FORAlign: Accelerating gap-affine DNA pairwise sequence alignment using t-blocks based on FOur Russians approach with linear space complexity
FORAlign is a library written in C++17 (C++20 for some features) for speeding up Hirschberg algorithm using Four-Russians approach in multithreads. It runs on Linux and Windows.
In order to test our methods, we use the benchmark program developed by WFA2, and we developed two programs to test our two methods: the align_benchmark
program has tested russians-multi
methods, and the multiswg_benchmark
has tested the condition-variable
method. The usage for align_benchmark
is shown as follows, our methods is in [Gap-affine (Smith-Waterman-Gotoh)], which called gap-affine-hirschberg-multi
and gap-affine-russians-multi
:
USE: ./align_benchmark -a ALGORITHM -i PATH
Options::
[Algorithm]
--algorithm|a ALGORITHM
[Indel (Longest Common Subsequence)]
indel-wfa
[Edit (Levenshtein)]
edit-bpm
edit-dp
edit-dp-banded
edit-wfa
[Gap-linear (Needleman-Wunsch)]
gap-linear-nw
gap-linear-wfa
[Gap-affine (Smith-Waterman-Gotoh)]
gap-affine-swg
gap-affine-swg-banded
gap-affine-wfa
gap-affine-hirschberg-multi
gap-affine-russians-multi
[Gap-affine-2pieces (Concave 2-pieces)]
gap-affine2p-dp
gap-affine2p-wfa
[Input & Output]
--input|i PATH
--output|o PATH
--output-full PATH
--input-ref|I PATH (Reference alignment file)
[Penalties]
--linear-penalties|p M,X,I
--affine-penalties|g M,X,O,E
--affine2p-penalties M,X,O1,E1,O2,E2
[Wavefront parameters]
--wfa-score-only
--wfa-span 'global'|'extension'|'ends-free[,P0,Pf,T0,Tf]'
--wfa-memory 'high'|'med'|'low'|'ultralow'
--wfa-heuristic STRATEGY
--wfa-heuristic-parameters P1,P2[,P3]
[STRATEGY='banded-static']
P1 = minimum-diagonal-band (e.g., -100)
P2 = maximum-diagonal-band (e.g., +100)
[STRATEGY='banded-adaptive']
P1 = minimum-diagonal-band (e.g., -100)
P2 = maximum-diagonal-band (e.g., +100)
P3 = steps-between-cutoffs
[STRATEGY='wfa-adaptive']
P1 = minimum-wavefront-length
P2 = maximum-difference-distance
P3 = steps-between-cutoffs
[STRATEGY='xdrop']
P1 = x-drop
P2 = steps-between-cutoffs
[STRATEGY='zdrop']
P1 = z-drop
P2 = steps-between-cutoffs
--wfa-max-memory BYTES
--wfa-max-steps INT
--wfa-max-threads INT (intra-parallelism; default=1)
[Russians Parameter]
--russian-block|B INT (Russians block size; default=50)
[Multithread Parameters]
--dp-threads|D INT
(SWG multithread/Hirschberg/Russians DP; default=1)
--divide-threads|E INT (Hirschberg/Russians main; default=1)
[Other Parameters]
--bandwidth INT
[Misc]
--check|c 'correct'|'score'|'alignment'
--check-distance 'indel'|'edit'|'linear'|'affine'|'affine2p'
--check-bandwidth INT
--plot
[System]
--num-threads|t INT
--batch-size INT
--progress|P INT
--verbose|v INT
--quiet|q
--help|h
The usage for multiswg_benchmark
is shown as follows, our method is gap-affine-swg-multithread
:
USE: ./align_benchmark -a ALGORITHM -i PATH
Options::
[Algorithm]
--algorithm|a ALGORITHM
[Gap-affine (Smith-Waterman-Gotoh)]
gap-affine-swg
gap-affine-swg-multithread
[Input & Output]
--input|i PATH
--output|o PATH
--output-full PATH
--input-ref|I PATH (Reference alignment file)
[Penalties]
--affine-penalties|g M,X,O,E
[Multithread Parameters]
--dp-threads|D INT
(SWG multithread DP; default=1)
--use-barrier|B use barrier to align (default=false)
[Misc]
--check|c 'correct'|'score'|'alignment'
[System]
--num-threads|t INT
--batch-size INT
--progress|P INT
--verbose|v INT
--quiet|q
--help|h
The tests in our paper is shown as follows:
Test method Name | Test Command (Run the following programs in bin folder) |
|
---|---|---|
benchmark | ./multiswg_benchmark -a gap-affine-swg -i $file_name -o $answer_name |
benchmark will output alignment CIGAR result for testing other methods |
wfa-high | ./align_benchmark -a gap-affine-wfa --wfa-memory high -i $file_name -I $answer_name -c alignment --wfa-max-threads $cpus |
|
wfa-med | ./align_benchmark -a gap-affine-wfa --wfa-memory med -i $file_name -I $answer_name -c alignment --wfa-max-threads $cpus |
|
wfa-low | ./align_benchmark -a gap-affine-wfa --wfa-memory low -i $file_name -I $answer_name -c alignment --wfa-max-threads $cpus |
|
wfa-ultra-low | ./align_benchmark -a gap-affine-wfa --wfa-memory ultralow -i $file_name -I $answer_name -c alignment --wfa-max-threads $cpus |
|
swg-barrier | ./multiswg_benchmark -a gap-affine-swg-multithread -i $file_name -I $answer_name -B -c alignment -D $cpus |
use -B to align with barrier but only supported in C++20 or newer |
swg-condition-variable | ./multiswg_benchmark -a gap-affine-swg-multithread -i $file_name -I $answer_name -c alignment -D $cpus |
|
hirschberg-single | ./align_benchmark -a gap-affine-hirschberg-multi -i $file_name -I $answer_name -c alignment -E $cpus -D 1 |
|
hirschberg-multi | ./align_benchmark -a gap-affine-hirschberg-multi -i $file_name -I $answer_name -c alignment -E $cpus -D $dpcpus |
$dpcpus is same as expr $cpus / 2
|
russians-multi-$t$ | ./align_benchmark -a gap-affine-russians-multi -i $file_name -I $answer_name -c alignment -E $cpus -D $dpcpus -B $blocksize |
$dpcpus is same as expr $cpus / 2 $blocksize is same as |
The test dataset is stored at https://github.com/malabz/FORAlign_testcase
. The test cases in paper is stored at https://github.com/malabz/FORAlign_testcase/blob/main/test-result/raw.tar.xz
, the compiled program is stored at https://github.com/malabz/FORAlign_testcase/tree/main/wfa2-test-prog
folder.
