Skip to content

Commit

Permalink
Additions for COVID-19 project: Abundance of multiple pathogenic and …
Browse files Browse the repository at this point in the history
…host amplicons
  • Loading branch information
UBrau committed Oct 23, 2020
1 parent e915bd1 commit 6eda46a
Show file tree
Hide file tree
Showing 355 changed files with 1,264 additions and 1 deletion.
7 changes: 6 additions & 1 deletion 3_combine.pl
Original file line number Diff line number Diff line change
Expand Up @@ -106,8 +106,13 @@
print "[3] Done getting junction counts\n";


# Generate files for expression analysis
system "$path/R/combine_reads_expression.R -e $evTab -t $treatTab -d fwd -c $cores $outDir" and
die "[3] Error when combining reads for expression\n";
print "[3] Done generating tables for expression\n";


# Get PSI, RPM, pseudo counts etc. per well
mkdir $outDir."/welldata" unless (-e $outDir."/welldata");
system "$path/R/compute_psi_rpm.R -c $cores $outDir -e $evTab" and
die "[3] Error when calculating PSI etc.\n";
print "[3] Done computing PSI\n";
Expand Down
230 changes: 230 additions & 0 deletions R/combine_reads_expression.R
Original file line number Diff line number Diff line change
@@ -0,0 +1,230 @@
#!/usr/bin/env Rscript
### Combine read counts and RPM from raw counts per well for SARS-CoV-2 project
### U. Braunschweig 2020


libMissing <- !require(optparse, quietly=T)
if (libMissing) {stop("Failed to load R package 'optparse'")}

#### Options
args <- commandArgs(TRUE)

option.list <- list(
make_option(c("-e", "--eventTab"), type="character",
help="CSV file describing the amplicons - see README"),
make_option(c("-t", "--treatTab"), type="character",
help="CSV file describing the samples - see README"),
make_option(c("-d", "--direction"), default="both",
help="Which reads to use. 'fwd' for forward/R1, 'rev' for reverse/R1, or 'both for mean [%default]"),
make_option(c("-i", "--imbal"), default=1.5,
help="Maximum imbalance between fwd and rev reads before a warning is printed [%default]"),
make_option(c("-b", "--imbalCts"), default=20,
help="Minimum reads (average of fwd and rev) to do imbalance test [%default]"),
make_option(c("-c", "--cores"), default=1,
help="Number of CPUs [%default]")

)
parser <- OptionParser(option_list=option.list,
usage="usage: %prog [options] OUTDIR",
description="Combine raw reads from invidual samples for expression analysis")
opt <- parse_args(parser, args=args, positional_arguments=1)

inDir <- sub("/*$","", opt$args[1])

libMissing <- !require(parallel, quietly=T)
if (libMissing) {stop("Failed to load R package 'parallel'")}


### Function defs

combineCounts <- function(inDir, treat, junc, cores=1) {
### Reads individual raw well counts from the 'counts' folder and combine into one table

files <- list.files(file.path(inDir, "counts"), pattern=paste(treat$Batch[1], ".*W.*.counts.tab", sep=""), full.names=T)
fileBC <- sub(".*(W[0-9]+).*", "\\1", files)

if (length(files) == 0) {stop("Raw well data not found")}
if (!(all(treat$Barcode %in% fileBC))) {stop("Not all raw well data files were found")}
if (!all(fileBC == treat$Barcode)) {stop("Mismatch betwetween treatment table and found raw well data files")}

## Get total reads
mapFilesF <- dir(file.path(inDir, "map"), pattern=".*(R1|Fwd|fwd|Fw|fw)\\.stats\\.txt")
mapFilesR <- dir(file.path(inDir, "map"), pattern=".*(Rw|Rev|rev|Rv|rv)\\.stats\\.txt")
statsF <- lapply(file.path(inDir, "map", mapFilesF), read.delim, header=F)
statsR <- lapply(file.path(inDir, "map", mapFilesR), read.delim, header=F)
statsF <- do.call("rbind", statsF)
statsR <- do.call("rbind", statsR)

bcF <- sub(".+(W[0-9]+).*", "\\1", statsF[,1])
bcR <- sub(".+(W[0-9]+).*", "\\1", statsR[,1])
if (!all(bcF == bcR)) {stop("Mismatch between fwd and rev read stats files")}
if (!all(treat$Barcode %in% bcF)) {stop("Not all expected mapping stats files were found")}
names(statsF) <- names(statsR) <- c("file","unmapped","total","mappability")
rownames(statsF) <- rownames(statsR) <- sub("[^_]+_(.+)_[^_]+", "\\1", statsF[,1])
statsF <- statsF[match(treat$Barcode, bcF),]
statsR <- statsF[match(treat$Barcode, bcR),]

