First try #13
Workflow file for this run
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
name: Test Pull Request | |
on: [pull_request] | |
jobs: | |
build: | |
runs-on: ubuntu-latest | |
strategy: | |
matrix: | |
python-version: [3.9, '3.10', '3.11'] | |
steps: | |
- uses: actions/checkout@v2 | |
- name: Testing with version ${{ matrix.python-version }} | |
uses: actions/setup-python@v2 | |
with: | |
python-version: ${{ matrix.python-version }} | |
- name: Install Python requirements | |
run: | | |
python -m pip install --upgrade pip | |
pip install -r requirements.txt | |
pip install pytest | |
- name: Install Java | |
uses: actions/setup-java@v4 | |
with: | |
distribution: 'oracle' | |
java-version: '21' | |
- name: Install RNAFold | |
run: | | |
wget https://www.tbi.univie.ac.at/RNA/download/sourcecode/2_6_x/ViennaRNA-2.6.4.tar.gz | |
tar -zxvf ViennaRNA-2.6.4.tar.gz | |
cd ViennaRNA-2.6.4 | |
./configure | |
make | |
sudo make install | |
pwd | |
- name: Run Tests | |
run: | | |
pwd | |
ls | |
echo "about to echo the path" | |
echo "1111111" | |
ls /home/runner/work/RNAFoldAssess/RNAFoldAssess/ | |
# /home/runner/work/RNAFoldAssess/RNAFoldAssess/ViennaRNA-2.6.4/bin/RNAfold GUAUCCACGCGAGUAGCGUGGAUGCAAAAAAAUAAUAAUAUGGGUGUGGAACUACAGGCAGUAGGGGAAACCCUACUGAACUACCUGCCACACCCUAAGUUAUUAUUUUAC | |
pip install -e . | |
# pytest /home/runner/work/RNAFoldAssess/RNAFoldAssess/tests |