Installation

1. Install ViennaRNA package and find its path
2. Change viennarna_path in Makefile to reflect the location of ViennaRNA on your system
3. Run make

Input parameters

$ ./AptaBlocks -h 

-N [integer(mandatory)]  the number of aptamer-'cargo' paris (For one aptamer and one cargo, N = 1)
-l [positve number]  \lambda in the oriningal paper. The larger the lower the binding energy of stikcy bridges is. default l = 1
-g [postive number]  The larger the larger the GC content. default g = 1
-i [mandatory] the name of the input file
-o [mandatory] the name of the output file

Input file format

1. All sequences are from 5'- -3'
2. Aptamer is a keyword to indicate the following is the sequence of an aptamer+sticky bridge
3. ssRNA is a keyword to indicate the following is a ssRNA + sticky bridge
4. dsRNA is a keyword to indicate the following is a dsRNA + sticky bridge
5. * indicates known bases and x denotes unknown sticky bridge sequences ('.' denotes something that would not bind to anything)
6. sticky bridges need to be complementary in the input file

Input file examples

Designing 5nt sticky bridge for one aptamer (UACCUGGUAC) and one ssRNA cargo (CUCGGCCUUA). (./Example/Input_ssRNA_cargo.txt)

>Aptamer
UACCUGGUACoooGGGGG
**********...xxxxx
>ssRNA
CUCGGCCUUACCCCC
**********xxxxx

Designing 5nt sticky bridge for one aptamer (UACCUGGUAC) and one dsRNA cargo (CUCUGCUUCGGUGUCGAAAUGAGAACC || UUCUCAUUUCGACACCGAAGCAGAG). (./Example/Input_dsRNA_cargo.txt)

>Aptamer
UACCUGGUACGGGGG
**********xxxxx
>dsRNA
CUCUGCUUCGGUGUCGAAAUGAGAACCCCCCC
***************************xxxxx
UUCUCAUUUCGACACCGAAGCAGAG

Designing a universal sticky bridge for the above ssRNA and dsRNA. (./Example/Input_universal_ssRNA_dsRNA.txt)

>Aptamer
UACCUGGUACGGGGG
**********xxxxx
>ssRNA
CUCGGCCUUACCCCC
**********xxxxx
>dsRNA
CUCUGCUUCGGUGUCGAAAUGAGAACCCCCCC
***************************xxxxx
UUCUCAUUUCGACACCGAAGCAGAG

Example of executing AptaBlocks

1. For one aptamer and one ssRNA cargo:

$ ./AptaBlocks -N 1 -l 2.5 -i ./Example/Input_ssRNA_cargo.txt -o ./Example/Output_ssRNA_cargo.txt 

2. For one aptamer and one dsRNA cargo:

$ ./AptaBlocks -N 1 -l 1.0 -i ./Example/Input_dsRNA_cargo.txt -o ./Example/Output_dsRNA_cargo.txt 

3. For one aptamer and one ssRNA and one dsRNA (universal sticky bridge)

$ ./AptaBlocks -N 2 -l 10 -i ./Example/Input_universal_ssRNA_dsRNA.txt.txt -o ./Example/Output_universal_ssRNA_dsRNA.txt.txt 

Output file

Take one aptamer and one ssRNA cargo for example, the output looks like:

1   Aptamer: UACCUGGUACGCUGU 
2   RNA: CUCGGCCUUAACAGC 
3   Probability with structure constraints: 0.90521 * 0.84481 = 0.76473 
4   Probability with structure constraints: 0.765  log_2: -0.386975
5   Energy of SE (converted in [0,1]): 0.619978 -5.710000 log_2: -0.689710
6   Probability of inter-interactions: 1.000000 log_2: 0.000000
7   number of consective identical: 0.000000
8   GC content: gcc_apta=0.600000, gcc_rna=0.600000, log_2(gcc_apta*gcc_rna)=-1.473931
9   Overall objectives: -1.076686

Explianation of the output file

1. Line 1 gives the aptamer sequence + the first part of the sticky brdige sequences (we use B1 to present it)
2. Line 2 gives ssRNA sequence + the secand part sticky brdige sequence (we use B2 to present it). B1 and B2 are complementary.
3. Line 3 gives the probability that B1 is unparied in aptamer-stick (the first number) and the probability of B2 is unpaired in cargo-stick (the second number)
4. Line 5 gives the hybridization energy of the sticky bridge (the second number (kcal/mol))
5. Line 6 gives the proability of not forming into undesired dimers (the first number)