input <- mclapply(files, read.csv, sep="\t", header=F, mc.cores=cores)
counts <- sapply(input, "[[", 4)
inputLabel <- paste(input[[1]][,1], input[[1]][,2], sep="_")
geneCounts <- aggregate(counts, by=list(Gene=paste(input[[1]][,1], substr(input[[1]][,2], 1, 2), sep=".")), FUN=sum)

if (any(!is.na(junc$Label))) {
collapseJunc <- junc[!is.na(junc$Label),]
juncF <- strsplit(collapseJunc$JunctionsFw, split=",")
juncR <- strsplit(collapseJunc$JunctionsRv, split=",")

collapseLabel <- rep(NA, nrow(input[[1]]))
for (i in 1:nrow(collapseJunc)) {
collapseLabel[input[[1]][,1] == collapseJunc$Gene[i] & input[[1]][,2] %in% juncF[[i]]] <-
paste0(collapseJunc$Gene[i], ".fw.", collapseJunc$Label[i])
collapseLabel[input[[1]][,1] == collapseJunc$Gene[i] & input[[1]][,2] %in% juncR[[i]]] <-
paste0(collapseJunc$Gene[i], ".rv.", collapseJunc$Label[i])
}
eventCounts <- aggregate(counts, by=list(Event=collapseLabel), FUN=sum)
eventCounts <- data.frame(Gene=sub("(.*)\\.[^.]+", "\\1", eventCounts$Event), eventCounts)
subtractCounts <- aggregate(eventCounts[,-c(1,2)], by=list(Gene=eventCounts$Gene), FUN=sum)

out <- geneCounts[!(geneCounts$Gene %in% subtractCounts$Gene),]
tmp <- geneCounts[match(subtractCounts$Gene, geneCounts$Gene),]
tmp <- data.frame(Gene=paste0(subtractCounts$Gene, ".RNA"),
as.matrix(tmp[,-1]) - as.matrix(subtractCounts[,-1])
)
out <- rbind(out,
tmp,
data.frame(Gene=sub("A1","GEN",eventCounts$Event), eventCounts[,-c(1,2)])
)
out <- out[order(out$Gene),]
} else {
out <- geneCounts
}
outNames <- as.character(out$Gene)
out <- t(out[,-1])
colnames(out) <- outNames
rownames(out) <- treat$Barcode

out <- cbind(out,
totReads.fw = statsF[,"total"],
totReads.rv = statsR[,"total"],
mappedReads.fw = statsF[,"total"] - statsF["unmapped"],
mappedReads.rv = statsR[,"total"] - statsR["unmapped"],
mappability.fw = round(100 * (1 - (statsF[,"unmapped"] / statsF[,"total"])), 2),
mappability.rv = round(100 * (1 - (statsR[,"unmapped"] / statsR[,"total"])), 2)
)

out
}

avgFRcounts <- function(x, junc, direction=c("both","fwd","rev")[1], imbal=1.2, imbalCts=10) {
### Average forward and reverse read counts, or select one; Also check for imbalance more than 'imbal'
eventsFw <- sort(grep(".*\\.fw", colnames(x), value=T))
fwInd <- sapply(eventsFw, FUN=function(y) {grep(y, colnames(x))})
rvInd <- sapply(sub("\\.fw", ".rv", eventsFw), FUN=function(y) {grep(y, colnames(x))})

## Check balance of fwd and rev
bal <- abs(log(10 + x[,fwInd]) / log(10 + x[,rvInd]))
meanFR <- (x[,fwInd] + x[,rvInd]) / 2
warn <- (bal < 1 - log(imbal) | bal > 1 + log(imbal)) & meanFR > imbalCts
if (any(as.vector(warn))) {
for (i in which(apply(warn, MAR=2, any))) {
warning(length(which(warn[,i])), " imbalanced samples for ", colnames(meanFR)[i])
}
}

if (direction == "fwd") {
out <- x[,fwInd]
colnames(out) <- sub("\\.fw", "", colnames(out))
}
if (direction == "rev") {
out <- x[,rvInd]
colnames(out) <- sub("\\.rv", "", colnames(out))
}
if (direction == "both") {
if (is.list(fwInd) || is.list(rvInd)) {
stop("Forward and reverse read columns in raw counts file could not be matched for all events")
}

