RNAStructViz has been tested on Mac OSX 10.14, Ubuntu Linux, Linux Mint, and CentOS Linux.
Yes! If you are running OSX 10.14 (Mojave) and Homebrew is already installed, it should be as simple as:
$ brew install gtDMMB/core/RNAStructVizSee the Mac OSX Install for more information.
Certainly; this is the default method on all non-Mac platforms. See Linux/Unix Source Install for more information.
A local install from source should be possible; see the specific instructions.
Minimally, we require the FLTK windowing library (v1.4.x) with integrated Cairo support enabled. We use the mostly standardized OpenSSL and Boost libraries to support portable string hashing and file system operations across the platforms we support. RNAStructViz also makes use of the ViennaRNA library in C++ to implement the the radial layout viewer.
Maintaining consistent binary packages that are both up-to-date with the most current software and tested to be bug-free on all possible platform use cases is a difficult task. We have made the decision not to support automated binary packages on Linux -- even though there is a Mac OSX equivalent installer that we do maintain. Most Linux users will have no problem following our detailed installation instructions for compiling RNAStructViz from source.
Unfortunately, due to the particular needs of recent Mac users for compiling the FLTK library, it is not possible to use these brew formulas from the gtDMMB tap on Linux with a working install of linux-brew.
We are unable to provide Windows-specific support at this time, but it just might be possible to install from source. If you succeed, please let us know.
Although we cannot trouble-shoot Windows specific issues at this time, please do let us know about the problem you encountered. If we can duplicate it on one of our non-Windows developer systems, then we should be able to debug the issue for you.
Note that we are currently unable to guarantee support for OSX releases 10.15.x (codename Catalina). However, we are working on fixing compatibility issues on this platform (see this note on Mac platform support). We have spent a considerable amount of time testing on Mac OSX 10.14.x (codename Mojave) and are able to guarantee that RNAStructViz works well on this Apple release of OSX. Please use OSX 10.14.x if at all possible to run RNAStructViz on Mac!
I'm suddenly getting unusual library errors or compiler messages building from source. How do I fix this?
If you have successfully installed RNAStructViz before and are suddenly getting strange errors, it's time to upgrade your system libraries and versions of our software to the latest versions.
On Mac OSX with Homebrew, this can be accomplished by running
$ brew update
$ brew reinstall gtDMMB/core/rnastructvizFor installations of the software which are compiled from source without an automated package, upgrading to the latest release will require recompiling RNAStructViz from source:
$ git pull origin master
$ make clean && makeYou may also consider upgrading to the most recent stable versions of the libcairo and fltk libraries before recompiling a new version of RNAStructViz.
Recent releases of Apple's OSX have been seen to generate software crashes due to conflicts with OS internals and the cycle of ever evolving open source libraries. We provide a development brew formula for FLTK 1.4.x which is not currently included in the official Homebrew sources on Mac to patch known graphics breakage since Mojave.
Why do the Linux from-source install instructions require building FLTK from scratch instead of using a package manager like apt-get to put these libraries on the system?
This is a semi-complicated question that has shown up in our user tests. We require a non-standard compile option that goes into the FLTK build process to enable core libcairo support, which we make extensive use of with our graphics processing routines. There is technically an apt package to install FLTK with libcairo support enabled, though in our testing it was unreliable.
We support the standard RNA secondary structure formats: CT (nopct) file data and DOT (Dot-Bracket) input sources. RNAStructViz also accepts a semi-standard text file format specified with helix triples. This helix triple file format is modeled after the output formats of a few of the more widely used sampling software utilities used to generate RNA secondary structure data. Historically, RNAStructViz has supported the semi-antique BPSEQ file format, though this functionality has not been recently tested by our developers.
Note that vanilla FASTA files contain only sequence data (without base pairing data) and therefore are only supported as an input format by RNAStructViz using an adaptation of the ViennaRNA Boltzmann sampling routines (currently only available as an experimental, non-default feature). One way to generate secondary structure data that RNAStructViz is capable of rendering is to use the RNAfold utility from the ViennaRNA suite of programs:
$ RNAfold -v hepatitis-rfam.fasta
Processing 1. input file "hepatitis-rfam.fasta"
UUAAACAAAUUUUCUUAAAAUUUCUGAGGUUUGUUUAUUUCUUUUAU-CAGUAAAU
.((((((((((((............))))))))))))................... ( -6.60)
$ cp hepatitis-rfam.fasta hepatitis-rfam.dbn
$ RNAfold -v hepatitis-rfam.fasta | tail -n1 | cut -d" " -f1 >> hepatitis-rfam.dbnThe resulting *.dbn file containing the sampled secondary structure is now compatible with our application.
