A collection of scripts of different programming languages addressing the naive matching problem inspired by this.
Probably the most fundamental task in bioinformatics analyses consists in the challenge of solving the problem of string matching.
Various approaches have been developed and are widely used in modern bioinformatic tools.
Since the amount of genomic data is continuously increasing, the demand for more and more efficient and powerful algorithms is growing.
One of the most basic string matching algorithm is the naive matching algorithm, where a sliding window of length k is compared to the pattern of interest.
Implementation of the naive matching problem in as many languages as possibly (primary) to compare them by efficiency and speed (secondary).
Improvements of already added languages are very welcome (please leave a note why its better)!
| Value | |
|---|---|
| Sequence: | AGCATCGATCGATCGATCGATCGATTGTCGATCGATCGATGT |
| Pattern: | AGT |
| Allowed mismatches: | 1 |
Comma separated values of all occurences of pattern 'AGT' with one mismatch allowed.
0,23,25,39
Choose a language of your preference and hit the keys! 😃