out <- round(meanFR)
colnames(out) <- sub("\\.fw", "", colnames(out))
}

out
}

main <- function(inDir, treat, junc, direction=c("both","fwd","rev")[1], cores=1, imbal=1.2, imbalCts=10) {
### Collect mapped read numbers from individual samples and creat tables with
### raw fwd and rev counts, average counts (if selected), and RPM

rawCounts <- combineCounts(inDir, treat, junc, cores=cores)
counts <- avgFRcounts(rawCounts, direction=direction, imbal=imbal,
junc = junc)
tmp <- counts[,-which(colnames(counts) %in% c("mappability","totReads"))]
rpm <- round(1000000 * tmp / rowSums(tmp), 1)

treatCols <- unlist(sapply(c("ID","Barcode","Batch","Replicate","Treatment","Type","Status"),
FUN=grep, x=names(treat)))
treat <- treat[,treatCols]

if (is.null(treat$Batch)) {
outName <- ""
} else {
outName <- paste0(treat$Batch[1], "_")
}
dirTag <- paste0("_", direction)

outDir <- file.path(inDir, "expression")
if (!dir.exists(outDir)) {dir.create(outDir, recursive=TRUE)}

write.csv(data.frame(treat, rawCounts, check.names=F),
file=file.path(outDir, paste0(outName, "CountsRaw.csv")))
write.csv(data.frame(treat, counts, check.names=F),
file=file.path(outDir, paste0(outName, "Counts", dirTag, ".csv")), row.names=F)
write.csv(data.frame(treat, rpm, check.names=F),
file=file.path(outDir, paste0(outName, "RPM", dirTag, ".csv")), row.names=F)

cat("Read and RPM files saved in", outDir, "\n")
}





### Body

## Check input
if (length(opt$args) != 1)
stop(print_help(parser))
if (is.null(opt$options$eventTab))
stop("eventTab must be provided")
if (is.null(opt$options$treatTab))
stop("treatTab must be provided")
if (!(opt$options$direction %in% c("both","fwd","rev")))
stop("direction must be one of 'both', 'fwd', or 'rev'")

## Load tables
treat <- read.delim(opt$options$treatTab)
treat <- treat[order(treat$Barcode),]

junc <- read.delim(opt$options$eventTab, as.is=T)


## Body
main(inDir, treat, junc,
direction = opt$options$direction,
cores = opt$options$cores,
imbal = opt$options$imbal,
imbalCts = opt$options$imbal
)

#opt <- list(
# options = list(
# treatTab = "~/bin/SPARpipe/examples/COVID-19/SampleTable.tab",
# eventTab = "~/bin/SPARpipe/examples/COVID-19/amplicons/EventJunctions.tab",
# direction = "fwd",
# imbal = 1.5,
# imbalCts = 20,
# cores = 1
# ),
# args = "~/bin/SPARpipe/examples/COVID-19/test_align/"
#)

