Calculates temperature for DNA sequence using a given algorithm.
    * sequence - The DNA sequence to use.
    * type - Either Teselagen.bio.tools.TemperatureCalculator.TABLE_BRESLAUER, TABLE_SUGIMOTO, or TABLE_UNIFIED
    * A - Helix initation for deltaS. Defaults to -10.8.
    * R - The gas constant, in cal/(K*mol). Defaults to 0.5e-6M.
-   * Na - THe monovalent salt concentration. Defaults to 50e-3M.
+   * monovalentCationConc - THe monovalent salt concentration. Defaults to 50e-3M.
    * return - Temperature for the given sequence, in Celsius.
    */
-  calculateTemperature: function (sequence, type, A, R, C, Na) {
+  calculateTemperature: function (
+    _sequence,
+    { type, A, R, primerConc, monovalentCationConc } = {}
+  ) {
+    const sequence = _sequence.toLowerCase();
     if (typeof type === "undefined") {
+      // type = this.TABLE_SUGIMOTO  ;
+      // type = this.TABLE_UNIFIED;
       type = this.TABLE_BRESLAUER;
     } else if (
       type != this.TABLE_BRESLAUER &&
@@ -40,11 +46,11 @@ const calcTmMethods = {
     if (!R) {
       R = this.R;
     }
-    if (!C) {
-      C = this.C;
+    if (!primerConc) {
+      primerConc = this.primerConc;
     }
-    if (!Na) {
-      Na = this.Na;
+    if (!monovalentCationConc) {
+      monovalentCationConc = this.monovalentCationConc;
     }
 
     const sequenceLength = sequence.length;
@@ -56,7 +62,7 @@ const calcTmMethods = {
     const deltaHTable = this.getDeltaHTable(type);
     const deltaSTable = this.getDeltaSTable(type);
 
-    const neighbors = []; // List goes in order: aa, at, ac, ag, tt, ta, tc, tg, cc, ca, ct, cg, gg, gt, gc
+    const neighbors = []; // List goes in order: aa, at, ac, ag, tt, ta, tc, tg, cc, ca, ct, cg, gg, ga, gt, gc
 
     neighbors.push(this.calculateReps(sequence, "aa"));
     neighbors.push(this.calculateNumberOfOccurrences(sequence, "at"));
@@ -87,16 +93,12 @@ const calcTmMethods = {
     }
 
     const temperature =
-      (-1000.0 * sumDeltaH) / (A + -sumDeltaS + R * Math.log(C / 4.0)) -
+      (-1000.0 * sumDeltaH) /
+        (A + -sumDeltaS + R * Math.log(primerConc / 4.0)) -
       273.15 +
-      16.6 * Math.LOG10E * Math.log(Na);
+      16.6 * Math.LOG10E * Math.log(monovalentCationConc);
 
-    // If temperature is negative then return 0.
-    if (temperature < 0) {
-      return 0;
-    }
-
-    return temperature.toFixed(2);
+    return temperature;
   },
 
   /**
@@ -125,6 +127,41 @@ const calcTmMethods = {
       return null;
     }
   },
+  // "AA/TT": -7.9, 7.9
+  // "AT/TA": -7.2, 7.2
+  // "AC/TG": -8.4, 8.4
+  // "AG/TC": -7.8, 7.8
+  // "TT/AA": -7.9, 7.9
+  // "TA/AT": -7.2, 7.2
+  // "TG/AC": -8.5, 8.2
+  // "TC/AG": -8.2, 8.5
+  // "CC/GG": -8.0, 8.0
+  // "CA/GT": -8.5, 8.5
+  // "CT/GA": -7.8, 7.8
+  // "CG/GC": -10.6, 10.6
+  // "GG/CC": -8.0, 8.0
+  // "GA/CT": -8.2, 8.2,
+  // "GT/CA": -8.4, 8.4
+  // "GC/CG": -9.8, 9.8
+
+  // aa, at, ac, ag, tt, ta, tc, tg, cc, ca, ct, cg, gg, ga, gt, gc
+
+  // "AA/TT": -22.2,22.2,
+  // "AT/TA": -20.4,20.4,
+  // "AC/TG": -22.4,22.4,
+  // "AG/TC": -21.0,21.0,
+  // "TT/AA": -22.2,22.2,
+  // "TA/AT": -21.3,21.3,
+  // "TC/AG": -22.2,22.2,
+  // "TG/AC": -22.7,22.7,
+  // "CC/GG": -19.9,19.9,
+  // "CA/GT": -22.7,22.7,
+  // "CT/GA": -21.0,21.0,
+  // "CG/GC": -27.2,27.2,
+  // "GG/CC": -19.9,19.9,
+  // "GT/CA": -22.4,22.2,
+  // "GA/CT": -22.2,22.4,
+  // "GC/CG": -24.4,24.4
 
   /**
    * @private

packages/sequence-utils/src/calculateTm.test.js

@@ -2,6 +2,12 @@ import calculateTm from "./calculateTm";
 import assert from "assert";
 describe("calculateTm", () => {
   it("should calculate the correct tm", () => {
-    assert.equal(calculateTm("atagagaggga"), 26.21);
+    assert.equal(calculateTm("atagagaggga"), 26.211404758492115);
+    assert.equal(calculateTm("AGCGGATAACAATTTCACACAGGA"), 67.27154960706082);
+    assert.equal(calculateTm("AGCGGATAACAATTTCAC"), 54.91103113095034);
+    assert.equal(calculateTm("AGCGGATAACAATTTcac"), 54.91103113095034);
+    assert.equal(calculateTm("ataataccgcgccacatagc"), 63.51394755261396);
+    assert.equal(calculateTm("AGCGGNNN"), -5.0392194500109255);
+    assert.equal(calculateTm("AGCGGnnn"), -5.0392194500109255);
   });
 });

packages/ui/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/ui",
-  "version": "0.4.16",
+  "version": "0.4.17",
   "main": "./src/index.js",
   "type": "module",
   "exports": {

packages/ui/src/utils/menuUtils.js

@@ -23,7 +23,14 @@ import {
 import fuzzysearch from "fuzzysearch";
 import classNames from "classnames";
 // https://github.com/palantir/blueprint/issues/2820
-export function MenuItemLink({ text, onClick, icon, navTo, active }) {
+export function MenuItemLink({ text, onClick, icon, navTo, active, disabled }) {
+  if (disabled) {
+    return (
+      <li className={Classes.POPOVER_DISMISS}>
+        <MenuItem icon={icon} disabled={true} text={text} />
+      </li>
+    );
+  }
   const handleLinkClick = e => {
     e.target.closest(`.${Classes.POPOVER_DISMISS}`).click();
   };
@@ -71,7 +78,6 @@ export const EnhancedMenuItem = compose(
   if (navTo) {
     MenuItemComp = MenuItemLink;
   }
-
   return (
     <MenuItemComp
       popoverProps={{
@@ -215,9 +221,14 @@ export const DynamicMenuItem = ({
     ...(doNotEnhanceTopLevelItem ? [ident] : enhancers)
   ].reduce((v, f) => f(v, context), def);
   let out;
-
   if (item.divider !== undefined) {
-    out = <MenuDivider {...(item.divider ? { title: item.divider } : {})} />;
+    out = (
+      <MenuDivider
+        {...(item.divider
+          ? { title: item.divider, className: item.className }
+          : {})}
+      />
+    );
   } else {
     const ItemComponent = item.component || EnhancedMenuItem;
     out = (