-
Notifications
You must be signed in to change notification settings - Fork 1
A javascript implementation of the Geo::DNA perl module, which is a perl port of the python "geoprint" library.
quile/geodna-js
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
NAME GeoDNA - Encode latitude and longitude in a useful string format There's an interactive demo of this at http://www.geodna.org/docs/google-maps.html SYNOPSIS <script type="text/javascript" src="geodna.js"></script> var geo = GeoDNA.encode( -41.288889, 174.777222, { precision: 22 } ); console.log( geo ); > etctttagatagtgacagtcta var coords = GeoDNA.decode( geo ); console.log( coords[0], coords[1] ); > -41.288889, 174.777222 VERSION 0.04 FEATURES * Simple API Generally you just convert coordinates back and forth with simple function calls. * Fast It's just basic space partitioning, really. DESCRIPTION This is a javascript version of the Python "geoprint" system that we developed a few years back at Action Without Borders. Its purpose is to encode a latitude/longitude pair in a string format that can be used in text databases to locate items by proximity. For example, if Wellington, New Zealand has the GeoDNA(10) value of etctttagat (which it does), then you can chop characters off the end of that to expand the area around Wellington. You can easily tell if items are close together because (for the most part) their GeoDNA will have the same prefix. For example, Palmerston North, New Zealand, has a GeoDNA(10) code of etctttaatc which has the same initial 7 characters. The original implementation of this in Python was by Michel Pelletier. This uses a concept that is very similar to Gustavo Niemeyer's geohash system ( http://geohash.org ), but encodes the latitude and longitude in a way that is more conducive to stem-based searching (which is probably the most common use of these hashing systems). FUNCTIONS GeoDNA.encode var code = GeoDNA.encode( latitude, longitude, options ); Returns a GeoDNA code (which is a string) for latitude, longitude. Possible options are: radians : true/false A true value means the latitude and longitude are in radians. precision : Integer (defaults to 22) number of characters in the GeoDNA code. Note that any more than 22 chars and you're kinda splitting hairs. GeoDNA.decode var coords = GeoDNA.decode( code, options ) Returns the latitude and longitude encoded within a GeoDNA code. radians : true/false If true, the values returned will be in radians. GeoDNA.neighbours var neighbours = GeoDNA.neighbours( code ); Returns an array of the 8 GeoDNA codes representing boxes of equal size around the one represented by code. This is very useful for proximity searching, because you can generate these GeoDNA codes, and then using only textual searching (eg. a SQL "LIKE" operator), you can locate any items within any of those boxes. The precision (ie. string length) of the GeoDNA codes will be the same as code. GeoDNA.neighboursWithinRadius var neighbours = GeoDNA.neighboursWithinRadius( code, radius, options ); Returns a raw list of GeoDNA codes of a certain size contained within the radius (specified in kilometres) about the point represented by a code. The size of the returned codes will either be specified in options, or will be the default (11). precision: N If this is present, the returned GeoDNA codes will have this size. GeoDNA.reduce var neighbours = GeoDNA.reduce( neighbours ) Given an array of GeoDNA codes of arbitrary size (eg. as returned by the "neighboursWithinRadius" function), this will return the minimal set of GeoDNA codes (of any sizes) that exactly cover the same area. This is important because it can massively reduce the number of comparisons you have to do in order to perform stem-matching, *and* more crucially, if you *don't* reduce the list, you *can't* perform stem matching. GeoDNA.boundingBox var coords = GeoDNA.boundingBox( code ); This returns an array containing two arrays: [ [ minimum latitude, maximum latitude ], [ minimum longitude, maximum longitude ], ] TODO * Add conveniences to help you with prefix-based searching At present you have to understand how this geometry works fairly well in order to get the most out of this module. * Bulletproofing It's not particularly well-tested. And there is the boundary-problem in that two very close-by locations can have radically different GeoDNA codes if they are on different sides of a partition. This is not a problem if you use the neighbouring GeoDNA codes of your reference point to do proximity searching, but if you don't know how to do that, it will make life hard for you. BUGS Please report bugs relevant to `GeoDNA' to <info[at]kyledawkins.com>. CONTRIBUTING The github repository is at git://github.com/quile/geodna-js.git SEE ALSO Some other stuff. AUTHOR Kyle Dawkins, <info[at]kyledawkins.com> COPYRIGHT Copyright 2012 by Kyle Dawkins
About
A javascript implementation of the Geo::DNA perl module, which is a perl port of the python "geoprint" library.
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published