27 changes: 27 additions & 0 deletions examples/COVID-19/PoC_ReadCount_Table.csv
Original file line number Diff line number Diff line change
@@ -0,0 +1,27 @@
fastq-file/sample name,PPIB,Ngene,Egene,RdRP,Sgene.RBD,Sgene.Poly,mapping%
W609_HEK293T-rep1,49152,0,1,1,3,2,90.85
W621_HEK293T-rep2,55368,5,0,2,2,0,96.94
W633_LTRI-20,23254,3,0,2,1,0,74.53
W645_LTRI-13,7400,1,0,0,1,1,77.05
W657_LTRI-35,11530,24023,3082,9911,15318,19653,98.47
W669_LTRI-36,11876,16764,1670,5815,8680,12000,98.36
W586_LTRI-32,49078,1752,146,222,1844,2198,97.57
W598_LTRI-28,5296,18336,3057,5551,6508,9692,90.48
W610_LTRI-27,0,8258,156,1392,4666,6028,96.22
W622_LTRI-33,24556,7527,502,1230,3654,1032,97.71
W634_LTRI-21,38302,7424,246,900,2002,4078,96.76
W646_LTRI-22,906,34718,3520,9420,14792,22242,97.48
W658_LTRI-34,1621,27632,3038,7954,13114,18448,98.09
W670_LTRI-24,2158,19434,2070,5063,9800,13128,98.35
W587_LTRI-26,279,31589,3312,8568,15040,22452,98.61
W599_LTRI-29,134,31968,4871,11048,15924,25968,98.52
W611_LTRI-30,507,27292,3476,9857,14336,20062,98.45
W623_LTRI-23,264,19518,3022,5348,11004,15160,98.48
W635_LTRI-31,20,17220,4682,8928,14429,19388,98.49
W647_LTRI-25,24,16955,5802,12460,15156,20241,98.52
W659_LTRI-18,3186,12088,3084,6093,8923,11260,98.25
W671_Twist2:-dil1,3,15862,4494,9988,14120,18706,97.43
W588_Twist2-dil2,1,14780,2266,6610,9346,14248,97.2
W600_Twist2-dil3,2,11194,4024,7262,8932,10612,96.77
W612_Twist2-dil4,1,9354,830,2240,5562,10107,93.83
W624_Twist2-dil5,0,0,202,0,797,4300,49.6
Binary file added examples/COVID-19/PoC_fastq_files.zip
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
27 changes: 27 additions & 0 deletions examples/COVID-19/SampleTable.tab
Original file line number Diff line number Diff line change
@@ -0,0 +1,27 @@
ID Replicate Batch Barcode Treatment
S163 R1 200423 W609 HEK293T-Qiagen_MIXE_30x
S164 R1 200423 W621 HEK293T-Norgen_MIXE_30x
S165 R1 200423 W633 LTRI-20_MIXE_30x
S166 R1 200423 W645 LTRI-13_MIXE_30x
S167 R1 200423 W657 LTRI-35_MIXE_30x
S168 R1 200423 W669 LTRI-36_MIXE_30x
S169 R1 200423 W586 LTRI-32_MIXE_30x
S170 R1 200423 W598 LTRI-28_MIXE_30x
S171 R1 200423 W610 LTRI-27_MIXE_30x
S172 R1 200423 W622 LTRI-33_MIXE_30x
S173 R1 200423 W634 LTRI-21_MIXE_30x
S174 R1 200423 W646 LTRI-22_MIXE_30x
S175 R1 200423 W658 LTRI-34_MIXE_30x
S176 R1 200423 W670 LTRI-24_MIXE_30x
S177 R1 200423 W587 LTRI-26_MIXE_30x
S178 R1 200423 W599 LTRI-29_MIXE_30x
S179 R1 200423 W611 LTRI-30_MIXE_30x
S180 R1 200423 W623 LTRI-23_MIXE_30x
S181 R1 200423 W635 LTRI-31_MIXE_30x
S182 R1 200423 W647 LTRI-25_MIXE_30x
S183 R1 200423 W659 LTRI-18_MIXE_30x
S184 R1 200423 W671 Twist2:50000_MIXE_30x
S185 R1 200423 W588 Twist2:5000_MIXE_30x
S186 R1 200423 W600 Twist2:500_MIXE_30x
S187 R1 200423 W612 Twist2:50_MIXE_30x
S188 R1 200423 W624 Twist2:5_MIXE_30x
13 changes: 13 additions & 0 deletions examples/COVID-19/ToDo
Original file line number Diff line number Diff line change
@@ -0,0 +1,13 @@
../../accessories/MakeJunctionsFASTA.R -e amplicons/JunctionLibraryElements_test200423.csv -p primers/PrimerChecking_SPARseq.optimized.COVD19_200423.csv -l 75

mkdir junctions/bowtie_indices
bowtie-build junctions/Junctions_fwd.fa junctions/bowtie_indices/Junctions_fwd
bowtie-build junctions/Junctions_rev.fa junctions/bowtie_indices/Junctions_rev


for f in fastq_files/200423_W*Fwd.fq.gz; do ../../2_align.pl --junc=amplicons/bowtie_indices/Junctions_fwd --outDir=test_align --trim3=1 --btopt="--best -n 3 -k 1 -m 1" ${f}; done
for f in fastq_files/200423_W*Rev.fq.gz; do ../../2_align.pl --junc=amplicons/bowtie_indices/Junctions_rev --outDir=test_align --trim3=1 --btopt="--best -n 3 -k 1 -m 1" ${f}; done

../../3_combine.pl --juncBase=amplicons/Junctions --eventTab=amplicons/EventJunctions.tab --treatTab=SampleTable.tab test_align