Are there sample RNA secondary structures available for me to explore with this application the first time I run it?
Please see the first run instructions page for how we recommend new users configure their fresh installs of RNAStructViz. Yes, there are in fact many sources of RNA structure files which are supported by RNAStructViz. Our default installation ships with a directory containing several example CT and Dot-Bracket (DOT) files for new users. These files can be viewed in the source code at this link. Other standardized sources such as the NCBI databases contain sample RNA structures. We also include examples files documenting our custom file formats for Boltzmann samples (historical support, supports multiple samples) and the newer helix triple file format.
Yes, but for most of our supported file formats each structure must be contained in a separate input file. Users can load multiple files at once using SHIFT or CTRL key presses, or by clicking the Select All button at the lower left of the file input window. The input files are then loaded into the RNAStructViz GUI for viewing where they are grouped into folders by the nucleotide sequence data associated with each secondary structure. Our application tries to guess at descriptive folder names obtained from the file comment lines and/or file path naming schemes. There are configuration options and checkboxes in our GUI that enable the user to save the descriptive folder names or user input folder names so that this data can be auto-loaded in later sessions (see configuration options). This feature is useful to users of RNAStructViz working with a large number of samples that they wish to load at once.
RNAStructViz will not load duplicate FILES (e.g., files on disk with the same basename), but it will by default load duplicate structures. If you do not want the application to load duplicate STRUCTURES even though they are specified in different FILES, then you can see the procedure to solve this issue in point (7) on the known limitations page.
Can I change the default directory where RNAStructViz searches for structure files? What about updating default save directories for exported files like PNG images and CSV stats output?
Yes! This is a default, easy to locate setting the the configuration (user preferences) window. You can access this window to change the default location by clicking on the "User Config" button in the left-hand-side main window pane (under the label: "Actions"). Note that when you navigate to a new directory to select new structure files after clicking on "Load Files", or after you export a PNG image or CSV stats output file to a new directory, this corresponding setting is automatically updated so that the search path is the most recently accessed directory. There are distinct settings for the structure search directory and the export file directory, respectively. A summary of the image and text based export file formats we support is found here.
I always use RNAStructViz to visualize sequences X, Y, and Z? Is there a way to automatically load my most used structures for these sequences every time the application starts?
Yes! There is now a directory in the user's home directory, ~/.RNAStructViz/AutoLoad/, that when populated with files in the formats we support allows for just this behavior. That is, all files contained in this directory will automatically be loaded into RNAStructViz when the application is started. To add specific structures to this directory from the GUI, notice that when you display a sequence folder in the right-hand-side main folder window (see diagram below), each structure displayed in the folder has a chain or "link" icon displayed next to it. By clicking on this icon, you can toggle the status for whether the loaded structure will be added to the list of structures automatically pre-loaded into the application at runtime. You can mouse over this icon to see a tooltip text summary of the auto-loading status of the particular structure.
Check the known limitations page first to see if this is documented. If your concern is not listed there, please post a new issue to document your problems. Users are also welcome to contact us to communicate issues with their experiences running RNAStructViz, or to request new features in the software.
It can easily visualize pseudoknots in the arc diagram format, when the base pairs are specified in a CT file format. However, we note that the radial diagram option accessible from the main arc diagram zoom window will generate the corresponding pseudoknot-free structure when possible. When secondary structures are input to RNAStructViz in DBN file format, we associate the characters <{ with the same meaning as ( and >} each as though a ) character is specified. External applications with extended options for pseudoknot processing may handle these DBN type structures differently. For users that want a richer set of visualizations and diagrams to analyze structures containing pseudoknots, we recommend also using the VARNA application from our software comparisons page.
The zoom box will disappear when the program thinks you are trying to select a new zoom box. To prevent this from happening, refocus the window by clicking on the window title.
Be sure to check the full contents of the main WIKI page. The topics documented by the WIKI are organized alphabetically by topic on the right-hand-side navigation pane visible on every page. If you still cannot find an answer to your question here, you can post a new thread to our GitHub issues page. Note that for reporting new bugs that come up in your usage of RNAStructViz, or before requesting new features to be added to future releases of this software, you should first check the guidelines for posting new issues page.