The WFA2 program is only supported in Linux. For Windows user please install WSL first. WSL instructional video: 1 or 2 (Copyright belongs to the original work).
Clone the FORAlign-testcase
repository and test:
#1 Download
git clone https://github.com/malabz/FORAlign-testcase
#2 Open the folder
cd wfa2-test-prog
#3 Test
./multiswg_benchmark
./align_benchmark
Clone the FORAlign
repository:
#1 Download
git clone https://github.com/malabz/FORAlign
#2 Open the folder and compile
cd FORAlign
make all THREADS=16
#3 Test
./bin/multiswg_benchmark
./bin/align_benchmark
FORAlign work as a programming library. This section shows how to use the C/CPP APIs of FORAlign to take two sequences as input and perform pairwise sequence alignment. Basically, the library file libforalign.a
and header file hirschberg.h
are needed to make the Hirschberg algorithm in FORAlign library work in your program, and the library file libswg.a
and header file parallel_swg.h
make the SWG algorithm in FORAlign library work in your program.
First, include the FORAlign alignment headers.
#include "foralign/hirschberg.h"
Next, configure the function arugments. The hirschberg library uses gap affine penalties. Note that mismatch, gap open penalty, gap extension penalty and russian block size must be positive values, the match penalty should be 0.
/*
M: match
X: mismatch
O: gap open
E: gap extension
table_size: russian table size
threads: program threads
*/
int O, E, M, X, table_size, threads;
threads = 16; O = 6; E = 2; M = 0; X = 4; table_size = 200;
Finally, call the Hirschberg_API
function. If you only want to get CIGAR string, call the hirschberg_cigar
function.
char *seq1 = "ATCGTAT";
char *seq2 = "TTTTCTAAA";
sequence_t type = DNA;
char *comp_seq1 = NULL, *comp_seq2 = NULL;
hirschberg_API(seq1, seq2, strlen(seq1), strlen(seq2), O, E, M, X, table_size, type, threads, &comp_seq1, &comp_seq2, 0, 1, threads / 2);
See library_example/foralign.c
for C API, library_example/foralign.cpp
for CPP API. For example, to compile and run example files, you need to link against the FORAlign library (-lforalign
) as follows:
make THREADS=16 # make the foralign library
mkdir -p bin
g++ -O3 library_example/foralign.cpp -pthread -L./lib -lforalign -o bin/foralign_cpp_example
# determine the link order
gcc -O3 library_example/foralign.c -o bin/foralign_c_example -L./lib -lforalign -pthread -lstdc++
./bin/foralign_cpp_example
./bin/foralign_c_example
First, include the FORAlign alignment headers.
#include "swg/parallel_swg.h"
Next, configure the function arugments. The swg library uses gap affine penalties. The calcluate matrix should be allocated before call the function:
affine_penalties_t args; args.match = 0; args.mismatch = 4; args.gap_opening = 6; args.gap_extension = 2;
affine_matrix_t mtx;
mtx.num_columns = len1; mtx.num_rows = len2;
mtx.columns = (affine_cell_t**)malloc(len1 + 1);
if(mtx.columns == nullptr) { fprintf(stderr, "Error: can not allocate. Program will exit.\n"); return 1; }
for(size_t i = 0; i < len2; ++ i)
{
mtx.columns[i] = (affine_cell_t*)malloc(len2 + 1);
if(mtx.columns[i] == nullptr) { fprintf(stderr, "Error: can not allocate. Program will exit.\n"); return 1; }
}
Finally, call the multithread_swg_compute_cv
function.
char* seq1 = "TCTTTACTCGCGCGTTGGAGAAATACAATAGT";
char* seq2 = "TCTATACTGCGCGTTTGGAGAAATAAAATAGT";
int threads = 16;
multithread_swg_init(threads);
multithread_swg_compute_cv(threads, &mtx, &args, seq1, strlen(seq1), seq2, strlen(seq2));
multithread_swg_free();
Afterwards, we can use the library to display the alignment result (e.g., the pairwise alignment result).
char *comp_seq1 = NULL, *comp_seq2 = NULL;
multithread_swg_traceback(&mtx, &args, strlen(seq1), strlen(seq2), seq1, seq2, &comp_seq1, &comp_seq2);
printf("Alignment result: %s\n%s\n", comp_seq1, comp_seq2);
See library_example/swg.cpp
for CPP API. For example, to compile and run example files, you need to link against the FORAlign SWG library (-lswg
) as follows:
make THREADS=16 # make the swg and foralign library
mkdir -p bin
g++ -O3 library_example/swg.cpp -pthread -L./lib -lswg -o bin/swg_cpp_example -lforalign
# The function `read_2_seqs` is defined in foralign library
./bin/foralign_swg_cpp_example
If you find any bug, welcome to contact us on the issues page or email us.
More tools and infomation can visit our github.