### Combine into one read table
8 changes: 8 additions & 0 deletions examples/COVID-19/amplicons/EventJunctions.tab
Original file line number Diff line number Diff line change
@@ -0,0 +1,8 @@
Gene Event Label Relative JunctionsFw JunctionsRv
004.PPIB NA NA NA fw1 rv1
006.Ngene NA NA NA fw1 rv1
008.Egene NA NA NA fw1 rv1
010.RdRP NA NA NA fw1 rv1
013.Sgene.RBD NA NA NA fw1 rv1
014.Sgene.Poly NA NA NA fw1 rv1
019.ACTB NA NA NA fw1 rv1
Original file line number Diff line number Diff line change
@@ -0,0 +1,8 @@
"gene","origin","event","structure","chrom","strand","C1.start","C1.end","C2.start","C2.end","C1.seq","C2.seq"
"004.PPIB","background","004.PPIP.ctrlM","C1-C2","chr15","-",64162852,64163155,64162041,64162154,"ACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGcgcccgccgcccgcccggagcccgcgagcaaccccagtcccccccacccgcgcgTGGCGGCGCCGGCTCCCTAGCCACCGCGGCCCCACCCTCTTCCGGCCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGGTCCGTCTTCTTCCTGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAG","GTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAG"
"006.Ngene","foreground","006.Ngene.SPARseq1","C1-C2","NC_045512.2","+",28867,28938,28939,29010,"TCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCT","GCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGT"
"008.Egene","foreground","008.Egene.SPARseq1","C1-C2","NC_045512.2","+",26203,26346,26347,26418,"ACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTT","ACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTT"
"010.RdRP","foreground","010.RdRP.SPARseq1","C1-C2","NC_045512.2","+",15406,15477,15478,15549,"GCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGA","ACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAAT"
"013.Sgene.RBD","foreground","013.Sgene.RBD.SPARseq1","C1-C2","NC_045512.2","+",22963,23034,23035,23106,"TATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCC","TTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTT"
"014.Sgene.Poly","foreground","014.Sgene.Poly.SPARseq1","C1-C2","NC_045512.2","+",23539,23610,23611,23754,"ATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCG","GGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTAT"
"019.ACTB","background","019.ACTB.ctrl.SPARseq2","C1-C2","chr7","-",5528281,5528719,5528004,5528185,"ATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGG","GCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAG"
14 changes: 14 additions & 0 deletions examples/COVID-19/amplicons/Junctions_amplicons.fa
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
>004.PPIB_C1C2
TGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACCTACGAATTGGAGATGAAGATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAA
>006.Ngene_C1C2
CCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAA
>008.Egene_C1C2
AGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTG
>010.RdRP_C1C2
TGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCAC
>013.Sgene.RBD_C1C2
ATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGT
>014.Sgene.Poly_C1C2
TATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTAC
>019.ACTB_C1C2
TCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACGAAACTACCTTCAACTCCATCATGAAGTGTGACGTGG
7 changes: 7 additions & 0 deletions examples/COVID-19/amplicons/Junctions_fwd.bed
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
004.PPIB_fw1_C1C2 0 75
006.Ngene_fw1_C1C2 0 75
008.Egene_fw1_C1 0 75
010.RdRP_fw1_C1C2 0 75
013.Sgene.RBD_fw1_C1C2 0 75
014.Sgene.Poly_fw1_C1C2 0 75
019.ACTB_fw1_C1C2 0 75
14 changes: 14 additions & 0 deletions examples/COVID-19/amplicons/Junctions_fwd.fa
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
>004.PPIB_fw1_C1C2
TGCTGCTGCCGGGACCTTCTGCGGCCGATGAGAAGAAGAAGGGGCCCAAAGTCACCGTCAAGGTGTATTTTGACC
>006.Ngene_fw1_C1C2
CCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTG
>008.Egene_fw1_C1
AGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCA
>010.RdRP_fw1_C1C2
TGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTG
>013.Sgene.RBD_fw1_C1C2
ATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCC
>014.Sgene.Poly_fw1_C1C2
TATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCT
>019.ACTB_fw1_C1C2
TCACCATTGGCAATGAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTG
8 changes: 8 additions & 0 deletions examples/COVID-19/amplicons/Junctions_fwd_minDist.tab
Original file line number Diff line number Diff line change
@@ -0,0 +1,8 @@
junction distEvent distAll
004.PPIB_fw1_C1C2 NA 54
006.Ngene_fw1_C1C2 NA 53
008.Egene_fw1_C1 NA 49
010.RdRP_fw1_C1C2 NA 49
013.Sgene.RBD_fw1_C1C2 NA 52
014.Sgene.Poly_fw1_C1C2 NA 52
019.ACTB_fw1_C1C2 NA 53
7 changes: 7 additions & 0 deletions examples/COVID-19/amplicons/Junctions_rev.bed
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
004.PPIB_rv1_C2C1 0 75
006.Ngene_rv1_C2C1 0 75
008.Egene_rv1_C2C1 0 75
010.RdRP_rv1_C2C1 0 75
013.Sgene.RBD_rv1_C2C1 0 75
014.Sgene.Poly_rv1_C2C1 0 75
019.ACTB_rv1_C2C1 0 75
Loading

0 comments on commit 6eda46a

Please sign in to comment.