ampliseq elembio data test

[amakunin]

Raw reads from elembio sequencing platform - similar to Illumina, but with base qualities above 41 possible (up to 45 in this example).

These data are sufficient for reconstruction of ~35 consensus sequences with DADA2 - this is multiplex amplicon sequencing data generated with anospp panel https://github.com/malariagen/ano-spp/. Please note this does not contain any conventional markers, so it's only suitable for testing steps up to consensus sequence generation with something like

nextflow run nf-core/ampliseq --input samplesheet.tsv \
        --FW_primer AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --RV_primer AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA \
        --retain_untrimmed --illumina_pe_its --skip_qiime --skip_taxonomy --skip_barrnap

[amakunin]

Added by request from @d4straub, see nf-core/ampliseq#773

[d4straub]

Thanks a lot!
I didnt test the files but I assume you did. I'm going to add a test profile in nf-core/ampliseq#801 that uses those files. Just might take a little, recently not easy to allocate some time ;)