Skip to content

New tool addition: Samestr2 #7304

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Draft
wants to merge 3 commits into
base: main
Choose a base branch
from
Draft

New tool addition: Samestr2 #7304

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
3 commits
Select commit Hold shift + click to select a range
3d3b497
Initial SameStr wrappers
xens25 Sep 25, 2025
0216fc3
Add .shed.yml for SameStr tool
xens25 Sep 25, 2025
25739c6
Add Metaphlan datatables to Samestr
SaimMomin12 Sep 25, 2025
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
2 changes: 2 additions & 0 deletions tools/samestr/.shed.yml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,2 @@
name: samestr
owner: iuc
14 changes: 14 additions & 0 deletions tools/samestr/samestr_compare.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_compare" name="SameStr Compare" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_convert.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_convert" name="SameStr Convert" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_extract.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_extract" name="SameStr Extract" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_filter.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_filter" name="SameStr Filter" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_merge.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_merge" name="SameStr Merge" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_stats.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_stats" name="SameStr Stats" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
14 changes: 14 additions & 0 deletions tools/samestr/samestr_summarize.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,14 @@
<tool id="samestr_summarize" name="SameStr Summarize" version="0.1.0+galaxy0" python_template_version="3.5" profile="21.05">
<requirements>
</requirements>
<command detect_errors="exit_code"><![CDATA[
TODO: Fill in command template.
]]></command>
<inputs>
</inputs>
<outputs>
</outputs>
<help><![CDATA[
TODO: Fill in help.
]]></help>
</tool>
2 changes: 2 additions & 0 deletions tools/samestr/test-data/test-db-with-one-marker.fasta
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,2 @@
>13076__A0A2I1PE66__CYJ72_10760 UniRef90_A0A2I1PE66;k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Aerococcaceae|g__Globicatella|s__Globicatella_sanguinis;GCA_002847845
ATGCTTGAAATGTATATCCAAGGTGTCTCTACAAGGAAAGTTTCGAAAGTTATTGAAAATTTATGTGGGAAAACCTATTCTAAATCATTTGTCTCTTCTCTTACGAAACAACTGGATGAAGAGGTTCGACAATGGCGTCATCACGATTTAAGTCCTGTCCAATACGCTTACCTAGTGGTGGATGTTATTTATATAAAAGTAAGAGAAAATCATAAGGTTGTATCCAAAGCGTGCCATATCGCTATTGGGATTAGTGAAGAAGGAAAACGAAGACTCCTTGGTTTTGACATCAGTGATGGCGAAAGTGATTACTCTTGGTCTCGTTTCTTTAACCACTTAAAAGAAAGAGGCCTAAATGGCCTTAAAATGGTCATATCTGATGCACACACGGGTCTAGTAAAAGCAATTAAGGAAAACTTCCTGAATGTTTCTTGGCAAAGATGTCAGGTTCACTTCTTAATGTATTTGGCAATAGGGAATTGCGTTAAACGGCAATTAATTTTGTATGCCACTTGCCATCACTATCTACTCATGAATTAA
1 change: 1 addition & 0 deletions tools/samestr/test-data/test-db-with-one-marker.json
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1 @@
{"markers": {"13076__A0A2I1PE66__CYJ72_10760": {"clade": "s__Globicatella_sanguinis", "ext": [], "len": 540, "score": 0, "taxon": "k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Aerococcaceae|g__Globicatella|s__Globicatella_sanguinis"}}, "taxonomy": {"k__Bacteria|p__Firmicutes|c__Bacilli|o__Lactobacillales|f__Aerococcaceae|g__Globicatella|s__Globicatella_sanguinis|t__GCA_002847845": ["2|1239|91061|186826|186827|13075|13076", 2411251]}, "merged_taxon": {}}
180 changes: 180 additions & 0 deletions tools/samestr/test-data/test-db-without-one-marker.fasta
View file
Open in desktop

Large diffs are not rendered by default.

1 change: 1 addition & 0 deletions tools/samestr/test-data/test-db-without-one-marker.json
View file
Open in desktop

Large diffs are not rendered by default.

182 changes: 182 additions & 0 deletions tools/samestr/test-data/test-db.fasta
View file
Open in desktop

Large diffs are not rendered by default.

1 change: 1 addition & 0 deletions tools/samestr/test-data/test-db.json
View file
Open in desktop

Large diffs are not rendered by default.

Binary file added tools/samestr/test-data/test-db/test-db.1.bt2l
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.2.bt2l
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.3.bt2l
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.4.bt2l
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.pkl
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.rev.1.bt2l
View file
Open in desktop
Binary file not shown.
Binary file added tools/samestr/test-data/test-db/test-db.rev.2.bt2l
View file
Open in desktop
Binary file not shown.
11 changes: 11 additions & 0 deletions tools/samestr/test-data/test_database_versioned.loc.test
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,11 @@
# Tab separated with 5 columns:
# - value (Galaxy records this in the Galaxy DB)
# - name (Galaxy shows this in the UI)
# - dbkey
# - path (folder name containing the Kraken DB)
# - db version (whether it is SGB of Metaphlan v4 or not)
test-db-20210409 "Test Database" test-db ${__HERE__}/test-db SGB
# the TOY DB should be called in tests with the hidden test parameter enables this will make Metaphlan
# download the data to the JWD
mpa_vJan21_TOY_CHOCOPhlAnSGB mpa_vJan21_TOY_CHOCOPhlAnSGB mpa_vJan21_TOY_CHOCOPhlAnSGB_202103 ./ SGB
# mpa_vJun23_CHOCOPhlAnSGB_202403 mpa_vJun23_CHOCOPhlAnSGB_202403 mpa_vJun23_CHOCOPhlAnSGB_202403 ${__HERE__}/mpa_vJun23_CHOCOPhlAnSGB_202403/ SGB
4 changes: 4 additions & 0 deletions tools/samestr/tool-data/metaphlan_database.loc.sample
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,4 @@
#This is a sample file distributed with Galaxy that enables tools
#to use a directory of metagenomics files.
#file has this format (white space characters are TAB characters)
#02_16_2014 MetaPhlAn2 clade-specific marker genes db_v20 /path/to/data SGB_or_legacy
7 changes: 7 additions & 0 deletions tools/samestr/tool_data_table_conf.xml.sample
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
<?xml version="1.0"?>
<tables>
<table name="metaphlan_database_versioned" comment_char="#">
<columns>value, name, dbkey, path, db_version</columns>
<file path="tool-data/metaphlan_database_versioned.loc"/>
</table>
</tables>
7 changes: 7 additions & 0 deletions tools/samestr/tool_data_table_conf.xml.test
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -0,0 +1,7 @@
<?xml version="1.0"?>
<tables>
<table name="metaphlan_database_versioned" comment_char="#">
<columns>value, name, dbkey, path, db_version</columns>
<file path="${__HERE__}/test-data/test_database_versioned.loc.test"/>
</table>
</tables>
Loading