Skip to content
/ RNAelem Public

RNAelem is a tool for learning secondary structural motifs from a set of RNA sequences.

License

Notifications You must be signed in to change notification settings

iyak/RNAelem

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

175 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

RNAelem is a tool for learning sequence-structure motifs from a set of RNA sequences.

Installation

git clone https://github.com/iyak/RNAelem.git
cd RNAelem
./waf configure --prefix=$HOME/local
./waf build test
./waf install

RNAelem is developed using Python3 and C++14, utilizing the numpy and scipy Python libraries. waf is a Python-based framework for configuring, compiling, and installing applications.

Toy Example

First, organize the input data, which includes:

  • A fasta file containing the positive sequence set
  • A list of search patterns

Search patterns are candidates for local secondary structures of motifs, expressed in dot-bracket notation with * indicating insertion region. For example, the search pattern ((.*.)) denotes a local secondary structure with an arbitrary internal structure flanked by a stem of at least two bases and an opening loop.

To demonstrate, consider finding a motif from 76 seed sequences in Rfam's tRNA family (RF00005) with 'CAU' as their anticodon. These sequences exhibit the tRNA clover structure. Specify a single hairpin loop as the search pattern:

cat pattern
(.....)

Execute RNAelem to train a motif:

elem pipeline -p positive.fa -m pattern
sequence logo graph diagram
tRNA profile tRNA secondary structure

The results include sequence logos and graph diagrams displaying conserved sequential profiles and stable local secondary structures simultaneously. The sequence logo indicates base and base pair compositions, with the y-axis measuring information in bits. The trained results default to a directory named elem_out/model-* in the current working directory:

train.model   # contains model parameters
prf.[png/svg] # sequence logo
rss.[png/eps] # graph diagram
train.raw     # final alignment of the model to input data
train.interim # interim parameters
log           # log file

To align the best-trained model to new data:

elem scan -s sequences.fa -m elem_out/model-1/train.model

The alignment results are stored in scan_out/scan.raw and include detailed probabilistic and structural alignments:

id: @1                                # sequence id
start: [-38.5222,-20.6088, ...        # log probability that motif starts at the position
end: [-inf,-inf,-inf,-inf, ...        # log probability that motif ends at the position
inner: [-38.5222,-20.6088, ...        # log probability that the position is inside motif
psihat: [0,0,0,1,...                  # viterbi alignment of Profile CFG
motif region: 11 - 22                 # estimation of motif region
exist prob: 0.699748                  # probability that motif exists in the sequence
seq: AUAAUAUUUAGGUGCAACUCCUAAAUCCGCUA # sequence
rss: OOOOOLLLLLLLHHHHHHHRRRRRRROOOOOO # viterbi alignment of secondary structure
mot:           ((.......))            # viterbi alignment of motif

Usage

To conduct de-novo motif discovery using RNAelem, multi-node parallelization on a cluster machine is required. This section describes the procedure for motif discovery on a single dataset, such as eCLIP data for an RBP. The training for each search pattern is distributed across nodes.

Manual Parallelization

This section explains how to perform manual parallel computing without using Grid Engine. Start by preparing a FASTA file containing the positive sequence set and a text file with the search patterns. On the master node, initialize the training with the following command:

elem init --positive a.fa --pattern-list p.txt

Here, a.fa represents the positive sequence set, and p.txt contains the search patterns. By default, a directory named elem_out is created to store the training results. Subsequently, conduct the training for each search pattern on parallel nodes:

elem train --elem-out elem_out --pattern-index 1 # 1...N

Here, N is the total number of search patterns in the list. Each node trains using a specific index from 1 to N, and the outcomes are saved in elem_out. If using a distributed filesystem, consolidate the elem_out contents at a single location to proceed with model selection:

elem select --elem-out elem_out --num-motifs 3

An enrichment score is calculated for each motif. These scores are compared, and the motifs with the highest scores are selected. Further refine the chosen model using all the training data. If multiple motifs are selected, distribute their training across the nodes:

elem refine --elem-out elem_out --pattern-index 1 # 1...M

Here, M is the number of motifs previously selected. Each node conducts parallel training using an index from 1 to M. Consolidate the training outputs in elem_out if the filesystem is distributed. The optimal motif is stored under elem_out/model-1, and the suboptimal motifs as elem_out/model-{2,...,M}.

Parallelization using Grid Engine

If the cluster machine supports job scheduling via Grid Engine, the train and refine steps can be replaced with the following commands:

elem train --elem-out elem_out --array
elem refine --elem-out elem_out --array

Alternatively, replace the entire procedure from init to refine with the following single command:

elem pipeline --positive a.fa --pattern-list p.txt --array

It is essential to configure the job execution commands based on the variant and version of the Grid Engine. At the beginning of script/elem, edit a Python dictionary to set these configurations:

ge={
    "cmd":"qsub",                               # command to submit a job
    "array":"-t 1-:N:",                         # :N: represents number of array-jobs
    "cwd":"-cwd",                               # option to set cwd as working directory
    "envvar":"-V",                              # option to pass environment variables
    "stdout":"-o :file:",                       # :file: is the file to write stdout
    "stderr":"-e :file:",                       # :file: is the file to write stderr
    "shell":"-S $SHELL",                        # option to set current shell as interpreter
    "memory":"-l mem_req=:mem:G,s_vmem=:mem:G", # :mem: is memory to use
    "cpu":"-pe def_slot :cpu:",                 # :cpu: is num of cpu to use
    "task_id":"SGE_TASK_ID",                    # env var to store task ID
    "sync":"-sync y",                           # option to wait until job terminates
    "other":"",                                 # any other options you want to specify
    }

About

RNAelem is a tool for learning secondary structural motifs from a set of RNA sequences.

Topics

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published